Angles. Angles. Curriculum Ready.

Size: px
Start display at page:

Download "Angles. Angles. Curriculum Ready."

Transcription

1 ngles ngles urriculum Redy

2

3 ngles mesure the mount of turn in degrees etween two lines tht meet t point. Mny gmes re sed on interpreting using ngles such s pool, snooker illirds. lck ll?c White ll?c Write down some other sports/gmes tht you cn think of tht require n understing of ngles: Give this go! While performing circulr llet move, net turned the first hlf esily then with some extr effort, mde it 5 of the remining wy round. ow mny degrees ws net wy from 6 completing the full circle? int: hlf circle is 180 degrees.?c Strt position Work through the ook for gret wy to solve this ngles SRIS 10 TI 1

4 ow does it work? ngles rts of n ngle ngles re formed when two stright rys extend from common point. The mount of rottion swept from one rm to the next in degrees is how they re mesured Rys re stright lines with n rrow on one end only. rm ngle swept y rms in degrees ( c) Vertex rm Rys tht form n ngle re clled rms Nming ngles These two methods of nming use the symol +in front to men 'ngle'. Nme these two ngles: R Method 1 + or + + R or + R The letter t the vertex is lwys written in the middle Method For ngles like these, you cn just use the letter t the vertex If there is more thn one ngle t the sme point, you must use method 1 to reference the ngle properly. Nme these ngles mrked with dot: K L is shred y oth ngles (ommon rm) + or + + KN or + NK N M 2 10 ngles SRIS TI

5 ow does it work? our Turn ngles rts of n ngle 1 ighlight the section of the ngle tht mtches the lel underneth. c RTS F N NGL * RTS F N NGL *.../.../20... rm rm The vertex d e f The ngle swept The rm shred y oth ngles R The ngle swept y the rms 2 Write down the prts of the ngles tht hve een highlighted elow. c d e f M S R L N ngles SRIS 10 TI 3

6 ow does it work? our Turn ngles Nming ngles 1 Nme ech of these ngles. c G NMING NGLS * NMING NGLS *.../.../20... F K 2 Nme ech of the ngles mrked with: dot squre M c N W F 3 Nme the rm common to oth mrked ngles in question 2, (write no rm common if there isn t one). c 4 Nme the ngles indicted in ech of these: c K F G L M = = 4 10 ngles SRIS TI

7 ow does it work? ngles ngle types This tle shows how ngles re clssified y their size. icture Size Nme etween 0c 90c or cute ngle 0c c xctly 90c Smll ox mens 90c or + = 90c Right ngle etween 90c 180c or 90c c tuse ngle xctly 180c Vertex or + = 180c Stright ngle etween 180c 360c or 180c 1 reflex c + could lso e n otuse (or cute) ngle, so include the word reflex in front Reflex ngle xctly 360c Reflex ngle Vertex / or + = 360c or Full rottion ngles SRIS 10 TI 5

8 NGL TS * NGL TS * NGL TS * ow does it work? our Turn ngles ngle types 1 Sketch lel ngles tht mtch ech of these descriptions: tuse ngle + cute + R.../.../20... c Right-ngle + MLN (int: rememer the ox) d Reflex + GU e Full revolution + KL f Stright + F 2 Fill in the tle elow with ll the ngles you cn find mtching the types in the digrm elow: R S U T V W cute ngle Right ngle tuse ngle Stright ngle Reflex ngle + RS + RS + RW + R reflex + RW 6 10 ngles SRIS TI

9 ow does it work? ngles Using protrctor to mesure ngles The mount of turn etween ech rm is mesured in degrees with the id of protrctor. Mesure the size of + Step 1: Set up protrctor to mesure Rememer: the vertex is the pointy it lce the centre mrker on the protrctor t the vertex Line up one of the rms with 0cmrk Step 2: Red the ngle Mesure with the outside scle s it strts with 0c ` + = 120c The two scles on protrctor enle us to mesure ngles from either direction. Mesure the size of + Step 1: Set up protrctor to mesure Line up one of the rms with 0cmrk lce the centre mrker on the protrctor t the vertex Step 2: Red the ngle Mesure with the inside scle s it strts with 0c ` + = 65c ngles SRIS 10 TI 7

