Integration. September 28, 2017

Size: px
Start display at page:

Download "Integration. September 28, 2017"

Transcription

1 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve lredy know, integrtion is the inverse of differentition, or sometimes clled ntiderivtive. In fct, by relising the reltionship between these two opertions, hs lid out the foundtion of wht we now clled Clculus which ws invented by Newton nd Leibniz independently in 7th century. Our min gol for this chpter is to lern bout the integrtion of the trnscendentl functions. First we will strt on reviewing the integrtion of simple integrnd(the eqution tht we wnt to integrte, the indefinite nd the definite integrl. Next we will lern the three techniques of integrtion, nd then we will pply these techniques on integrting trnscendentl functions ccordingly. Review of Integrtion. Bsic Integrl Formul Exmple : Evlute the following indefinite integrls. x x x 3 x

2 sin x cos x e x x x 8 x 4 5 x 3 x 5 4 sec x cosec x ( + tn x sec x sin x cos x sin x cos x. Integrls with Sum, Difference nd Fctor Exmple : Evlute the following indefinite integrls. (3x + 8. ( 4 sech x tnh x

3 (x 4 + x 6 (3x x 4 x 3 (4 + tn x (sin x cos x (x + (3x 8. + e x sec x sec x.3 Definite Integrl Exmple 3: Evlute the following integrls.. 3. (3x + 7 (x + (x + 3 x 3 + x 3 3 Techniques of Integrtion 3. Integrtion by Substitution Method of substitution is strightforwrd from chin rule, nd this method is wht you should consider first before other methods. We usully choose the substitution for the inside function nd then mnipulte some lgebr for wht s left on the outside function. Exmple 4: Evlute the following integrl by using the proper substitution. (4x +. c x + b 3

4 e 4x e 3x+5 (x 9 5 sin 5x cos(x + 3 tn(3 x 9. x + 3 x + 3x +. x x 4 x + 6. x 3 + 4x. x + cos x 3x + 6 sin x 3. tn x sin x cos x sec x 4x(x 3 6 sin x cos 4 x e x (e x 3 9. ln x x 4

5 x ln x x sec (x + 3 tn(x + 3 xe x x(x + 5 x 3x x x x 3 cos x 4 e x sin e x e tn x sec x 5x cos(5 x + x + e x x x 4 sin (6x + 7 Sometimes the substitution is given to us. Hve in mind tht the substitution will help us to simplify the integrnd, not mking it more difficult to integrte, which is the sole reson on why we re lerning to find the pproprite substitution in using this technique. Exmple 5 Evlute the following integrls by using the given substitution. 3x 3x with substitution u = 3x. 5

6 . 4x with substitution x = sin θ. x 3. 4 x with substitution x = sin θ. 3. Integrtion by Prts Integrtion by prts is powerful method to evlute integrls when the integrnd is in the form of product of lgebric nd trnscendentl, such s x ln x, xe x, e x cos x. Generl formul for integrtion by prts is u dv = uv v du Tips If the integrl is in the form of x n ln x, tke u = ln x nd dv = x n. If the integrl is in the form of e x sin bx or e x cos bx, tke u = sin bx nd dv = e x. Or, we cn use the substitution the other wy round by tking u = e x nd dv = sin x. If the integrl is in the form of x n e x, x n sin x or use the substitution u = x n nd dv = e x, sin x, cos x. x n cos x, Exmple 6 Evlute the following integrl using the following integrls. x ln x. ln x 3. xe x xe x x sin x 6

7 6. 7. π x cos x x cos x π x sin x e x cos x x ln x 3.3 Tbulr Method When integrting by prts hve mny repeted integrtions nd differentitions, tbulr method is very useful trick since it s mking the integrtion by prt procedure more net. Exmple 7 Evlute the integrl using the tbulr method. x 3 e x.. x sin 3x. 3. x sec x. 4. x (x e 3x cos x 6. cos 5x sin 4x 3.4 Integrtion by Prtil Frction By using this technique, we rewrite the integrl which initlly in product nd quotient form, in terms of frction. In prctice the integrl is in the form of polynomil of rtionl functions, where the denomintor usully cn be fctorised. Though pretty much most of polynomil of degree cn be fctorised, ber in mind tht if the 7

