Sequence analysis Pairwise sequence alignment
|
|
- Cora Warner
- 6 years ago
- Views:
Transcription
1 UMF11 Introduction to bioinformatics, 25 Sequence analysis Pairwise sequence alignment 1. Sequence alignment Lecturer: Marina lexandersson 12 September, 25 here are two types of sequence alignments, global and local. In global alignment, the entire sequences are aligned up to both ends. Sequences that are quite similar and approximately the same length are suitable for global alignment. small example LGPSKDFGKISESREFDN LNPLERSFGKINM-RED In local alignments, segments of sequences with the highest similarity are aligned. his is used for instance when two proteins are suspected to share a common domain, or when comparing long stretches of DN. It is also usually a much more sensitive way to detect similarities between two highly diverged sequences. his is because in such cases only part of the sequence has been under strong enough selection to preserve detectable similarity; the rest will have accumulated so many mutations that they are no longer alignable FGKI FGKI It may seem that one should always use local alignments. But then it may be difficult to spot an overall similarity, so it depends on the situation. Pairwise sequence alignment can be performed using the following methods: 1. Dot matrix analysis 2. he dynamic programming algorithm 3. Pair Hidden Markov models 4. Database searches using word- or k-tuple methods, such as FS or BLS 2. Dynamic programming he dynamic programming method consists of three parts 1. he recursive relation 2. he tabular computation 3. he traceback 1
2 UMF11 Introduction to bioinformatics, Global alignment: the Needleman-Wunsch algorithm he idea of the Needleman-Wunsch algorithm is to build up an optimal alignment using previous solutions for optimal alignments of smaller subsequences he recursive relation We want to align sequences x 1x2... xn and y 1 y2... ym and start by producing an n m matrix F where F ( i, = score of optimal path of subsequences x 1...xi and y 1...y j ssume a linear gap penalty d. i 1, + s( xi, y j ) i, = max i 1, i, (match/mismatch) (gap in y) (gap in x) with F (,) =, i,) = id,, = jd. F ( i 1, F ( i, s( x i, y j ) i 1, F ( i, he tabular computation In the tabular computation we calculate the scores of each cell in F, starting with cell (,) and the boundary conditions for the first row and column. hen we calculate the scores one row at the time. In each cell we keep a pointer to the optimal previous position 2
3 UMF11 Introduction to bioinformatics, 25 i,: he traceback In the traceback we start in cell ( n, m) and follow the arrows back to (,) to achieve the optimal alignment. G G- -G G 2.2 Local alignment: the Smith-Waterman algorithm In a local alignment we are looking for the best alignment between subsequences of x and y. GGG GG he highest scoring alignment of subsequences of x and y is then called the optimal local alignment. he Smith-Waterman algorithm is very similar to the global alignment algorithm he recursive relation he recursive relation in the Needleman-Wunsch algorithm only needs a slight modification to fit our purposes 3
4 UMF11 Introduction to bioinformatics, 25 i 1, + s( xi, y j ) i 1, i, = max i, s an extra possibility, F ( i, is allowed to take the value if all other options have value less than, resulting in a matrix with all non-negative values. s a consequence the top row and the leftmost column will be filled with s, and not id and jd as before he tabular computation. s a consequence of the added possibility in the recursive relation, the top row and the leftmost column will now be filled with s, and not id and jd as before. Moreover, we only keep a pointer to the previous optimal position in cells with positive values. i,: he traceback nother difference from the global alignment case is that now an alignment can begin and end anywhere in the matrix. Instead of starting the traceback in the bottom right corner F ( n, m), we begin in the cell with the highest value of F ( i,. he traceback ends when we meet a cell with value, which corresponds to the start of the alignment. 4
5 UMF11 Introduction to bioinformatics, 25 Example 1. We want to align protein sequences seq1:hegwghee and seq2:pwhee using local alignment, with gap penalty d = 8 and the BLOSUM5 matrix (see below). H E G W G H E E P 5 5 W H E E he highest score in the matrix is 28, so that is where the traceback starts. he optimal local alignment with score 28 is thus WGHE W-HE 5
6 UMF11 Introduction to bioinformatics, Pair Hidden Markov Models (PHMMs) pair hidden Markov model consists of three states S = { M, I, D} where M = match (or mismatch) I = insertion (in seq1 => deletion in seq2) D = deletion (in seq1 => insertion in seq2) M I D he output from a PHMM is an aligned pair of sequences. In the match state, the generated output is a pair of residues, which can be identical (match), or not (mismatch). In the insertion and deletion states the generated output is one residue paired up with a gap. Example 2. ssume that we have a sequence alignment generating machine. he alignment G - - G G would then have been produced as follows M M I M D D M - G - - G 6