10 ow does it work? our Turn ngles Using protrctor to mesure ngles 1 Write down the size (mount of turn in degrees) of these mesured ngles. R ` + = ` + R = c d K L ` + LK = ` + = 2 Write down the size of the ngles indicted elow ech digrm. ` + = ` + = c d ` + = ` + = 8 10 ngles SRIS TI

11 USING RTRTR T MSUR NGLS * ow does it work? our Turn ngles Using protrctor to mesure ngles 3 Try these trickier ones! R S.../.../20... T ` + RS = ` + = 4 Use protrctor to mesure the size (mount of turn in degrees) etween the rms for these four ngles: ` + = ` + = c d ` + = ` + = ngles SRIS 10 TI 9

12 ow does it work? our Turn ngles Using protrctor to mesure ngles 5 Mesure ech cute ngle etween the stright supports on ert the spider s we mtch the letter with the correct size elow. T L U I R S N V 44c 10c 24c 30c 20c 40c 35c 52c 27c 22c 56c ngles SRIS TI

13 ow does it work? ngles Using protrctor to mesure reflex ngles Most protrctors only mesure ngles up to 180c, so mesure the ngle you cn go from there. Mesure the size of reflex + R Step 1: Mesure the otuse + R tuse + R = 140c Step 2: Sutrct the size of the otuse ngle from 360c 140c R tuse + R + reflex + R = 360c ( full revolution) R ` Reflex + R = 360c - 140c = 220c ere is nother exmple with n cute ngle. Mesure the size of reflex Step 1: Mesure the cute + F + F Step 2: Sutrct the size of the cute ngle from 360c F 25c tuse + F + reflex + F = 360c ( full revolution) F ` Reflex + F = 360c - 25c = 335c ngles SRIS 10 TI 11

14 USING RTRTR T MSUR RFL NGLS * ow does it work? our Turn ngles Using protrctor to mesure reflex ngles 1 lculte the size of these reflex ngles. L K ` Reflex + = 360c - = ` Reflex + LK = 360c - = c d T U V ` Reflex + = 360c - = ` Reflex + TUV = 360c - = 2 Mesure write down the size of the reflex ngle for ech of these: M L ` Reflex + LMN = N c.../.../20... I ` Reflex + = ` Reflex + I = ngles SRIS TI

15 Where does it work? ngles djcent ngles ngles tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. Nme the djcent cute ngles in this digrm rm is shred y + + Sme vertex point for is djcent to + djcent simply mens 'next to' ere is the officil wy to sy it: The rm is common to oth ngles. The vertex is common to oth ngles. ere is n exmple where ngles with common rm vertex overlp. Nme ll the otuse ngles djcent to + U V W U rm U is lso common to these otuse ngles + UW + U The vertex is common to ll ngles rm is lso common to these otuse ngles: + V, + + W + U is djcent to the otuse ngles + UW, + U, + + W. e creful: g: + V + U shre common rm vertex, ut they re not djcent ecuse they overlp. U V rm vertex common to oth ngles SRIS 10 TI 13

16 NT NGLS * NT NGLS * Where does it work? our Turn ngles djcent ngles 1 Nme pir of djcent cute ngles in ech of these digrms: K L.../.../20... N M 2 Nme one reflex ngle ll the cute ngles djcent to these ngles mrked with dot. W Rememer to write the word reflex infront of the reflex ngles T (iii) U S (iv) R IG TUMS U IF U FIN LL FUR * 3 rw n otuse ngle lel it + R. rw n cute ngle + S djcent to it. 4 ch of these ngles shre n rm. xplin why they re not djcent to ech other. N M + MN + N MN + N re not djcent ecuse: + + re not djcent ecuse: ngles SRIS TI

