Physics 152. Diffraction. Difrraction Gratings. Announcements. Friday, February 2, 2007
|
|
- Bernadette Norman
- 6 years ago
- Views:
Transcription
1 ics Fri Feb.02. Announcements Diffrction Difrrction Grtings Fridy, Februry 2, 2007 Help sessions: W 9-10 pm in NSC 118 Msteringics WU #5 due Mondy WU #6 due Wednesdy A bem of light of wvelength 580 nm psses through two closely spced glss pltes s shown. Wht is the minimum plte seprtion d > 0 for which the trnsmitted light be mximlly bright? Seprte Worksheet Worksheet Problem #1 d 1 2 1) 145 nm 2) 290 nm 3) 435 nm 4) 580 nm 5) 725 nm 6) 1160 nm 7) Cnnot determine In studying the two slit interference pttern, we ve mde some simplifying ssumptions nd neglected some importnt physicl processes. Perhps the most importnt of these is clled The wy we ve drwn our digrms for the 2-slit interference, we ve included the process lredy without relly commenting on its existence. et s tke close-up view of one of the slits... 1
2 If light is trvelling in stright pth, why don t we observe the following: Geometric optics cnnot explin the diffrction-- the bending of light round edges--tht is ctully observed in our experiments with the slits) When we project the light pssing through single slit onto distnt, guess wht we see Centrl mximum Secondry mxim Right bout this point, you should be sking yourself Why in the world should light from single slit produce wht looks like n interference pttern on the???? Secondry minim It is useful to employ Huygens principle to try to explin our observtions... Huygens principle dvises us to tret ech portion of wve front of light s source of light wves... A drk spot will pper on the t loctions where the pth length difference,, is hlf wvelength. Thinking bout the problem this wy llows us to see the single slit s contining lrge number of sources, ech of which cn interfere. = 2 sin = 2 minim 2
3 This is true for ny pir of sources seprted by hlf the slit width... Destructive interference will occur s long s the pth length difference is some integer multiple of the quntity / Therefore, ngles t which destructive interference occurs re given by sin = m = 2 sin = 2 minim Where m = +/- 1, +/- 2, +/- 3,. As with the two-slit interference pttern, we cn relte the distnce bove the centrl mximum of ech drk fringe with little geometry... y sin tn = = m y Notice tht when the slit width,, is less thn the wvelength, the quntity on the right side is greter thn 1! y sin tn = = m Therefore, for <, we will not observe the diffrction interference pttern. The secondry mxim cn be found on either side of the centrl mximum pproximtely hlf-wy between the loctions of successive minim. The centrl mximum is found t the ngle = 0. The secondry mxim pper t ngles given by: y 1 sin tn = = ( m + ) 2 Note tht the centrl mximum is twice s wide s the secondry mxim. The formule for the diffrction pttern look lot like those we sw for the two-slit interference pttern, but they re very different! Two-slit mxim sin = m d Diffrction minim sin = m 3
4 A bem of green light is diffrcted by slit of width mm. The diffrction pttern forms on 2.06 m wy from the slit. The distnce between the zero intensity res on both sides of the centrl mximum is 4.10 mm. Wht is the wvelength of the lser light? Worksheet Problem #2 1) 274 nm 4) 15 nm 2) 547 nm 3) 821 nm 5) 2189 nm 6) Cnnot determine Conceptully, it s quite simple to extend our discussion of diffrction nd Young s experiment to the cse of the interference pttern produced from n object known s Insted of the lrge number of sources tht we considered in the diffrction pttern using Huygen s principle, the diffrction grting consists of very lrge number of slits, ech one of which cts s its own source. Diffrction Grting Diffrction Grting N slits N slits You cn think of it s n N-slit interference pttern (where N is the number of slits). Diffrction grtings re usully described by the number of slits per unit length. As in Young s experiment, the observed diffrction pttern depends upon the slit seprtion, the wvelength of the incident light, nd the ngle to the. observed interference pttern N-slit mxim sin = m d Where m is the order number nd d the slit seprtion, given by / N for the diffrction grting. Notice tht these lines tend to be very nrrow centrl mximum Order of the Secondry mxim We cn proceed s before (using geometry) to locte the mxim. As you will see in the lbortory, diffrction grtings provide gret wy to seprte the constituent wvelengths of incident light, since ech wvelength will hve unique ngle for the ppernce of bright lines when exmined through the grting. All wvelengths will hve bright t ngle = 0, so bright white line usully ppers t this ngle. 4