7 UMF11 Introduction to bioinformatics, 25 But in reality we only observe the sequences seq1:gg and seq2:g and need to determine the optimal alignment under our model, that is our PHMM. he algorithm used to find the best alignment in a PHMM is called the Viterbi algorithm. he Viterbi algorithm is a dynamic programming method similar to the Needleman-Wunsch algorithm, where we formulize the recursive relation based on the PHMM parameters, and perform the tabular computation and the traceback in the same manner. 4. Database searches With dynamical programming we're guaranteed to find the optimal alignment, but unfortunately these algorithms are usually computationally complex (in speed and memory usage). Heuristic searches are less sensitive, but pretty good still and much faster. he idea is that most good alignments have short stretches of ungapped very high scoring matches. Hence, good alignments without such a stretch are missed, but these are rather rare. 4.1 BLS (Basic Local lignment Search ool) BLS is one of the most widely used tools in bioinformatics, and perhaps in biology all together. BLS takes a query sequence (DN or protein) and searches for local alignment matches in a database. he procedure is as follows: Find all substrings of length w (w-length words) in the database that aligns with words in the query sequence, where the alignment has score higher than some threshold t. hese words are called hits. Extend each hit to see if it is contained in an alignment segment of score higher than some other threshold S. Usually w is about 3-5 for amino acids and ~ 12 for DN. Example 3. Let w = 2, t = 8 and S = 2, and use a PM12 substitution matrix. ssume we want to search a database for matches to the peptide query Query: QLNFSGW Possible w-length words ( words of length 2) of the query are: QL, LN, NF, FS, S, G, GW We match these words with words in the database sequences, but only record the matches with scores t. hus possible alignments in the database are QL QL QL QL: = 11, = 9, = 8 QL QM HL QL, QM, HL LN LN: = 9 LN LN 7
8 UMF11 Introduction to bioinformatics, 25 NF NF NF NF: NF = 12, F = 8, NY = 8 NF, F, NY and so on. hen for each database entry having one or more hits, we align the words and try to extend the alignment to see if it is part of a segment with a score S. For instance, assume there is a database entry Database entry: HLNYW his entry for instance contains the hit LN. We align the words and try to extend the alignment Q LN FSGW H LN YW In this case we get score 21 > S for the subsequences QLNFS HLNY If the database entry contains more hits, these are extended in the same manner. BLS reports the hits ordered according to score, and with the score and E-value (indicating the significance of the score). 4.2 FS For nucleotide searches FS may be more sensitive than BLS. he procedure is as follows: lookup table is created for all identical matching words of length ktup (1-2 for proteins, 4-6 for DN) between the query sequence and the database. he comparison of the query sequence and the database can be viewed as a set of dotplots, with the query as the vertical sequence and the database sequences as the horizontal. Diagonals with the largest number of words are registered. he best regions are rescored, using a scoring matrix, trying to extend the match for as long as possible and still have a score above a given threshold. Ungapped regions are joined if the total score is S. he highest scoring candidates are realigned using a dynamical programming algorithm, but restricting it to a band around the candidate match. 8
9 UMF11 Introduction to bioinformatics, Significance of scores: P-values and E-values he classical approach uses the extreme value distribution to calculate the probability that the best match from a search of N unrelated sequences has score S. If this probability is very small we don't believe that the sequences are unrelated, and so they are likely to be homologous. HSP = high scoring pair. If two random sequences of lengths n and m are aligned, the probability of finding at least one segment pair with score S is Pr(at least one HSP with score S ) 1 exp{ Knme λs } where K, λ depends on the scoring scheme. We call this probability the P-value. he expected number of segment pairs having score S in the random model is the E-value E [#HSPs with score S ] = Kmne λs. Scores are often normalized to get rid of the dependence on the scoring system S log K S' = λ log 2 and the E-value S ' mn / 2. BLS reports the normalized score and the E-value where m is the length of the query sequence, and n the length of the entire database (the sum of all sequence lengths in the database). 9
10 UMF11 Introduction to bioinformatics, 25 BLOSUM5 R N D Q E G H I L K M F P S W Y V R N D Q E G H I L K M F P S W Y W PM12 R N D Q E G H I L K M F P S W Y V R N D Q E G H I L K M F P S W Y V
Lecture 10. Sequence alignments
Lecture 10 Sequence alignments Alignment algorithms: Overview Given a scoring system, we need to have an algorithm for finding an optimal alignment for a pair of sequences. We want to maximize the score
More informationBiology 644: Bioinformatics
Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find
More informationAn Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST
An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST Alexander Chan 5075504 Biochemistry 218 Final Project An Analysis of Pairwise
More informationLecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:
Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating
More informationSequence Alignment & Search
Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating the first version
More informationSequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it.