17 Where does it work? ngles omplementry supplementry ngles These specil nmes re given to pirs of ngles tht dd together to totl of 90c or 180c. omplementry ngles re pir of ngles tht mke right-ngle (90c) when put together. lculte the size of + if it is the complement of + Rememer like this: omplementry ngles mke orner. 50c Size of = 90c ` c = 90c ` + = 40c If you drw complementry ngles djcent to ech other, you will mke right-ngle! + + re complementry ngles 40c = 50c ere is nother exmple. Nme the pir of complementry ngles in this digrm W 42c 47c V 45c 43c Look for pir of ngles tht dd to 90c U + UV + + = 43c + 47c = 90c ` + UV + re complementry ngles ngles SRIS 10 TI 15

18 Where does it work? ngles Supplementry ngles re pir of ngles tht mke stright-ngle (180c) when put together. lculte the supplement of 132c The supplement of 132c is: 180c - 132c = 48c Supplementry ngles dd to 180c lculte the size of n ngle supplementry to + W S Rememer like this: Supplementry ngles mke Stright ngle. W 44c 65c + W = + W + + = 65c + 44c = 109c + W is formed y two djcent ngles + W + ngle = 180c ` 109c + ngle = 180c ` ngle = 180c - 109c ` ngle = 71c ` the size of the ngle supplementry to +W is 71c uestions with mny ngles need closer investigtion. Write down the pir of djcent, supplementry ngles from this digrm igrm not drwn to scle K 29c 105c 19c 46c L M N + M = + MN + + N + M = 46c + 105c + M = 151c The totl size of other djcent ngles is sometimes needed + M + + K = 151c + 29c = 180c + M + K re supplementry ngles ngles SRIS TI

19 MLMNTR N SULMNTR NGLS * Where does it work? our Turn ngles omplementry supplementry ngles 1 lculte the complement (the ngle tht mkes it 90c) of these ngles: 30c 80c c 46c.../.../20... d 11c e 23. 5c f 18. 3c 2 lculte the supplementry (the ngle tht mkes it 180c) of these ngles: 100c 90c c 165c d 109c e c f c 3 lculte the size of the missing complementry ngles elow: 11. 5c R S T 71c U + = + TSU = 4 lculte the size of the missing supplementry ngles elow: I W 107c F + = + I = ngles SRIS 10 TI 17

20 Where does it work? our Turn ngles omplementry supplementry ngles 5 Nme the pir of supplementry ngles in this digrm: int: wht is the size of + W W V 64c 44c 46c U re supplementry ngles 6 Nme the two pirs of complementry ngles in this digrm: 24c 35c 23c 30c F First pir: 37c + F Second pir: + FG 31c G It's como time! 7 Nme the pir of djcent complementry ngles in this digrm: R S.../.../ c 25c 65c 35c T M TIM * M TIM * M TIM * 25c U V If + UV is drwn djcent to + TU s shown, wht size must it e to mke + V stright ngle? int: the ngles must ll dd to 180c + UV = ngles SRIS TI

21 Where does it work? ngles Verticlly opposite ngles When two stright lines cross ech other, four ngles re creted If you mesured ech of these ngles with your protrctor, you will discover tht: ngle 1 = ngle 3 ngle 2 = ngle 4 In Mthemtics we cll these equl ngles, verticlly opposite ngles. Nme the pirs of verticlly opposite ngles in this digrm: re two stright lines crossing ech other t ` 1 st pir of verticlly opposite ngles re: + + ` 2 nd pir of verticlly opposite ngles re: + + djcent ngles formed y the intersection of two stright lines re supplementry. lculte the size of these ngles: W 140c + + = + W Verticlly opposite ngles re the sme size ` + = 140c +W + W is djcent to + W ` + W + + W = 180c djcent ngles of intersecting lines re supplementry ` + W + 140c = 180c ` + W = 40c ngles SRIS 10 TI 19