8 fctor on the numertor results to complicted lgebr, you re dvised to use other method ie substitution or inverse trigonometric nd inverse hyperbolic. If the numertor hs the sme order of degree or more with the denomintor, it becomes n improper frction. For this prticulr cse, you re required to use long division of polynomils. Exmple 8 Evlute the integrl by using prtil frctions. 3x + x + 3x +. x 3 3x + x x + 7 (x x + x + 6 x 3 + x + x x x + x 3 x x x + 3x + x 5 5x (x + 4 Integrls of Hyperbolic Functions Integrls of hyperbolic functions re similr to the integrls of trigonometric functions. You my refer to the formul to find the ntiderivtive of the hyperbolic functions. As for the more complicted integrls, we cn use the three methods described erlier. Exmple. Evlute the following integrls sinh x b 5 cosh 3x c sinh x 8

9 d e f g cosh x 3 sech 4x cosh (5x + cosh x + 3 sinh x. By using the definitions show tht Hence show tht cosh x + sinh x = cosh x sinh x. cosh x + sinh x = ( e. 3. By using the tbulr method, evlute the following integrl x 3 cosh x b x sinh 3x c e 3x cosh x d sin x sinh 3x 5 Integrtion Involving Inverse Hyperbolic Functions nd Inverse Trigonometric Functions When integrtion involving inverse hyperbolic nd inverse trigonometric functions re in the form of x sinh - x, x cosh - x, tn - x, they cn be integrted using integrtion by prt(ibp sin - x, u dv = uv v du. It is solvble if we choose the inverse functions s u in the IBP formul, since the inverse function cnnot be integrted directly, nd cn only undergo differentition. Another form is when the integrnd is in the form of frction. Usully when we re given n integrl in frction form, we first try the method of substitution. If it is 9

10 not working, the we try the method of prtil frction. It is not necessrily in tht order, it cn be interchnge. However if both methods re not pplicble, then it must hve involved inverse hyperbolic or inverse trigonometric. inverse hyperbolic/trigonometric is in the form of Ax + B or Ax + B or Generlly the integrtion tht will result to x Ax + B. (5. Another form is Ax + Bx + C or Ax + Bx + C or x Ax + Bx + C, (5. tht requires completing the squre to get the form in Eqution 5.. Here, x is ny function of x. Once we hve the form s in Eqution 5., we just need to mtch it with the formul given by using the method of substitution to get the ntiderivtive tht involve the inverse trnscendentl function. It would be useful if we fmilirize ourselves with the technique of completing the squre tht will be used frequently in trnsforming the integrnd. Completing the squre is trnsforming the qudrtic eqution into x + bx + c =, (x + d + e =, where d = b b nd e = c 4. Prctice : Rewrite this expression by completing the squre. x + 4x +. x 6x 3. x 8x x + 7x + 3 Another pproch is to mke trigonometric substitution, which is originlly how the formul mterilized to the generl form s we cn use now. The form nd

11 respectively the substitution re given s : if x, substitute x = sin θ or x = cos θ (5.3 if + x, substitute x = sinh θ or x = tn θ (5.4 if x, substitute x = cosh θ or x = sec θ, (5.5 where is constnt. 5. Integrtion Involving Inverse Trigonometric Functions In previous chpter we hve lerned how to do the differentition of the inverse function using the formul. Hence to find the integrl, the ide is the sme. Wht we need to do is to mnipulte the integrnd(provided tht we re sure tht the integrl will result to inverse trigonometric or inverse hyperbolic, so tht it mtches the formul. Recll tht the differentition of inverse trigonometric is given s d [sin- x] = x d [cos- x] = x d [tn- x] = + x d [cot- x] = + x d [sec- x] = x x d [cosec- x] = x x.

12 Therefore the integrl formul is the ntiderivtive of those nd given s = x sin- x + C, x < = x cos- x + C, x < + x = tn- x + C + x = cot- x + C x x = sec- x + C, x > x x = cosec- x + C, x > Generlly, the integrl for the inverse trigonometric will look like this x, nd t first glnce, we know it looks like the differentition eqution of we let x = u, then = du. Hence x = du ( x u = sin- + C. d [sin- x]. If The sme procedure pplied on the pproprite integrnd similr to the form of differentition of tn - x nd sec - x. The generl formul for this type of integrnds re given s ( x x = sin- + C, x < + x = ( x tn- + C x x = ( x sec- + C, x >, where the integrtion formul tht ssocites with cos - x, cot - x nd cosec - x re just the negtive terms of the bove integrnds respectively. Exmple Evlute the following integrls.. 5 x. 9 + x

13 x x 4 9x 4 + 9x x 4x x x x + 4x + 5 x + x + x / x x x + (x x x 3 sin - x cos - x x tn - x 5. Integrtion Involving Inverse Hyperbolic Functions The procedure of solving the integrtion involving inverse hyperbolic functions is similr to the procedure of solving the integrting involving inverse trigonometric 3

