Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Size: px
Start display at page:

Download "Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search"

Transcription

1 Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t

2 Tody Serch Problems Uninformed Serch Methods Depth-First Serch Bredth-First Serch Uniform-Cost Serch

3 Serch Problems A serch problem consists of: A stte spce A successor function (with ctions, costs) A strt stte nd gol test N, 1.0 E, 1.0 A solution is sequence of ctions ( pln) which trnsforms the strt stte to gol stte

4 Serch Problems Are Models

5 Exmple: Trveling in Romni Stte spce: Cities Successor function: Rods: Go to djcent city with cost = distnce Strt stte: Ard Gol test: Is stte == Buchrest? Solution?

6 Wht s in Stte Spce? The world stte includes every lst detil of the environment A serch stte keeps only the detils needed for plnning (bstrction) Problem: Pthing Sttes: (x,y) loction Actions: NSEW Successor: updte loction only Gol test: is (x,y)=end Problem: Et-All-Dots Sttes: {(x,y), dot boolens} Actions: NSEW Successor: updte loction nd possibly dot boolen Gol test: dots ll flse

7 Stte Spce Sizes? World stte: Agent positions: 120 Food count: 30 Ghost positions: 12 Agent fcing: NSEW How mny World sttes? 120x(2 30 )x(12 2 )x4 Sttes for pthing? 120 Sttes for et-ll-dots? 120x(2 30 )

8 Stte Spce Grphs nd Serch Trees G b c S d h e f p q r

9 Stte Spce Grphs Stte spce grph: A mthemticl representtion of serch problem Nodes re (bstrcted) world configurtions Arcs represent successors (ction results) The gol test is set of gol nodes (mybe only one) In stte spce grph, ech stte occurs only once! We cn rrely build this full grph in memory (it s too big), but it s useful ide

10 Stte Spce Grphs Stte spce grph: A mthemticl representtion of serch problem Nodes re (bstrcted) world configurtions b c G Arcs represent successors (ction results) The gol test is set of gol nodes (mybe only one) d e f S h In serch grph, ech stte occurs only once! p q r We cn rrely build this full grph in memory (it s too big), but it s useful ide Tiny serch grph for tiny serch problem

11 Serch Trees This is now / strt N, 1.0 E, 1.0 Possible futures A serch tree: A wht if tree of plns nd their outcomes The strt stte is the root node Children correspond to successors Nodes show sttes, but correspond to PLANS tht chieve those sttes For most problems, we cn never ctully build the whole tree

12 Stte Spce Grphs vs. Serch Trees S Stte Spce Grph b c e d f h p q r G Ech NODE in in the serch tree is n entire PATH in the stte spce grph. We construct both on demnd nd we construct s little s possible. b d c Serch Tree S e e h r h r p q f p q f q c G q c G p q

13 Quiz: Stte Spce Grphs vs. Serch Trees Consider this 4-stte grph: How big is its serch tree (from S)? S G b Importnt: Lots of repeted structure in the serch tree!

14 Tree Serch

15 Serch Exmple: Romni

16 Serching with Serch Tree Serch: Expnd out potentil plns (tree nodes) Mintin fringe of prtil plns under considertion Try to expnd s few tree nodes s possible

17 Generl Tree Serch Importnt ides: Fringe Expnsion Explortion strtegy Min question: which fringe nodes to explore?

18 Exmple: Tree Serch b c G S d h e f p q r

19 Depth-First Serch

20 Depth-First Serch S b d p c e p h f r q q c G q e p h f r q q c G S G d b p q c e h f r q p h f d b c e r Strtegy: expnd deepest node first Implementtion: Fringe is LIFO stck

21 Serch Algorithm Properties

22 Serch Algorithm Properties Complete: Gurnteed to find solution if one exists? Optiml: Gurnteed to find the lest cost pth? Time complexity? Spce complexity? b 1 node b nodes Crtoon of serch tree: b is the brnching fctor m is the mximum depth solutions t vrious depths Number of nodes in entire tree? 1 + b + b 2 +. b m = O(b m ) m tiers b 2 nodes b m nodes