22 VRTILL SIT NGLS * VRTILL SIT NGLS * Where does it work? our Turn ngles Verticlly opposite ngles 1 Nme shde ll the pirs of verticlly opposite ngles elow: R M.../.../20... T S L K + TR + TS First pir: Second pir: 2 lculte the size of these ngles: I + I + + G 67c + 49c 56c re stright lines 3 This digrm is mde up of four stright lines,, F G intersecting t the sme point. Nme ten different pirs of verticlly opposite ngles. G (iii) (iv) (v) (vi) F (vii) (viii) (ix) (x) ngles SRIS TI

23 Where does it work? ngles rllel lines rllel lines never cross ech other, so on their own they never form n ngle. Used to show tht the lines re prllel to ech other rllel lines re nmed like this: ;; This symol mens 'is prllel to' We get ngles formed when nother line tht is not prllel crosses them. line tht crosses prllel lines is clled trnsversl The opposite of prllel is perpendiculr. The symol for this is =. It mens the lines cross t 90cto ech other ngles ngles tht re on lternte sides of the trnsversl inside pir of prllel lines re the sme size. G G F F + GF = + FG + FG = + GF These re clled lternte ngles, they form zigzg shpe when highlighted. Let s cll them ngles. Find the size of + M 124c K L + = 124c + = + M ` + M = 124c N M lternte ngles in prllel lines, K ;; LM lternte ngles in prllel lines re the sme size ngles SRIS 10 TI 21

24 Where does it work? ngles Fngles ngles tht re in corresponding (mtching) positions on pir of prllel lines re the sme size. G G F F + F = + FG + FG = + G These re clled corresponding ngles they form n F shpe when highlighted. Let s cll them Fngles. Find the size of + LN G 124c L + = 124c + = + LN ` + LN = 124c N K M orresponding ngles in prllel lines, K ;; LM orresponding ngles in prllel lines re the sme size ngles ngles on the sme side of the trnsversl inside pir of prllel lines re supplementry. G G F + FG + + FG = 180c F + GF + + FG = 180c These re clled cointerior ngles they form shpe when highlighted. Let s cll these ngles. Find the size of + L 124c L + = 124c L = 180c ` + L = 56c N K M ointerior ngles in prllel lines, K ;; LM ointerior ngles in prllel lines re supplementry ngles SRIS TI

25 Where does it work? our Turn ngles rllel lines 1 For ech of these digrms: W Nme the trnsversl. Nme the pir of prllel lines using the correct symol. F G RLLL LINS * RLLL LINS *.../.../ Nme ll the pirs of ngles, Fngles ngles in these digrms: W S T U V ngles (lternte ngles) F G ngles (lternte ngles) Fngles (corresponding ngles) There re four pirs of this type Fngles (corresponding ngles) There re four pirs of this type (iii) (iii) (iv) (iv) ngles (cointerior ngles) ngles (cointerior ngles) ngles SRIS 10 TI 23

26 Where does it work? our Turn ngles rllel lines 3 stright cle N, runs underneth rilwy trck s shown. Use the ngles Fngles properties to complete the tle with ll the other ngles tht re the sme size s the two given. 63c 117c 63c Rememer you + + cn look for L 117c verticlly opposite ngles too s they re lso equl. K N M 4 Find the size of ech of these ngles include one of the properties elow you used to find them: roperties: lternte, corresponding, cointerior, verticlly opposite, stright F 46c G + G = roperty used: orresponding ngles + GF = roperty used: ngles + F = roperty used: ngles + GF = roperty used: ngles Try this one with 3 prllel lines! (psst! ou will need to use more thn one property) V + W = roperty used: W 128c orresponding ngle to + T, ( + ) = 128c + W is verticlly opposite to + = 128c + W = roperty used: T 128c U + = roperty used: ngles SRIS TI