5 ight from n rgon lser strikes diffrction grting with 5310 lines per centimeter. The centrl nd 1 st order principl mxim re seprted by m on wll 1.72 m from the grting. Wht is the wvelength of the lser light? Worksheet Problem #4 Worksheet Problem #3 1) 257 nm 2) 514 nm 3) 534 nm 4) 1028 nm 5) 1068 nm 6) impossible to determine 5
3.5.1 Single slit diffraction
3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More information2. What are the types of diffraction and give the differences between them? (June 2005, June 2011)
UNIT-1 b DIFFRACTION Diffrction:A) Distinction between Fresnel nd Frunhofer diffrction, B) diffrction due to single slit, N-slits,C) Diffrction grting experiment. 1 A) Distinction between Fresnel nd Frunhofer
More informationThe Nature of Light. Light is a propagating electromagnetic waves
The Nture of Light Light is propgting electromgnetic wves Index of Refrction n: In mterils, light intercts with toms/molecules nd trvels slower thn it cn in vcuum, e.g., vwter The opticl property of trnsprent
More informationOPTICS. (b) 3 3. (d) (c) , A small piece
AQB-07-P-106 641. If the refrctive indices of crown glss for red, yellow nd violet colours re 1.5140, 1.5170 nd 1.518 respectively nd for flint glss re 1.644, 1.6499 nd 1.685 respectively, then the dispersive
More informationChapter 2. 3/28/2004 H133 Spring
Chpter 2 Newton believe tht light ws me up of smll prticles. This point ws ebte by scientists for mny yers n it ws not until the 1800 s when series of experiments emonstrte wve nture of light. (But be
More informationDiffraction Patterns and Polarization
chpter 38 Diffrction Ptterns nd Polriztion 38.1 Introduction to Diffrction Ptterns 38.2 Diffrction Ptterns from Nrrow Slits 38.3 Resolution of Single-Slit nd Circulr Apertures 38.4 The Diffrction Grting
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationClass-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts
Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationRadiation & Matter 3: Refraction
Rdition & Mtter 3: Refrction Refrction AIM The effects of refrction (the chnge of direction tht tkes plce when light psses fro ir into glss) y hve been et during n erlier study of Physics. The i of this
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:
5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationOptics. Diffraction at a double slit and at multiple slits. LD Physics Leaflets P Bi. Wave optics Diffraction. Objects of the experiments
Optics Wve optics Diffrction LD Physics Leflets Diffrction t ouble slit n t multiple slits Objects of the experiments g Investigting iffrction t ouble slit for vrious slit spcings. g Investigting iffrction
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationAngle Properties in Polygons. Part 1 Interior Angles
2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationOptics and Optical design Problems
Optics nd Opticl design 0 Problems Sven-Görn Pettersson / Cord Arnold 0-09-06 4:3 This mteril is tken from severl sources. Some problems re from the book Våglär och Optik by Görn Jönsson nd Elisbeth Nilsson.
More informationOn the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis
On the Detection of Step Edges in Algorithms Bsed on Grdient Vector Anlysis A. Lrr6, E. Montseny Computer Engineering Dept. Universitt Rovir i Virgili Crreter de Slou sin 43006 Trrgon, Spin Emil: lrre@etse.urv.es
More informationMA 124 (Calculus II) Lecture 2: January 24, 2019 Section A3. Professor Jennifer Balakrishnan,
Wht is on tody Professor Jennifer Blkrishnn, jbl@bu.edu 1 Velocity nd net chnge 1 2 Regions between curves 3 1 Velocity nd net chnge Briggs-Cochrn-Gillett 6.1 pp. 398-46 Suppose you re driving long stright
More informationMATH 2530: WORKSHEET 7. x 2 y dz dy dx =
MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationProblems. .,..,... : Problems of increasing difficulty. CP: Cumulative problems incorporating material from earlier chapters.