Sequence Alignments Overview Sequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it. Sequence alignment means arranging
More informationBLAST - Basic Local Alignment Search Tool
Lecture for ic Bioinformatics (DD2450) April 11, 2013 Searching 1. Input: Query Sequence 2. Database of sequences 3. Subject Sequence(s) 4. Output: High Segment Pairs (HSPs) Sequence Similarity Measures:
More informationSequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment
Sequence lignment (chapter 6) p The biological problem p lobal alignment p Local alignment p Multiple alignment Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity
More information24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:
24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid
More informationDynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
More informationCS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores.
CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. prepared by Oleksii Kuchaiev, based on presentation by Xiaohui Xie on February 20th. 1 Introduction
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Sequence pairwise alignment Score statistics: E-value and p-value Heuristic algorithms: BLAST and FASTA Database search: gene finding and annotations
More informationFastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:
FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:56 4001 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem
More informationSequence Alignment. part 2
Sequence Alignment part 2 Dynamic programming with more realistic scoring scheme Using the same initial sequences, we ll look at a dynamic programming example with a scoring scheme that selects for matches
More informationSequence Comparison: Dynamic Programming. Genome 373 Genomic Informatics Elhanan Borenstein
Sequence omparison: Dynamic Programming Genome 373 Genomic Informatics Elhanan Borenstein quick review: hallenges Find the best global alignment of two sequences Find the best global alignment of multiple
More informationCOS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching
COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1 Database Searching In database search, we typically have a large sequence database
More informationCompares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.
Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the
More informationOutline. Sequence Alignment. Types of Sequence Alignment. Genomics & Computational Biology. Section 2. How Computers Store Information
enomics & omputational Biology Section Lan Zhang Sep. th, Outline How omputers Store Information Sequence lignment Dot Matrix nalysis Dynamic programming lobal: NeedlemanWunsch lgorithm Local: SmithWaterman
More informationBioinformatics for Biologists
Bioinformatics for Biologists Sequence Analysis: Part I. Pairwise alignment and database searching Fran Lewitter, Ph.D. Director Bioinformatics & Research Computing Whitehead Institute Topics to Cover
More informationFastA & the chaining problem
FastA & the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 1 Sources for this lecture: Lectures by Volker Heun, Daniel Huson and Knut Reinert,
More informationBLAST MCDB 187. Friday, February 8, 13
BLAST MCDB 187 BLAST Basic Local Alignment Sequence Tool Uses shortcut to compute alignments of a sequence against a database very quickly Typically takes about a minute to align a sequence against a database
More informationHeuristic methods for pairwise alignment:
Bi03c_1 Unit 03c: Heuristic methods for pairwise alignment: k-tuple-methods k-tuple-methods for alignment of pairs of sequences Bi03c_2 dynamic programming is too slow for large databases Use heuristic
More informationFASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm.
