Slides for Data Mining by I. H. Witten and E. Frank

Size: px
Start display at page:

Download "Slides for Data Mining by I. H. Witten and E. Frank"

Transcription

1 Slides for Dt Mining y I. H. Witten nd E. Frnk

2 Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully & independently A weighted liner comintion might do Instnce-sed: use few prototypes Use simple logicl rules Success of method depends on the domin 3

3 Inferring rudimentry rules 1R: lerns 1-level decision tree I.e., rules tht ll test one prticulr ttriute Bsic version One rnch for ech vlue Ech rnch ssigns most frequent clss Error rte: proportion of instnces tht don t elong to the mjority clss of their corresponding rnch Choose ttriute with lowest error rte (ssumes nominl ttriutes) 4

4 Pseudo-code for 1R For ech ttriute, For ech vlue of the ttriute, mke rule s follows: count how often ech clss ppers find the most frequent clss mke the rule ssign tht clss to this ttriute-vlue Clculte the error rte of the rules Choose the rules with the smllest error rte Note: missing is treted s seprte ttriute vlue 5

5 Evluting the wether ttriutes Outlook Temp Humidity Wind y Ply Attriute Rules Errors Totl errors Sunny Hot High Flse No Outlook Sunny No 2/5 4/14 Sunny Hot High True No Overcst 0/4 Overcst Hot High Flse Riny 2/5 Riny Mild High Flse Temp Hot No* 2/4 5/14 Riny Cool Flse Mild 2/6 Riny Cool True No Cool 1/4 Overcst Cool True Humidity High No 3/7 4/14 Sunny Mild High Flse No 1/7 Sunny Cool Flse Windy Flse 2/8 5/14 Riny Mild Flse True No* 3/6 Sunny Mild True Overcst Overcst Riny Mild Hot Mild High High True Flse True No * indictes tie 6

6 Deling with numeric ttriutes Discretize numeric ttriutes Divide ech ttriute s rnge into intervls Sort instnces ccording to ttriute s vlues Plce rekpoints where the clss chnges (the mjority clss) Outlook Temperture This minimizes the totl error Sunny Exmple: Sunny temperture 80 from 90 wether True dt Overcst Riny Humidity No No No No No Windy Flse Flse Flse Ply No No 7

7 The prolem of overfitting This procedure is very sensitive to noise One instnce with n incorrect clss lel will proly produce seprte intervl Also: time stmp ttriute will hve zero errors Simple solution: enforce minimum numer of instnces in mjority clss per intervl Exmple (with min = 3): No No No No No No No No No No8

8 With overfitting voidnce Resulting rule set: Attriute Rules Errors Totl errors Outlook Sunny No 2/5 4/14 Overcst 0/4 Riny 2/5 Temperture /10 5/14 > 77.5 No* 2/4 Humidity /7 3/14 > 82.5 nd 95.5 No 2/6 > /1 Windy Flse 2/8 5/14 True No* 3/6 9

9 Discussion of 1R 1R ws descried in pper y Holte (1993) Contins n experimentl evlution on 16 dtsets (using cross-vlidtion so tht results were representtive of performnce on future dt) Minimum numer of instnces ws set to 6 fter some experimenttion 1R s simple rules performed not much worse thn much more complex decision trees Simplicity first pys off! Very Simple Clssifiction Rules Perform Well on Most Commonly Used Dtsets Roert C. Holte, Computer Science Deprtment, University of Ottw 10

10 Covering lgorithms Convert decision tree into rule set Strightforwrd, ut rule set overly complex More effective conversions re not trivil Insted, cn generte rule set directly for ech clss in turn find rule set tht covers ll instnces in it (excluding instnces not in the clss) Clled covering pproch: t ech stge rule is identified tht covers some of the instnces 44

11 Exmple: generting rule y x y 1 2 x y x If true then clss = If x > 1.2 then clss = Possile rule set for clss : If x 1.2 then clss = If x > 1.2 nd y > 2.6 then clss = If x > 1.2 nd y 2.6 then clss = Could dd more rules, get perfect rule set 45

12 Rules vs. trees Corresponding decision tree: (produces exctly the sme predictions) But: rule sets cn e more perspicuous when decision trees suffer from replicted sutrees Also: in multiclss situtions, covering lgorithm concentrtes on one clss t time wheres decision tree lerner tkes ll clsses into ccount 46

13 Simple covering lgorithm Genertes rule y dding tests tht mximize rule s ccurcy Similr to sitution in decision trees: prolem of selecting n ttriute to split on But: decision tree inducer mximizes overll purity Ech new test reduces rule s coverge: spce of exmples rule so fr rule fter dding new term 47