1106 CHPTER 33 The Nture nd Propgtion of Light RIDGING PROLEM Reflection nd Refrction Figure 33.38 shows rectngulr glss block tht hs metl reflector on one fce nd wter on n djoining fce. light bem strikes
More informationAnalysis of Computed Diffraction Pattern Diagram for Measuring Yarn Twist Angle
Textiles nd Light ndustril Science nd Technology (TLST) Volume 3, 2014 DO: 10.14355/tlist.2014.0301.01 http://www.tlist-journl.org Anlysis of Computed Diffrction Pttern Digrm for Mesuring Yrn Twist Angle
More informationANALYTICAL GEOMETRY. The curves obtained by slicing the cone with a plane not passing through the vertex are called conics.
ANALYTICAL GEOMETRY Definition of Conic: The curves obtined by slicing the cone with plne not pssing through the vertex re clled conics. A Conic is the locus directrix of point which moves in plne, so
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationarxiv:cs.cg/ v1 18 Oct 2005
A Pir of Trees without Simultneous Geometric Embedding in the Plne rxiv:cs.cg/0510053 v1 18 Oct 2005 Mrtin Kutz Mx-Plnck-Institut für Informtik, Srbrücken, Germny mkutz@mpi-inf.mpg.de October 19, 2005
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationFall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.
15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for
More informationPHYSICS - CLUTCH CH 32: WAVE OPTICS.
!! www.clutchprep.com CONCEPT: DIFFRACTION Remember! Light travels in a straight line so long as it isn t disturbed - This allows light to be described as RAYS A common way to disturb light is to have
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationFinal. Mark Scheme. Physics A PHYA2. (Specification 2450) Unit 2: Mechanics, materials and waves. General Certificate of Education (A-level) June 2011
Version 1.0 Generl Certificte of Eduction (A-level) June 011 Physics A PHYA (Specifiction 450) Unit : Mechnics, mterils nd wves Finl Mrk Scheme Mrk schemes re prepred by the Principl Exminer nd considered,
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationCollege Physics B - PHY2054C
Young College - PHY2054C Wave Optics: 10/29/2014 My Office Hours: Tuesday 10:00 AM - Noon 206 Keen Building Outline Young 1 2 3 Young 4 5 Assume a thin soap film rests on a flat glass surface. Young Young
More information4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E
4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationII. THE ALGORITHM. A. Depth Map Processing
Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationPhysics 208: Electricity and Magnetism Exam 1, Secs Feb IMPORTANT. Read these directions carefully:
Physics 208: Electricity nd Mgnetism Exm 1, Secs. 506 510 11 Feb. 2004 Instructor: Dr. George R. Welch, 415 Engineering-Physics, 845-7737 Print your nme netly: Lst nme: First nme: Sign your nme: Plese
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationx )Scales are the reciprocal of each other. e
9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationPhysical Optics. 1 st year physics laboratories. University of Ottawa.
Physical Optics 1 st year physics laboratories University of Ottawa https://uottawa.brightspace.com/d2l/home INTRODUCTION Physical optics deals with light as a wave which can bend around obstacles (diffraction)
More information3 FRACTIONS. Before you start. Objectives
FRATIONS Only one eighth of n iceberg shows bove the surfce of the wter, which leves most of it hidden. The lrgest northern hemisphere iceberg ws encountered ner Bffin Islnd in nd in 1. It ws 1 km long,
More information9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association
9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationHW Stereotactic Targeting
HW Stereotctic Trgeting We re bout to perform stereotctic rdiosurgery with the Gmm Knife under CT guidnce. We instrument the ptient with bse ring nd for CT scnning we ttch fiducil cge (FC). Above: bse
More informationMcAfee Network Security Platform
10/100/1000 Copper Active Fil-Open Bypss Kit Guide Revision E McAfee Network Security Pltform This document descries the contents nd how to instll the McAfee 10/100/1000 Copper Active Fil-Open Bypss Kit
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationprisms Prisms Specifications Catalogue number BK7 Wedge, Beam Deviation, deg
Cotings Wedge Steer bems in opticl systems Cn be used in pirs for continuous ngulr djustment T Hving selected n pproprite wedge, it is esy to crete precise bem devition without ffecting other bem prmeters.