FASTA INTRODUCTION Definition (by David J. Lipman and William R. Pearson in 1985) - Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence
More informationToday s Lecture. Edit graph & alignment algorithms. Local vs global Computational complexity of pairwise alignment Multiple sequence alignment
Today s Lecture Edit graph & alignment algorithms Smith-Waterman algorithm Needleman-Wunsch algorithm Local vs global Computational complexity of pairwise alignment Multiple sequence alignment 1 Sequence
More informationLectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures
4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 4.1 Sources for this lecture Lectures by Volker Heun, Daniel Huson and Knut
More informationAs of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be
48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools Lecture 8. Note
MS: Bioinformatic lgorithms, Databases and ools Lecture 8 Sequence alignment: inexact alignment dynamic programming, gapped alignment Note Lecture 7 suffix trees and suffix arrays will be rescheduled Exact
More informationBGGN 213 Foundations of Bioinformatics Barry Grant
BGGN 213 Foundations of Bioinformatics Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: 25 Responses: https://tinyurl.com/bggn213-02-f17 Why ALIGNMENT FOUNDATIONS Why compare biological
More informationBioinformatics explained: Smith-Waterman
Bioinformatics Explained Bioinformatics explained: Smith-Waterman May 1, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com
More informationB L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture
February 6, 2008 BLAST: Basic local alignment search tool B L A S T! Jonathan Pevsner, Ph.D. Introduction to Bioinformatics pevsner@jhmi.edu 4.633.0 Copyright notice Many of the images in this powerpoint
More informationSoftware Implementation of Smith-Waterman Algorithm in FPGA
Software Implementation of Smith-Waterman lgorithm in FP NUR FRH IN SLIMN, NUR DLILH HMD SBRI, SYED BDUL MULIB L JUNID, ZULKIFLI BD MJID, BDUL KRIMI HLIM Faculty of Electrical Engineering Universiti eknologi
More informationAlgorithmic Approaches for Biological Data, Lecture #20
Algorithmic Approaches for Biological Data, Lecture #20 Katherine St. John City University of New York American Museum of Natural History 20 April 2016 Outline Aligning with Gaps and Substitution Matrices
More informationBasic Local Alignment Search Tool (BLAST)
BLAST 26.04.2018 Basic Local Alignment Search Tool (BLAST) BLAST (Altshul-1990) is an heuristic Pairwise Alignment composed by six-steps that search for local similarities. The most used access point to
More informationSequence alignment algorithms
Sequence alignment algorithms Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 23 rd 27 After this lecture, you can decide when to use local and global sequence alignments
More informationPairwise Sequence Alignment: Dynamic Programming Algorithms. COMP Spring 2015 Luay Nakhleh, Rice University
Pairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 - Spring 2015 Luay Nakhleh, Rice University DP Algorithms for Pairwise Alignment The number of all possible pairwise alignments (if
More informationBrief review from last class
Sequence Alignment Brief review from last class DNA is has direction, we will use only one (5 -> 3 ) and generate the opposite strand as needed. DNA is a 3D object (see lecture 1) but we will model it
More informationPairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 Luay Nakhleh, Rice University
1 Pairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 Luay Nakhleh, Rice University DP Algorithms for Pairwise Alignment 2 The number of all possible pairwise alignments (if gaps are allowed)
More informationSequence comparison: Local alignment
Sequence comparison: Local alignment Genome 559: Introuction to Statistical an Computational Genomics Prof. James H. Thomas http://faculty.washington.eu/jht/gs559_217/ Review global alignment en traceback
More informationScoring and heuristic methods for sequence alignment CG 17
Scoring and heuristic methods for sequence alignment CG 17 Amino Acid Substitution Matrices Used to score alignments. Reflect evolution of sequences. Unitary Matrix: M ij = 1 i=j { 0 o/w Genetic Code Matrix:
More informationProfiles and Multiple Alignments. COMP 571 Luay Nakhleh, Rice University
Profiles and Multiple Alignments COMP 571 Luay Nakhleh, Rice University Outline Profiles and sequence logos Profile hidden Markov models Aligning profiles Multiple sequence alignment by gradual sequence
More informationBLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha
BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio. 1990. CS 466 Saurabh Sinha Motivation Sequence homology to a known protein suggest function of newly sequenced protein Bioinformatics
More informationPairwise Sequence Alignment. Zhongming Zhao, PhD
Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T
More informationAlgorithms in Bioinformatics: A Practical Introduction. Database Search
Algorithms in Bioinformatics: A Practical Introduction Database Search Biological databases Biological data is double in size every 15 or 16 months Increasing in number of queries: 40,000 queries per day
More information.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar..