14 Selecting test Gol: mximize ccurcy t totl numer of instnces covered y rule p positive exmples of the clss covered y rule t p numer of errors mde y rule Select test tht mximizes the rtio p/t We re finished when p/t = 1 or the set of instnces cn t e split ny further 48

15 Exmple: contct lens dt Rule we seek: Possile tests: If? then recommendtion = hrd Age = Young Age = Pre-presyopic Age = Presyopic Spectcle prescription = Myope Spectcle prescription = Hypermetrope Astigmtism = no Astigmtism = yes Ter production rte = Reduced Ter production rte = 2/8 1/8 1/8 3/12 1/12 0/12 4/12 0/12 4/12 49

16 Modified rule nd resulting dt Rule with est test dded: If stigmtism = yes then recommendtion = hrd Instnces covered y modified rule: Age Spectcle prescription Astigmtism Ter production rte Recommended lenses Young Myope Reduced None Young Myope Hrd Young Hypermetrope Reduced None Young Hypermetrope hrd Pre-presyopic Myope Reduced None Pre-presyopic Myope Hrd Pre-presyopic Hypermetrope Reduced None Pre-presyopic Hypermetrope None Presyopic Myope Reduced None Presyopic Myope Hrd Presyopic Hypermetrope Reduced None Presyopic Hypermetrope None 50

17 Further refinement Current stte: If stigmtism = yes nd? then recommendtion = hrd Possile tests: Age = Young Age = Pre-presyopic Age = Presyopic Spectcle prescription = Myope Spectcle prescription = Hypermetrope Ter production rte = Reduced Ter production rte = 2/4 1/4 1/4 3/6 1/6 0/6 4/6 51

18 Modified rule nd resulting dt Rule with est test dded: If stigmtism = yes nd ter production rte = norml then recommendtion = hrd Instnces covered y modified rule: Age Young Young Pre-presyopic Pre-presyopic Presyopic Presyopic Spectcle prescription Myope Hypermetrope Myope Hypermetrope Myope Hypermetrope Astigmtism Ter production rte Recommended lenses Hrd hrd Hrd None Hrd None 52

19 Further refinement Current stte: If stigmtism = yes nd ter production rte = norml nd? then recommendtion = hrd Possile tests: Age = Young Age = Pre-presyopic Age = Presyopic Spectcle prescription = Myope Spectcle prescription = Hypermetrope 2/2 1/2 1/2 3/3 1/3 Tie etween the first nd the fourth test We choose the one with greter coverge 53

20 The result Finl rule: If stigmtism = yes nd ter production rte = norml nd spectcle prescription = myope then recommendtion = hrd Second rule for recommending hrd lenses : (uilt from instnces not covered y first rule) If ge = young nd stigmtism = yes nd ter production rte = norml then recommendtion = hrd These two rules cover ll hrd lenses : Process is repeted with other two clsses 54

21 Pseudo-code for PRISM For ech clss C Initilize E to the instnce set While E contins instnces in clss C Crete rule R with n empty left-hnd side tht predicts clss C Until R is perfect (or there re no more ttriutes to use) do For ech ttriute A not mentioned in R, nd ech vlue v, Consider dding the condition A = v to the left-hnd side of R Select A nd v to mximize the ccurcy p/t (rek ties y choosing the condition with the lrgest p) Add A = v to R Remove the instnces covered y R from E 55

22 Rules vs. decision lists PRISM with outer loop removed genertes decision list for one clss Susequent rules re designed for rules tht re not covered y previous rules But: order doesn t mtter ecuse ll rules predict the sme clss Outer loop considers ll clsses seprtely No order dependence implied Prolems: overlpping rules, defult rule required 56

23 Seprte nd conquer Methods like PRISM (for deling with one clss) re seprte-nd-conquer lgorithms: First, identify useful rule Then, seprte out ll the instnces it covers Finlly, conquer the remining instnces Difference to divide-nd-conquer methods: Suset covered y rule doesn t need to e explored ny further 57

Data Mining Algorithms: Basic Methods

Data Mining Algorithms: Basic Methods Algorithms: The basic methods Inferring rudimentary rules Data Mining Algorithms: Basic Methods Chapter 4 of Data Mining Statistical modeling Constructing decision trees Constructing rules Association

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

II. THE ALGORITHM. A. Depth Map Processing

II. THE ALGORITHM. A. Depth Map Processing Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

A Comparison of the Discretization Approach for CST and Discretization Approach for VDM