More informationModels of Light The wave model: The ray model: The photon model:
Models of Light The wave model: under many circumstances, light exhibits the same behavior as sound or water waves. The study of light as a wave is called wave optics. The ray model: The properties of
More informationPower Transmittance of a Laterally Shifted Gaussian Beam through a Circular Aperture
Poer Trnsmittnce of Lterlly Shifted Gussin Bem through Circulr Aperture Triq Shmim Khj 1 nd Syed Azer Rez 1 1. Deprtment of Electricl Engineering, Lhore University of Mngement Sciences, DHA, Lhore 5479,
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationPhysical or wave optics
Physical or wave optics In the last chapter, we have been studying geometric optics u light moves in straight lines u can summarize everything by indicating direction of light using a ray u light behaves
More informationGuide for sending an Electronic Dental referral
Guide for sending n Electronic Dentl referrl 1. Lunch Rego vi your Ptient Record System Open the Rego referrl templte vi your Ptient Record System: Exct / SOE: Open the ptient record, then click on Ptient
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More informationB. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a
Mth 176 Clculus Sec. 6.: Volume I. Volume By Slicing A. Introduction We will e trying to find the volume of solid shped using the sum of cross section res times width. We will e driving towrd developing
More information)
Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between
More informationCAUTION: NEVER LOOK DIRECTLY INTO THE LASER BEAM.
LABORATORY 12 PHYSICAL OPTICS I: INTERFERENCE AND DIFFRACTION Objectives To be able to explain demonstrate understanding of the dependence of a double slit interference pattern on slit width, slit separation
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationIterated Integrals. f (x; y) dy dx. p(x) To evaluate a type I integral, we rst evaluate the inner integral Z q(x) f (x; y) dy.
Iterted Integrls Type I Integrls In this section, we begin the study of integrls over regions in the plne. To do so, however, requires tht we exmine the importnt ide of iterted integrls, in which inde
More informationPRISMS. Don t see exactly what you are looking for? CVI Laser Optics specializes in prototype to volume production manufacturing!
PRISMS Mirrors CVI Lser Optics mnufctures lrge selection of high qulity prisms for use in mny pplictions including diverse industril nd scientific uses, lser trcking nd lignment, spectroscopy, nd militry
More informationIntroduction Transformation formulae Polar graphs Standard curves Polar equations Test GRAPHS INU0114/514 (MATHS 1)
POLAR EQUATIONS AND GRAPHS GEOMETRY INU4/54 (MATHS ) Dr Adrin Jnnett MIMA CMth FRAS Polr equtions nd grphs / 6 Adrin Jnnett Objectives The purpose of this presenttion is to cover the following topics:
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationResearch Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES
Volume 2, 1977 Pges 349 353 http://topology.uburn.edu/tp/ Reserch Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES by J. A. Guthrie, H. E. Stone, nd M. L. Wge Topology Proceedings Web: http://topology.uburn.edu/tp/
More informationCompanion Mathematica Notebook for "What is The 'Equal Weight View'?"
Compnion Mthemtic Notebook for "Wht is The 'Equl Weight View'?" Dvid Jehle & Brnden Fitelson July 9 The methods used in this notebook re specil cses of more generl decision procedure
More informationInterference. Electric fields from two different sources at a single location add together. The same is true for magnetic fields at a single location.
Interference Electric fields from two different sources at a single location add together. The same is true for magnetic fields at a single location. Thus, interacting electromagnetic waves also add together.
More informationV12 FAMILY BRAND GUIDELINES
V12 FAMILY BRAND GUIDELINES LOGO The logo is n importnt element of our visul identity. It must not be re-drwn or ltered in ny wy nd hs size nd minimum spce requirements to ensure tht it is lwys visully
More information