23 Depth-First Serch (DFS) Properties Wht nodes DFS expnd? Some left prefix of the tree. Could process the whole tree! b 1 node b nodes If m is finite, tkes time O(b m ) b 2 nodes How much spce does the fringe tke? Only hs siblings on pth to root, so O(bm) m tiers Is it complete? m could be infinite, so only if we prevent cycles (more lter) b m nodes Is it optiml? No, it finds the leftmost solution, regrdless of depth or cost

24 Bredth-First Serch

25 Bredth-First Serch Strtegy: expnd shllowest node first Implementtion: Fringe is FIFO queue S b p d q c h e r f G S Serch Tiers b d c h e r p h q e r f p q p q f q c G q c G

26 Bredth-First Serch (BFS) Properties Wht nodes does BFS expnd? Processes ll nodes bove shllowest solution Let depth of shllowest solution be s Serch tkes time O(b s ) s tiers b 1 node b nodes b 2 nodes How much spce does the fringe tke? b s nodes Hs roughly the lst tier, so O(b s ) Is it complete? b m nodes s must be finite if solution exists, so yes! Is it optiml? Only if costs re ll 1 (more on costs lter)

27 Quiz: DFS vs BFS When will BFS outperform DFS? When will DFS outperform BFS?

28 Wht serch strtegy is this? Bredth-First Serch (BFS)

29 Wht serch strtegy is this? Depth-First Serch (DFS)

30 Wht serch strtegy is this? Depth-First Serch (DFS)

31 Wht serch strtegy is this? Bredth-First Serch (BFS)

32 Itertive Deepening Ide: get DFS s spce dvntge with BFS s time / shllow-solution dvntges Run DFS with depth limit 1. If no solution Run DFS with depth limit 2. If no solution Run DFS with depth limit 3... b Isn t tht wstefully redundnt? Generlly most work hppens in the lowest level serched, so not so bd!

33 Cost-Sensitive Serch b d 2 c e GOAL 2 f START 1 p 4 15 q 4 h r 2 BFS finds the shortest pth in terms of number of ctions. It does not find the lest-cost pth. We will now cover similr lgorithm which does find the lest-cost pth.

34 Uniform Cost Serch

35 Uniform Cost Serch Strtegy: expnd chepest node first: Fringe is priority queue (priority: cumultive cost) 2 b 1 3 S 1 p d q 2 c h e 8 2 r G 2 f 1 S 0 d 3 e 9 p 1 b 4 c 11 e 5 h 17 r 11 q 16 Cost contours 6 h 13 r 7 p q f p q f 8 q c G q 11 c G 10

36 Uniform Cost Serch (UCS) Properties Wht nodes does UCS expnd? Processes ll nodes with cost less thn chepest solution! If tht solution costs C* nd rcs cost t lest, then the effective depth is roughly C*/ Tkes time O(b C*/ ) (exponentil in effective depth) C*/ tiers b c 1 c 2 c 3 How much spce does the fringe tke? Hs roughly the lst tier, so O(b C*/ ) Is it complete? Assuming best solution hs finite cost nd minimum rc cost is positive, yes! Is it optiml? Yes! (Proof next lecture vi A*)

37 Uniform Cost Issues Remember: UCS explores incresing cost contours The good: UCS is complete nd optiml! c 1 c 2 c 3 The bd: Explores options in every direction No informtion bout gol loction Strt Gol We ll fix tht soon!