27 Where does it work? our Turn ngles rllel lines Since the rules for ngles, Fngles ngles only work when lines re prllel, you cn use them to find out whether pir of lines re prllel or not! 5 For ech of these: circle prllel or not prllel for the lines drwn write reson why you circled the one you did! The line re: F 153c Reson: RLLL NT RLLL 37c The cointerior ngles do not dd up to 180c or The cointerior ngles re not supplementry S 81c T The line ST UV re: Reson: RLLL NT RLLL U 81c V c R The line RS re: N 101c 100c Reson: RLLL NT RLLL S d N K The line LM N re: L Reson: RLLL NT RLLL (write ll the properties used here) 158c I 22c M ngles SRIS 10 TI 25

28 Wht else cn you do? ngles ngle sums The size of specil ngle types lernt erlier cn e used to find unknown ngles. ngles tht form stright line dd to 180c. lculte the size of + MN, if L is stright line M N + L = 180c( stright ngle) 41c 73c L + LM + + N + + MN = + L = 180c ` 41c + 73c + + MN = 180c ` + MN = 180c - 41c - 73c + MN = 66c ngles tht re prt of full revolution re clled ngles t point they dd to 360c. lculte the size of + ere is right-ngle exmple. lculte the size of = 360c ` 38c + 62c + 125c + + = 360c ` + = 360c - 38c - 62c - 125c + = 135c + KN, + MKN + LKM if they re ll the sme size K M L + KN + + MKN + + LKM = 90c ` + KN, + MKN + LKM = 90c ' 3 ` + KN, + MKN + LKM = 30c N 62c 38c 125c The ngles joined t vertex sum to equl 360c + KL is right-ngle which equls 90c ' 3 s they re ll the sme size ngles SRIS TI

29 Wht else cn you do? our Turn ngles ngle sums 1 For ech of these digrms, clculte the size of the missing ngle: K N 13c 29c L M 17c 14c NGL SUMS * NGL SUMS * NGL SUMS * +.../.../ NK = + = c W 72c 76c 203c d Smll dots cn e used to show equl sized ngles R V U T S + = ch ngle = 2 Verticlly opposite ngles cn e used to help find the unknown ngles for these. re stright lines 127c 83c K MN re stright lines M 34c 88c 76c N K + = + M = ngles SRIS 10 TI 27

30 Wht else cn you do? our Turn ngles ngle sums 3 Use the prllel line ngle properties to help find the size of these ngles: W 70c G 47c U + W = 84c 130c V F I + G = + = + GF = + = + G = + W = + GF = omo Time! 4 Give these tricky ones go! ou hve the skills now to use few different ngle properties for ech one. K re stright, prllel lines. re stright lines. 119c re stright, prllel lines. I 46c 141c K + = + FG = int: find F + F first G + = + = + FI = int: find + IF first ngles SRIS TI

31 Wht else cn you do? ngles ngle prolems Mny rel life prolems cn involve the ppliction of the ngle properties covered in this ooklet. This one uses the ngle sum of revolution. Trinity is lindfolded spun round in children s prty gme. If it tkes her equl-sized steps to complete ech circle, how mny degrees does she turn with ech step? 1 complete circle = 1 revolution =360c ` Numer of degrees turned with ech step = 360c ' = 48c ` Trinity spins 48c with ech step she tkes. lwys nswer prolems with sttement ere is nother prolem. Five people were holding lengths of rope ll tied together t the centre. They need to move round until the ngle etween ech rope is the sme. xplin how ech person should move if Kim Rohn must oth sty still. Kim lculte the size ech ngle needs to e. Wei ` 360c ' 5 = 72c ngles t point dd to 360c 92c 37c 100c 44c 87c Rohn Kim Rohn cnnot move. Wei moves 100c - 72c = 28c counter-clockwise Sung-Li ` ngle etween Kim Wei = 72c rin Sung-Li moves 92c - 72c = 20c clockwise ` ngle etween Kim Sung-Li = 72c Sung-Li's movements leve rin 20c + 37c = 57c wy from her. ` rin moves 72c - 57c = 15c counter-clockwise ` ngle etween Sung-Li rin 87c - 15c = 72c rin's movements tke her 15c closer to Rohn ` ngle etween rin Rohn = 87c - 15c = 72c ` ngle etween Wei Rohn = 72c nly ngle left over ngles SRIS 10 TI 29