.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. PAM and BLOSUM Matrices Prepared by: Jason Banich and Chris Hoover Background As DNA sequences change and evolve, certain amino acids are more
More informationProgramming assignment for the course Sequence Analysis (2006)
Programming assignment for the course Sequence Analysis (2006) Original text by John W. Romein, adapted by Bart van Houte (bart@cs.vu.nl) Introduction Please note: This assignment is only obligatory for
More informationComputational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
More informationNotes on Dynamic-Programming Sequence Alignment
Notes on Dynamic-Programming Sequence Alignment Introduction. Following its introduction by Needleman and Wunsch (1970), dynamic programming has become the method of choice for rigorous alignment of DNA
More informationSequence alignment theory and applications Session 3: BLAST algorithm
Sequence alignment theory and applications Session 3: BLAST algorithm Introduction to Bioinformatics online course : IBT Sonal Henson Learning Objectives Understand the principles of the BLAST algorithm
More informationPROTEIN MULTIPLE ALIGNMENT MOTIVATION: BACKGROUND: Marina Sirota
Marina Sirota MOTIVATION: PROTEIN MULTIPLE ALIGNMENT To study evolution on the genetic level across a wide range of organisms, biologists need accurate tools for multiple sequence alignment of protein
More informationDatabase Searching Using BLAST
Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain
More informationToday s Lecture. Multiple sequence alignment. Improved scoring of pairwise alignments. Affine gap penalties Profiles
Today s Lecture Multiple sequence alignment Improved scoring of pairwise alignments Affine gap penalties Profiles 1 The Edit Graph for a Pair of Sequences G A C G T T G A A T G A C C C A C A T G A C G
More informationLecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD
Lecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD Assumptions: Biological sequences evolved by evolution. Micro scale changes: For short sequences (e.g. one
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3
More informationC E N T R. Introduction to bioinformatics 2007 E B I O I N F O R M A T I C S V U F O R I N T. Lecture 13 G R A T I V. Iterative homology searching,
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Introduction to bioinformatics 2007 Lecture 13 Iterative homology searching, PSI (Position Specific Iterated) BLAST basic idea use
More informationPrinciples of Bioinformatics. BIO540/STA569/CSI660 Fall 2010
Principles of Bioinformatics BIO540/STA569/CSI660 Fall 2010 Lecture 11 Multiple Sequence Alignment I Administrivia Administrivia The midterm examination will be Monday, October 18 th, in class. Closed
More informationBioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure
Bioinformatics Sequence alignment BLAST Significance Next time Protein Structure 1 Experimental origins of sequence data The Sanger dideoxynucleotide method F Each color is one lane of an electrophoresis
More information15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs
5-78: Graduate rtificial Intelligence omputational biology: Sequence alignment and profile HMMs entral dogma DN GGGG transcription mrn UGGUUUGUG translation Protein PEPIDE 2 omparison of Different Organisms
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies November 17, 2012 1 Introduction Introduction 2 BLAST What is BLAST? The algorithm 3 Genome assembly De
More informationChapter 6. Multiple sequence alignment (week 10)
Course organization Introduction ( Week 1,2) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 3)» Algorithm complexity analysis
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
More informationChapter 4: Blast. Chaochun Wei Fall 2014
Course organization Introduction ( Week 1-2) Course introduction A brief introduction to molecular biology A brief introduction to sequence comparison Part I: Algorithms for Sequence Analysis (Week 3-11)
More informationBiochemistry 324 Bioinformatics. Multiple Sequence Alignment (MSA)
Biochemistry 324 Bioinformatics Multiple Sequence Alignment (MSA) Big- Οh notation Greek omicron symbol Ο The Big-Oh notation indicates the complexity of an algorithm in terms of execution speed and storage
More informationCISC 889 Bioinformatics (Spring 2003) Multiple Sequence Alignment
CISC 889 Bioinformatics (Spring 2003) Multiple Sequence Alignment Courtesy of jalview 1 Motivations Collective statistic Protein families Identification and representation of conserved sequence features
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 04: Variations of sequence alignments http://www.pitt.edu/~mcs2/teaching/biocomp/tutorials/global.html Slides adapted from Dr. Shaojie Zhang (University
More informationSearching Sequence Databases
Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science & Engineering 2003 Searching Sequence Databases Dan E. Krane Wright State University - Main Campus,
More informationDistributed Protein Sequence Alignment
Distributed Protein Sequence Alignment ABSTRACT J. Michael Meehan meehan@wwu.edu James Hearne hearne@wwu.edu Given the explosive growth of biological sequence databases and the computational complexity
More informationIntroduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2
Introduction to BLAST with Protein Sequences Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 1 References Chapter 2 of Biological Sequence Analysis (Durbin et al., 2001)
More informationCAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1
CAP 5510-6 BLAST BIOINFORMATICS Su-Shing Chen CISE 8/20/2005 Su-Shing Chen, CISE 1 BLAST Basic Local Alignment Prof Search Su-Shing Chen Tool A Fast Pair-wise Alignment and Database Searching Tool 8/20/2005
More informationBLAST, Profile, and PSI-BLAST
BLAST, Profile, and PSI-BLAST Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 26 Free for academic use Copyright @ Jianlin Cheng & original sources
More informationDatabase Similarity Searching
An Introduction to Bioinformatics BSC4933/ISC5224 Florida State University Feb. 23, 2009 Database Similarity Searching Steven M. Thompson Florida State University of Department Scientific Computing How
More informationSimilarity searches in biological sequence databases
Similarity searches in biological sequence databases Volker Flegel september 2004 Page 1 Outline Keyword search in databases General concept Examples SRS Entrez Expasy Similarity searches in databases
More informationA Design of a Hybrid System for DNA Sequence Alignment
IMECS 2008, 9-2 March, 2008, Hong Kong A Design of a Hybrid System for DNA Sequence Alignment Heba Khaled, Hossam M. Faheem, Tayseer Hasan, Saeed Ghoneimy Abstract This paper describes a parallel algorithm
More informationBIOL591: Introduction to Bioinformatics Alignment of pairs of sequences
BIOL591: Introduction to Bioinformatics Alignment of pairs of sequences Reading in text (Mount Bioinformatics): I must confess that the treatment in Mount of sequence alignment does not seem to me a model
More informationComparative Analysis of Protein Alignment Algorithms in Parallel environment using CUDA
Comparative Analysis of Protein Alignment Algorithms in Parallel environment using BLAST versus Smith-Waterman Shadman Fahim shadmanbracu09@gmail.com Shehabul Hossain rudrozzal@gmail.com Gulshan Jubaed
More informationDynamic Programming & Smith-Waterman algorithm
m m Seminar: Classical Papers in Bioinformatics May 3rd, 2010 m m 1 2 3 m m Introduction m Definition is a method of solving problems by breaking them down into simpler steps problem need to contain overlapping
More informationSequence Alignment Heuristics
Sequence Alignment Heuristics Some slides from: Iosif Vaisman, GMU mason.gmu.edu/~mmasso/binf630alignment.ppt Serafim Batzoglu, Stanford http://ai.stanford.edu/~serafim/ Geoffrey J. Barton, Oxford Protein
More informationAcceleration of Algorithm of Smith-Waterman Using Recursive Variable Expansion.
www.ijarcet.org 54 Acceleration of Algorithm of Smith-Waterman Using Recursive Variable Expansion. Hassan Kehinde Bello and Kazeem Alagbe Gbolagade Abstract Biological sequence alignment is becoming popular
More informationSequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC-- TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences
More informationChapter 8 Multiple sequence alignment. Chaochun Wei Spring 2018
1896 1920 1987 2006 Chapter 8 Multiple sequence alignment Chaochun Wei Spring 2018 Contents 1. Reading materials 2. Multiple sequence alignment basic algorithms and tools how to improve multiple alignment
More informationOPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT
OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT Asif Ali Khan*, Laiq Hassan*, Salim Ullah* ABSTRACT: In bioinformatics, sequence alignment is a common and insistent task. Biologists align
More informationBIOL 7020 Special Topics Cell/Molecular: Molecular Phylogenetics. Spring 2010 Section A
BIOL 7020 Special Topics Cell/Molecular: Molecular Phylogenetics. Spring 2010 Section A Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 Similarity searching and homology First, just
More informationIntroduction to Computational Molecular Biology
18.417 Introduction to Computational Molecular Biology Lecture 13: October 21, 2004 Scribe: Eitan Reich Lecturer: Ross Lippert Editor: Peter Lee 13.1 Introduction We have been looking at algorithms to
More informationCS313 Exercise 4 Cover Page Fall 2017
CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationTCCAGGTG-GAT TGCAAGTGCG-T. Local Sequence Alignment & Heuristic Local Aligners. Review: Probabilistic Interpretation. Chance or true homology?