14 functions. The generl formul for the integrnd tht will result to the inverse hyperbolic functions re given s ( x + x = sinh- x + C, > ( x x = cosh- x + C, x > x = ( x tnh- + C, if x < x = ( x coth- + C, if x > ( x x x = sech- + C, if < x < ( x x + x = cosech- + C, if < x < Exmple Evlute the following integrl.. x + x e x. 6 e x x x 6, x > 4 4 x, x < x 4x x x 4x + 5 4

15 . 5 3 x x.. (x + x + x + x x tnh - x 6 Conclusion In this topic, you re required to know how to integrte the integrls tht involve trigonometric, inverse trigonometric, hyperbolic nd inverse hyperbolic functions. Wht you should know first is to mster ll the techniques of integrtion which re Integrtion by Substitution Integrtion by Prts( nd Tbulr Method Integrtion by Prtil Frctions Once you hve fmilir yourselves with ll these techniques, the next step is to recognised the pttern of which technique you should use given n integrl. There is no trick or shortcut to it. It is dvised for you to do s mny integrtion prctises s you cn, then you will be ble to recognised the pttern. However it is suggested tht (but don t tke the following s strict rule tht you hve to follow for you to lwys try the method of substitution first. If it s not working ie the resulting substitution is not simple lgebric eqution, then you cn try prtil frction (if the integrl is in frction, nd followed by integrtion by prts. If you were given n integrtion in the form of frction with the denomintor is in squre root form, try the method of substitution first, if it isn t working, see if the integrtion of inverse trigonometric or hyperbolic works. If you were given n integrtion in form of frction of polynomil, check the order of the power. If the order of the numertor is the sme or greter thn the denomintor, then use long division first. 5

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Math 142, Exam 1 Information.

Math 142, Exam 1 Information. Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

The Fundamental Theorem of Calculus

The Fundamental Theorem of Calculus MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Solutions to Math 41 Final Exam December 12, 2011

Solutions to Math 41 Final Exam December 12, 2011 Solutions to Mth Finl Em December,. ( points) Find ech of the following its, with justifiction. If there is n infinite it, then eplin whether it is or. ( ) / ln() () (5 points) First we compute the it:

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association 9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

)

) Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

WebAssign Lesson 1-3a Substitution Part 1 (Homework)

WebAssign Lesson 1-3a Substitution Part 1 (Homework) WeAssign Lesson -3 Sustitution Prt (Homework) Current Score : / 3 Due : Fridy, June 7 04 :00 AM MDT Jimos Skriletz Mth 75, section 3, Summer 04 Instructor: Jimos Skriletz. /.5 points Suppose you hve the

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

6.2 Volumes of Revolution: The Disk Method

6.2 Volumes of Revolution: The Disk Method mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

Math 17 - Review. Review for Chapter 12

Math 17 - Review. Review for Chapter 12 Mth 17 - eview Ying Wu eview for hpter 12 1. Given prmetric plnr curve x = f(t), y = g(t), where t b, how to eliminte the prmeter? (Use substitutions, or use trigonometry identities, etc). How to prmeterize

More information

1 The Definite Integral

1 The Definite Integral The Definite Integrl Definition. Let f be function defined on the intervl [, b] where

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

Iterated Integrals. f (x; y) dy dx. p(x) To evaluate a type I integral, we rst evaluate the inner integral Z q(x) f (x; y) dy.

Iterated Integrals. f (x; y) dy dx. p(x) To evaluate a type I integral, we rst evaluate the inner integral Z q(x) f (x; y) dy. Iterted Integrls Type I Integrls In this section, we begin the study of integrls over regions in the plne. To do so, however, requires tht we exmine the importnt ide of iterted integrls, in which inde

More information

The Basic Properties of the Integral

The Basic Properties of the Integral The Bsic Properties of the Integrl When we compute the derivtive of complicted function, like + sin, we usull use differentition rules, like d [f()+g()] d f()+ d g(), to reduce the computtion d d d to

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org

More information

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X 4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X

More information

Matrices and Systems of Equations

Matrices and Systems of Equations Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.

More information

This notebook investigates the properties of non-integer differential operators using Fourier analysis.