32 Wht else cn you do? our Turn ngles ngle prolems 1 While performing circulr llet move, net turned the first hlf esily then with some extr effort, mde it 5 of the remining wy round. 6 ow mny degrees ws net wy from completing the full circle?.../.../20... NGL RLMS * NGL RLMS *?c Strt position Rememer me? She immeditely recovers strts her second move fcing where she hd stopped. If she successfully turns nother 180c in the sme direction, how mny degrees wy from the strt position is net now? 2 ert is uilding nother we, this time etween two stright, prllel ems ;; W. is we hs three stright supports:, G. W G 28c 47c K ert wnts to put in nother stright support K tht psses through, strting t (etween W ) finishing t K (etween ). rw in the support K tht mtches ert s wishes. Wht is the size of + if ll the cute ngles ginst the em W re complementry? ngles SRIS TI

33 Wht else cn you do? our Turn ngles ngle prolems 3 toy root is progrmmed to move to ll of the discs shown elow. It strts on disc fcing in the direction of the rrow. When it reches ech disc, the root remins fcing the direction it ws during the previous move. Nme the order of the discs it moves to if it follows these instructions in order: Turn right-ngle clockwise trvel forwrd to the next disc. omplete full revolution then trvel forwrd to the next disc. Turn counter-clockwise 200c trvel forwrd to the next disc. Turn clockwise 270c trvel forwrd to the next disc. Turn clockwise 80c then trvel in reverse (ckwrds) to the next disc. Turn counter-clockwise n cute ngle trvel forwrd to the lst disc. F G isc order: 4 s prt of tresure hunt, prticipnts must complete puzzles to receive the nme of the next destintion. t one stop, the puzzle is this: 27c Step 1: If + is stright ngle, clculte the complement of + dd it to one of the ngles formed when + is divided into nine equl sized prts. Step 2: lculte the size of reflex +, sutrct the vlue of step 1 from it then dd the supplement of + to the nswer. Wht nswer will win you the nme of the next destintion? ngles SRIS 10 TI 31

34 het Sheet ngles ere is summry of the importnt things to rememer for ngles rt of n ngle Nming ngles R rm ngle swept in degrees (c) +R Vertex rm Rys tht form n ngle The letter t the vertex is lwys written in the middle ngle types cute ngle Right ngle tuse ngle Smll ox mens 90c 0c c + = 90c 90c c Stright ngle Reflex ngle Full revolution or Full rottion Vertex Vertex + = 180c 180c 1 reflex c + = 360c / omplementry supplementry ngles omplementry: pir of ngles whose sum = 90c Together they form right-ngle Supplementry: pir of ngles whose sum = 180c Together they form stright-ngle Verticlly opposite ngles ngle 1 = ngle 3 ngle 2 = ngle 4 3 rllel lines ;; : mens the line is prllel to the line rrows indicte prllel lines Trnsversl lternte ngles orresponding ngles ointerior ngles qul on prllel lines qul on prllel lines Supplementry on prllel lines ngles SRIS TI

35

36 ngles

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to djcent tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. me the djcent cute ngles in this digrm rm is shred y + + me vertex point for + + + is djcent to + djcent simply mens

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids Chpter44 Polygons nd solids Contents: A Polygons B Tringles C Qudrilterls D Solids E Constructing solids 74 POLYGONS AND SOLIDS (Chpter 4) Opening prolem Things to think out: c Wht different shpes cn you

More information

Order these angles from smallest to largest by wri ng 1 to 4 under each one. Put a check next to the right angle.