Local Sequence Alignment & Heuristic Local Aligners Lectures 18 Nov 28, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall
More informationAccelerating Smith Waterman (SW) Algorithm on Altera Cyclone II Field Programmable Gate Array
Accelerating Smith Waterman (SW) Algorithm on Altera yclone II Field Programmable Gate Array NUR DALILAH AHMAD SABRI, NUR FARAH AIN SALIMAN, SYED ABDUL MUALIB AL JUNID, ABDUL KARIMI HALIM Faculty Electrical
More informationSimilarity Searches on Sequence Databases
Similarity Searches on Sequence Databases Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Zürich, October 2004 Swiss Institute of Bioinformatics Swiss EMBnet node Outline Importance of
More informationBioinformatics explained: BLAST. March 8, 2007
Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics
More informationOn the Efficacy of Haskell for High Performance Computational Biology
On the Efficacy of Haskell for High Performance Computational Biology Jacqueline Addesa Academic Advisors: Jeremy Archuleta, Wu chun Feng 1. Problem and Motivation Biologists can leverage the power of
More informationResearch Article International Journals of Advanced Research in Computer Science and Software Engineering ISSN: X (Volume-7, Issue-6)
International Journals of Advanced Research in Computer Science and Software Engineering ISSN: 77-18X (Volume-7, Issue-6) Research Article June 017 DDGARM: Dotlet Driven Global Alignment with Reduced Matrix
More informationSequence Alignment. Ulf Leser
Sequence Alignment Ulf Leser his Lecture Approximate String Matching Edit distance and alignment Computing global alignments Local alignment Ulf Leser: Bioinformatics, Summer Semester 2016 2 ene Function
More informationComputational Biology Lecture 4: Overlap detection, Local Alignment, Space Efficient Needleman-Wunsch Saad Mneimneh
Computational Biology Lecture 4: Overlap detection, Local Alignment, Space Efficient Needleman-Wunsch Saad Mneimneh Overlap detection: Semi-Global Alignment An overlap of two sequences is considered an
More informationReconstructing long sequences from overlapping sequence fragment. Searching databases for related sequences and subsequences
SEQUENCE ALIGNMENT ALGORITHMS 1 Why compare sequences? Reconstructing long sequences from overlapping sequence fragment Searching databases for related sequences and subsequences Storing, retrieving and
More informationVL Algorithmen und Datenstrukturen für Bioinformatik ( ) WS15/2016 Woche 9
VL Algorithmen und Datenstrukturen für Bioinformatik (19400001) WS15/2016 Woche 9 Tim Conrad AG Medical Bioinformatics Institut für Mathematik & Informatik, Freie Universität Berlin Contains material from
More informationCHAPTER-6 WEB USAGE MINING USING CLUSTERING
CHAPTER-6 WEB USAGE MINING USING CLUSTERING 6.1 Related work in Clustering Technique 6.2 Quantifiable Analysis of Distance Measurement Techniques 6.3 Approaches to Formation of Clusters 6.4 Conclusion
More informationComparison of Sequence Similarity Measures for Distant Evolutionary Relationships
Comparison of Sequence Similarity Measures for Distant Evolutionary Relationships Abhishek Majumdar, Peter Z. Revesz Department of Computer Science and Engineering, University of Nebraska-Lincoln, Lincoln,
More informationFinding homologous sequences in databases
Finding homologous sequences in databases There are multiple algorithms to search sequences databases BLAST (EMBL, NCBI, DDBJ, local) FASTA (EMBL, local) For protein only databases scan via Smith-Waterman
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationResearch Article Aligning Sequences by Minimum Description Length
Hindawi Publishing Corporation EURASIP Journal on Bioinformatics and Systems Biology Volume 2007, Article ID 72936, 14 pages doi:10.1155/2007/72936 Research Article Aligning Sequences by Minimum Description
More informationL4: Blast: Alignment Scores etc.
L4: Blast: Alignment Scores etc. Why is Blast Fast? Silly Question Prove or Disprove: There are two people in New York City with exactly the same number of hairs. Large database search Database (n) Query
More informationAlignment of Long Sequences
Alignment of Long Sequences BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2009 Mark Craven craven@biostat.wisc.edu Pairwise Whole Genome Alignment: Task Definition Given a pair of genomes (or other large-scale
More information