38 Wht serch strtegy is this? Bredth-First Serch (BFS)

39 Wht serch strtegy is this? Uniform Cost Serch (UCS)

40 The One Queue All these serch lgorithms re the sme except for fringe strtegies Conceptully, ll fringes re priority queues (i.e. collections of nodes with ttched priorities) Prcticlly, for DFS nd BFS, you cn void the log(n) overhed from n ctul priority queue, by using stcks nd queues Cn even code one implementtion tht tkes vrible queuing object

41 Serch Gone Wrong?

42 Old Greece Assignment

43 Serch nd Models Serch opertes over models of the world The gent doesn t ctully try ll the plns out in the rel world! Plnning is ll in simultion Your serch is only s good s your models

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

CSC 2114: Artificial Intelligence Search

CSC 2114: Artificial Intelligence Search CSC 2114: Artificial Intelligence Search Ernest Mwebaze emwebaze@cit.ac.ug Office: Block A : 3 rd Floor [Slide Credit Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. Reference materials

More information

Announcements. Project 0: Python Tutorial Due last night

Announcements. Project 0: Python Tutorial Due last night Announcements Project 0: Python Tutorial Due last night HW1 officially released today, but a few people have already started on it Due Monday 2/6 at 11:59 pm P1: Search not officially out, but some have

More information

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012 1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt

More information

CS 188: Ar)ficial Intelligence

CS 188: Ar)ficial Intelligence CS 188: Ar)ficial Intelligence Search Instructors: Pieter Abbeel & Anca Dragan University of California, Berkeley [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley

More information

CSE 473: Ar+ficial Intelligence

CSE 473: Ar+ficial Intelligence CSE 473: Ar+ficial Intelligence Search Instructor: Luke Ze=lemoyer University of Washington [These slides were adapted from Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials

More information

CS 4100 // artificial intelligence

CS 4100 // artificial intelligence CS 4100 // artificial intelligence instructor: byron wallace Search I Attribution: many of these slides are modified versions of those distributed with the UC Berkeley CS188 materials Thanks to John DeNero

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

521495A: Artificial Intelligence

521495A: Artificial Intelligence 521495A: Artificial Intelligence Search Lectured by Abdenour Hadid Associate Professor, CMVS, University of Oulu Slides adopted from http://ai.berkeley.edu Agent An agent is an entity that perceives the

More information

CS 5522: Artificial Intelligence II

CS 5522: Artificial Intelligence II CS 5522: Artificial Intelligence II Search Algorithms Instructor: Wei Xu Ohio State University [These slides were adapted from CS188 Intro to AI at UC Berkeley.] Today Agents that Plan Ahead Search Problems

More information

PEAS: Medical diagnosis system

PEAS: Medical diagnosis system PEAS: Medical diagnosis system Performance measure Patient health, cost, reputation Environment Patients, medical staff, insurers, courts Actuators Screen display, email Sensors Keyboard/mouse Environment

More information

CS 188: Artificial Intelligence Fall 2008

CS 188: Artificial Intelligence Fall 2008 CS 188: Artificil Intelligence Fll 2008 Lecture 2: Queue-Bsed Serc 9/2/2008 Dn Klein UC Berkeley Mny slides from eiter Sturt Russell or Andrew Moore Announcements Written ssignments: One mini-omework ec

More information

Graph Search. Chris Amato Northeastern University. Some images and slides are used from: Rob Platt, CS188 UC Berkeley, AIMA

Graph Search. Chris Amato Northeastern University. Some images and slides are used from: Rob Platt, CS188 UC Berkeley, AIMA Graph Search Chris Amato Northeastern University Some images and slides are used from: Rob Platt, CS188 UC Berkeley, AIMA What is graph search? Start state Goal state Graph search: find a path from start

More information

Uninformed search strategies (Section 3.4) Source: Fotolia

Uninformed search strategies (Section 3.4) Source: Fotolia Uninformed search strategies (Section 3.4) Source: Fotolia Uninformed search strategies A search strategy is defined by picking the order of node expansion Uninformed search strategies use only the information

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics,

Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, performance data Pattern DBs? General Tree Search function