Order these angles from smallest to largest by wri ng 1 to 4 under each one. Put a check next to the right angle. Lines nd ngles Connect ech set of lines to the correct nme: prllel perpendiculr Order these ngles from smllest to lrgest y wri ng to 4 under ech one. Put check next to the right ngle. Complete this tle

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

MATHS LECTURE # 09. Plane Geometry. Angles

MATHS LECTURE # 09. Plane Geometry. Angles Mthemtics is not specttor sport! Strt prcticing. MTHS LTUR # 09 lne eometry oint, line nd plne There re three sic concepts in geometry. These concepts re the point, line nd plne. oint fine dot, mde y shrp

More information

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012 Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt

More information

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org

More information

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E 4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Angle Properties in Polygons. Part 1 Interior Angles

Angle Properties in Polygons. Part 1 Interior Angles 2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures

More information

3 4. Answers may vary. Sample: Reteaching Vertical s are.

3 4. Answers may vary. Sample: Reteaching Vertical s are. Chpter 7 Answers Alterntive Activities 7-2 1 2. Check students work. 3. The imge hs length tht is 2 3 tht of the originl segment nd is prllel to the originl segment. 4. The segments pss through the endpoints

More information

Angle properties of lines and polygons

Angle properties of lines and polygons chievement Stndrd 91031 pply geometric resoning in solving problems Copy correctly Up to 3% of workbook Copying or scnning from ES workbooks is subject to the NZ Copyright ct which limits copying to 3%

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Mathematics Background

Mathematics Background For more roust techer experience, plese visit Techer Plce t mthdshord.com/cmp3 Mthemtics Bckground Extending Understnding of Two-Dimensionl Geometry In Grde 6, re nd perimeter were introduced to develop

More information

Pythagoras theorem and trigonometry (2)

Pythagoras theorem and trigonometry (2) HPTR 10 Pythgors theorem nd trigonometry (2) 31 HPTR Liner equtions In hpter 19, Pythgors theorem nd trigonometry were used to find the lengths of sides nd the sizes of ngles in right-ngled tringles. These

More information

6.2 Volumes of Revolution: The Disk Method

6.2 Volumes of Revolution: The Disk Method mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes

More information

Angle Relationships. Geometry Vocabulary. Parallel Lines November 07, 2013

Angle Relationships. Geometry Vocabulary. Parallel Lines November 07, 2013 Geometr Vocbulr. Point the geometric figure formed t the intersecon of two disnct lines 2. Line the geometric figure formed b two points. A line is the stright pth connecng two points nd etending beond

More information

Summer Review Packet For Algebra 2 CP/Honors

Summer Review Packet For Algebra 2 CP/Honors Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review

More information

Measurement and geometry

Measurement and geometry Mesurement nd geometry 4 Geometry Geometry is everywhere. Angles, prllel lines, tringles nd qudrilterls n e found ll round us, in our homes, on trnsport, in onstrution, rt nd nture. This sene from Munih

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Geometry/Trig 2 Unit 3 Review Packet Answer Key

Geometry/Trig 2 Unit 3 Review Packet Answer Key Unit 3 Review Pcket nswer Key Section I Nme the five wys to prove tht prllel lines exist. 1. If two lines re cut y trnsversl nd corresponding ngles re congruent, then the lines re prllel.. If two lines

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

SERIES. Patterns and Algebra OUT. Name

SERIES. Patterns and Algebra OUT. Name D Techer Student Book IN OUT 8 Nme Series D Contents Topic Section Ptterns Answers nd (pp. functions ) identifying ptterns nd nd functions_ creting ptterns_ skip equtions counting nd equivlence completing

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Naming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you.