This notebook investigates the properties of non-integer differential operators using Fourier analysis. Frctionl erivtives.nb Frctionl erivtives by Fourier ecomposition by Eric Thrne 4/9/6 This notebook investigtes the properties of non-integer differentil opertors using Fourier nlysis. In[]:=

More information

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a Mth 176 Clculus Sec. 6.: Volume I. Volume By Slicing A. Introduction We will e trying to find the volume of solid shped using the sum of cross section res times width. We will e driving towrd developing

More information

Study Guide for Exam 3

Study Guide for Exam 3 Mth 05 Elementry Algebr Fll 00 Study Guide for Em Em is scheduled for Thursdy, November 8 th nd ill cover chpters 5 nd. You my use "5" note crd (both sides) nd scientific clcultor. You re epected to no

More information

Essential Question What are some of the characteristics of the graph of a rational function?

Essential Question What are some of the characteristics of the graph of a rational function? 8. TEXAS ESSENTIAL KNOWLEDGE AND SKILLS A..A A..G A..H A..K Grphing Rtionl Functions Essentil Question Wht re some of the chrcteristics of the grph of rtionl function? The prent function for rtionl functions

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Are You Ready for Algebra 3/Trigonometry? Summer Packet **Required for all Algebra 3/Trig CP and Honors students**

Are You Ready for Algebra 3/Trigonometry? Summer Packet **Required for all Algebra 3/Trig CP and Honors students** Are You Red for Algebr /Trigonometr? Summer Pcket **Required for ll Algebr /Trig CP nd Honors students** Pge of The Algebr /Trigonometr course prepres students for Clculus nd college science courses. In

More information

f[a] x + f[a + x] x + f[a +2 x] x + + f[b x] x

f[a] x + f[a + x] x + f[a +2 x] x + + f[b x] x Bsic Integrtion This chpter contins the fundmentl theory of integrtion. We begin with some problems to motivte the min ide: pproximtion by sum of slices. The chpter confronts this squrely, nd Chpter 3

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Angle properties of lines and polygons

Angle properties of lines and polygons chievement Stndrd 91031 pply geometric resoning in solving problems Copy correctly Up to 3% of workbook Copying or scnning from ES workbooks is subject to the NZ Copyright ct which limits copying to 3%

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round

More information

Introduction Transformation formulae Polar graphs Standard curves Polar equations Test GRAPHS INU0114/514 (MATHS 1)

Introduction Transformation formulae Polar graphs Standard curves Polar equations Test GRAPHS INU0114/514 (MATHS 1) POLAR EQUATIONS AND GRAPHS GEOMETRY INU4/54 (MATHS ) Dr Adrin Jnnett MIMA CMth FRAS Polr equtions nd grphs / 6 Adrin Jnnett Objectives The purpose of this presenttion is to cover the following topics:

More information

CHAPTER 8 Quasi-interpolation methods

CHAPTER 8 Quasi-interpolation methods CHAPTER 8 Qusi-interpoltion methods In Chpter 5 we considered number of methods for computing spline pproximtions. The strting point for the pproximtion methods is dt set tht is usully discrete nd in the

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Yoplait with Areas and Volumes

Yoplait with Areas and Volumes Yoplit with Ares nd Volumes Yoplit yogurt comes in two differently shped continers. One is truncted cone nd the other is n ellipticl cylinder (see photos below). In this exercise, you will determine the

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

5/9/17. Lesson 51 - FTC PART 2. Review FTC, PART 1. statement as the Integral Evaluation Theorem as it tells us HOW to evaluate the definite integral

5/9/17. Lesson 51 - FTC PART 2. Review FTC, PART 1. statement as the Integral Evaluation Theorem as it tells us HOW to evaluate the definite integral Lesson - FTC PART 2 Review! We hve seen definition/formul for definite integrl s n b A() = lim f ( i )Δ = f ()d = F() = F(b) F() n i=! where F () = f() (or F() is the ntiderivtive of f() b! And hve seen

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

PhysicsAndMathsTutor.com

PhysicsAndMathsTutor.com M Centres of Mss - Rigid bodies nd composites. Figure A continer is formed by removing right circulr solid cone of height l from uniform solid right circulr cylinder of height 6l. The centre O of the plne

More information

Math 35 Review Sheet, Spring 2014

Math 35 Review Sheet, Spring 2014 Mth 35 Review heet, pring 2014 For the finl exm, do ny 12 of the 15 questions in 3 hours. They re worth 8 points ech, mking 96, with 4 more points for netness! Put ll your work nd nswers in the provided

More information

6.3 Definite Integrals and Antiderivatives

6.3 Definite Integrals and Antiderivatives Section 6. Definite Integrls nd Antiderivtives 8 6. Definite Integrls nd Antiderivtives Wht ou will lern out... Properties of Definite Integrls Averge Vlue of Function Men Vlue Theorem for Definite Integrls