A Comparison of the Discretization Approach for CST and Discretization Approach for VDM Interntionl Journl of Innovtive Reserch in Advnced Engineering (IJIRAE) Volume1 Issue1 (Mrch 2014) A Comprison of the Discretiztion Approch for CST nd Discretiztion Approch for VDM Omr A. A. Shib Fculty

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

Data Mining Part 5. Prediction

Data Mining Part 5. Prediction Data Mining Part 5. Prediction 5.4. Spring 2010 Instructor: Dr. Masoud Yaghini Outline Using IF-THEN Rules for Classification Rule Extraction from a Decision Tree 1R Algorithm Sequential Covering Algorithms

More information

Misrepresentation of Preferences

Misrepresentation of Preferences Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from

More information

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure , Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured

More information

arxiv: v1 [cs.db] 16 Sep 2016

arxiv: v1 [cs.db] 16 Sep 2016 Blech: A Distriuted Strem Dt Clening System Yongcho Tin Eurecom yongcho.tin@eurecom.fr Pietro Michirdi Eurecom pietro.michirdi@eurecom.fr Mrko Vukolić IBM Reserch - Zurich mvu@zurich.im.com rxiv:169.5113v1

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

USING HOUGH TRANSFORM IN LINE EXTRACTION

USING HOUGH TRANSFORM IN LINE EXTRACTION Stylinidis, Efstrtios USING HOUGH TRANSFORM IN LINE EXTRACTION Efstrtios STYLIANIDIS, Petros PATIAS The Aristotle University of Thessloniki, Deprtment of Cdstre Photogrmmetry nd Crtogrphy Univ. Box 473,

More information

Geometric transformations

Geometric transformations Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Data Mining. 3.3 Rule-Based Classification. Fall Instructor: Dr. Masoud Yaghini. Rule-Based Classification

Data Mining. 3.3 Rule-Based Classification. Fall Instructor: Dr. Masoud Yaghini. Rule-Based Classification Data Mining 3.3 Fall 2008 Instructor: Dr. Masoud Yaghini Outline Using IF-THEN Rules for Classification Rules With Exceptions Rule Extraction from a Decision Tree 1R Algorithm Sequential Covering Algorithms

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION

CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION CIS 1068 Progrm Design nd Astrction Spring2015 Midterm Exm 1 Nme SOLUTION Pge Points Score 2 15 3 8 4 18 5 10 6 7 7 7 8 14 9 11 10 10 Totl 100 1 P ge 1. Progrm Trces (41 points, 50 minutes) Answer the

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Inference of node replacement graph grammars

Inference of node replacement graph grammars Glley Proof 22/6/27; :6 File: id293.tex; BOKCTP/Hin p. Intelligent Dt Anlysis (27) 24 IOS Press Inference of node replcement grph grmmrs Jcek P. Kukluk, Lwrence B. Holder nd Dine J. Cook Deprtment of Computer

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Thirty-fourth Annual Columbus State Invitational Mathematics Tournament. Instructions

Thirty-fourth Annual Columbus State Invitational Mathematics Tournament. Instructions Thirty-fourth Annul Columbus Stte Invittionl Mthemtics Tournment Sponsored by Columbus Stte University Deprtment of Mthemtics Februry, 008 ************************* The Mthemtics Deprtment t Columbus Stte

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

Bleach: A Distributed Stream Data Cleaning System

Bleach: A Distributed Stream Data Cleaning System Blech: A Distriuted Strem Dt Clening System Yongcho Tin Eurecom Biot, Frnce Emil: yongcho.tin@eurecom.fr Pietro Michirdi Eurecom Biot, Frnce Emil: pietro.michirdi@eurecom.fr Mrko Vukolić IBM Reserch Zurich,

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

Blackbaud s Mailwise Service Analyse Records Updated by MailWise

Blackbaud s Mailwise Service Analyse Records Updated by MailWise Blckud s Milwise Service Anlyse Records Updted y MilWise To nlyse the updtes tht hve een performed y the import, run the relevnt queries from the list elow. The queries selected depend on the MilWise Services

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

SAPPER: Subgraph Indexing and Approximate Matching in Large Graphs

SAPPER: Subgraph Indexing and Approximate Matching in Large Graphs SAPPER: Sugrph Indexing nd Approximte Mtching in Lrge Grphs Shijie Zhng, Jiong Yng, Wei Jin EECS Dept., Cse Western Reserve University, {shijie.zhng, jiong.yng, wei.jin}@cse.edu ABSTRACT With the emergence

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information