Naming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you. Nming 3D ojects 1 Nme the 3D ojects lelled in these models. Use the word nk to help you. Word nk cue prism sphere cone cylinder pyrmid D A C F A B C D cone cylinder cue cylinder E B E prism F cue G G pyrmid

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

UNCORRECTED SAMPLE PAGES. Angle relationships and properties of 6geometrical figures 1. Online resources. What you will learn

UNCORRECTED SAMPLE PAGES. Angle relationships and properties of 6geometrical figures 1. Online resources. What you will learn Online resoures uto-mrked hpter pre-test Video demonstrtions of ll worked exmples Intertive widgets Intertive wlkthroughs Downlodle HOTsheets ess to ll HOTmths ustrlin urriulum ourses ess to the HOTmths

More information

Area and Volume. Introduction

Area and Volume. Introduction CHAPTER 3 Are nd Volume Introduction Mn needs mesurement for mny tsks. Erly records indicte tht mn used ody prts such s his hnd nd forerm nd his nturl surroundings s mesuring instruments. Lter, the imperil

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

1 Drawing 3D Objects in Adobe Illustrator

1 Drawing 3D Objects in Adobe Illustrator Drwing 3D Objects in Adobe Illustrtor 1 1 Drwing 3D Objects in Adobe Illustrtor This Tutoril will show you how to drw simple objects with three-dimensionl ppernce. At first we will drw rrows indicting

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Section 9.2 Hyperbolas

Section 9.2 Hyperbolas Section 9. Hperols 597 Section 9. Hperols In the lst section, we lerned tht plnets hve pproimtel ellipticl orits round the sun. When n oject like comet is moving quickl, it is le to escpe the grvittionl

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Patterns and Algebra. My name. Series

Patterns and Algebra. My name. Series Student Techer Ptterns nd Alger My nme Series D Copyright 009 P Lerning. All rights reserved. First edition printed 009 in Austrli. A ctlogue record for this ook is ville from P Lerning Ltd. ISBN 978--9860--

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Math 4 Review for Quarter 2 Cumulative Test

Math 4 Review for Quarter 2 Cumulative Test Mth 4 Review for Qurter 2 Cumultive Test Nme: I. Right Tringle Trigonometry (3.1-3.3) Key Fcts Pythgoren Theorem - In right tringle, 2 + b 2 = c 2 where c is the hypotenuse s shown below. c b Trigonometric

More information

Lesson 11 MA Nick Egbert

Lesson 11 MA Nick Egbert Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

Can Pythagoras Swim?

Can Pythagoras Swim? Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Notes for Graph Theory

Notes for Graph Theory Notes for Grph Theory These re notes I wrote up for my grph theory clss in 06. They contin most of the topics typiclly found in grph theory course. There re proofs of lot of the results, ut not of everything.

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Rules for Numbers. Rules of addition. x + y = y + x (Law of commutativity) x +0=x (Law of identity) x + x =0(Lawofinverses) Rules of multiplication.

Rules for Numbers. Rules of addition. x + y = y + x (Law of commutativity) x +0=x (Law of identity) x + x =0(Lawofinverses) Rules of multiplication. ules for Numers rel numers re governed y collection rules hve do with ddition, multipliction, equlities. In rules elow,, y, z. In or words,, y, z re rel numers.) ules ddition. + y)+z +y + z) Lwssocitivity)

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

called the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola.

called the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola. Review of conic sections Conic sections re grphs of the form REVIEW OF CONIC SECTIONS prols ellipses hperols P(, ) F(, p) O p =_p REVIEW OF CONIC SECTIONS In this section we give geometric definitions

More information

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997.

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997. Forced convex n-gons in the plne F. R. K. Chung y University ofpennsylvni Phildelphi, Pennsylvni 19104 R. L. Grhm AT&T Ls - Reserch Murry Hill, New Jersey 07974 Mrch 2,1997 Astrct In seminl pper from 1935,

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example: Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information