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

Revisit: Limits at Infinity

Revisit: Limits at Infinity Revisit: Limits t Infinity Limits t Infinity: Wewrite to men the following: f () =L, or f ()! L s! + Conceptul Mening: Thevlueoff () willbesclosetol s we like when is su Forml Definition: Forny"> 0(nomtterhowsmll)thereeistsnM

More information

RATIONAL EQUATION: APPLICATIONS & PROBLEM SOLVING

RATIONAL EQUATION: APPLICATIONS & PROBLEM SOLVING RATIONAL EQUATION: APPLICATIONS & PROBLEM SOLVING When finding the LCD of problem involving the ddition or subtrction of frctions, it my be necessry to fctor some denomintors to discover some restricted

More information

Name Date Class. cot. tan. cos. 1 cot 2 csc 2

Name Date Class. cot. tan. cos. 1 cot 2 csc 2 Fundmentl Trigonometric Identities To prove trigonometric identit, use the fundmentl identities to mke one side of the eqution resemle the other side. Reciprocl nd Rtio Identities csc sec sin cos Negtive-Angle

More information

Lecture 5: Spatial Analysis Algorithms

Lecture 5: Spatial Analysis Algorithms Lecture 5: Sptil Algorithms GEOG 49: Advnced GIS Sptil Anlsis Algorithms Bsis of much of GIS nlsis tod Mnipultion of mp coordintes Bsed on Eucliden coordinte geometr http://stronom.swin.edu.u/~pbourke/geometr/

More information

arxiv: v2 [math.ho] 4 Jun 2012

arxiv: v2 [math.ho] 4 Jun 2012 Volumes of olids of Revolution. Unified pproch Jorge Mrtín-Morles nd ntonio M. Oller-Mrcén jorge@unizr.es, oller@unizr.es rxiv:5.v [mth.ho] Jun Centro Universitrio de l Defens - IUM. cdemi Generl Militr,

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

5 Regular 4-Sided Composition

5 Regular 4-Sided Composition Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Introduction. Chapter 4: Complex Integration. Introduction (Cont d)

Introduction. Chapter 4: Complex Integration. Introduction (Cont d) Introduction Chpter 4: Complex Integrtion Li, Yongzho Stte Key Lbortory of Integrted Services Networks, Xidin University October 10, 2010 The two-dimensionl nture of the complex plne required us to generlize

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

LIMITS AND CONTINUITY

LIMITS AND CONTINUITY LIMITS AND CONTINUITY Joe McBride/Stone/Gett Imges Air resistnce prevents the velocit of skdiver from incresing indefinitel. The velocit pproches it, clled the terminl velocit. The development of clculus

More information

Math 4 Review for Quarter 2 Cumulative Test

Math 4 Review for Quarter 2 Cumulative Test Mth 4 Review for Qurter 2 Cumultive Test Nme: I. Right Tringle Trigonometry (3.1-3.3) Key Fcts Pythgoren Theorem - In right tringle, 2 + b 2 = c 2 where c is the hypotenuse s shown below. c b Trigonometric

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

ONU Calculus I Math 1631

ONU Calculus I Math 1631 ONU Clculus I Mth 1631 2013-2014 Syllus Mrs. Trudy Thompson tthompson@lcchs.edu Text: Clculus 8 th Edition, Anton, Bivens nd Dvis Prerequisites: C or etter in Pre-Clc nd techer s permission This course

More information

EXPONENT RULES Add Multiply Subtraction Flip

EXPONENT RULES Add Multiply Subtraction Flip Algebr II Finl Em Review Nme Chpter 7 REVIEW: EXPONENT RULES Add Multiply Subtrction Flip Simplify the epression using the properties of eponents. Assume ll vribles re positive. 4 4. 8 8.. 4. 5. 9 9 5

More information

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area: Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Chapter 2 Sensitivity Analysis: Differential Calculus of Models

Chapter 2 Sensitivity Analysis: Differential Calculus of Models Chpter 2 Sensitivity Anlysis: Differentil Clculus of Models Abstrct Models in remote sensing nd in science nd engineering, in generl re, essentilly, functions of discrete model input prmeters, nd/or functionls

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

1.1 Lines AP Calculus

1.1 Lines AP Calculus . Lines AP Clculus. LINES Notecrds from Section.: Rules for Rounding Round or Truncte ll finl nswers to 3 deciml plces. Do NOT round before ou rech our finl nswer. Much of Clculus focuses on the concept

More information