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Warm- up. IteraAve version, not recursive. class TreeNode TreeNode[] children() boolean isgoal() DFS(TreeNode start)

Warm- up. IteraAve version, not recursive. class TreeNode TreeNode[] children() boolean isgoal() DFS(TreeNode start) Warm- up We ll o-en have a warm- up exercise for the 10 minutes before class starts. Here s the first one Write the pseudo code for breadth first search and depth first search IteraAve version, not recursive

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Uninformed Search. Reading: Chapter 4 (Tuesday, 2/5) HW#1 due next Tuesday

Uninformed Search. Reading: Chapter 4 (Tuesday, 2/5) HW#1 due next Tuesday Uninformed Search Reading: Chapter 4 (Tuesday, 2/5) HW#1 due next Tuesday 1 Uninformed Search through the space of possible solutions Use no knowledge about which path is likely to be best Exception: uniform

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Uninformed search strategies

Uninformed search strategies Uninformed search strategies A search strategy is defined by picking the order of node expansion Uninformed search strategies use only the informa:on available in the problem defini:on Breadth- first search

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

CS 188: Artificial Intelligence. Recap Search I

CS 188: Artificial Intelligence. Recap Search I CS 188: Artificial Intelligence Review of Search, CSPs, Games DISCLAIMER: It is insufficient to simply study these slides, they are merely meant as a quick refresher of the high-level ideas covered. You

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

The Distributed Data Access Schemes in Lambda Grid Networks

The Distributed Data Access Schemes in Lambda Grid Networks The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 1

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 1 CS 188 Introduction to Artificial Intelligence Fall 2018 Note 1 These lecture notes are heavily based on notes originally written by Nikhil Sharma. Agents In artificial intelligence, the central problem

More information

UNINFORMED SEARCH. What to do if teammates drop? Still have 3 or more? No problem keep going. Have two or fewer and want to be merged?

UNINFORMED SEARCH. What to do if teammates drop? Still have 3 or more? No problem keep going. Have two or fewer and want to be merged? UNINFORMED SEARCH EECS492 January 14, 2010 Administrative What to do if teammates drop? Still have 3 or more? No problem keep going. Have two or fewer and want to be merged? We ll do what we can. Submitting

More information

CS 771 Artificial Intelligence. Problem Solving by Searching Uninformed search

CS 771 Artificial Intelligence. Problem Solving by Searching Uninformed search CS 771 Artificial Intelligence Problem Solving by Searching Uninformed search Complete architectures for intelligence? Search? Solve the problem of what to do. Learning? Learn what to do. Logic and inference?

More information

CS 343: Artificial Intelligence

CS 343: Artificial Intelligence CS 343: Artificial Intelligence Informed Search Prof. Scott Niekum University of Texas at Austin [These slides based on ones created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley.

More information

Uninformed Search Strategies

Uninformed Search Strategies Uninformed Search Strategies Alan Mackworth UBC CS 322 Search 2 January 11, 2013 Textbook 3.5 1 Today s Lecture Lecture 4 (2-Search1) Recap Uninformed search + criteria to compare search algorithms - Depth

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

CS 4700: Foundations of Artificial Intelligence. Bart Selman. Search Techniques R&N: Chapter 3

CS 4700: Foundations of Artificial Intelligence. Bart Selman. Search Techniques R&N: Chapter 3 CS 4700: Foundations of Artificial Intelligence Bart Selman Search Techniques R&N: Chapter 3 Outline Search: tree search and graph search Uninformed search: very briefly (covered before in other prerequisite

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Uninformed Search Strategies AIMA 3.4

Uninformed Search Strategies AIMA 3.4 Uninformed Search Strategies AIMA 3.4 CIS 391-2015 1 The Goat, Cabbage, Wolf Problem (From xkcd.com) CIS 391-2015 2 But First: Missionaries & Cannibals Three missionaries and three cannibals come to a

More information

Announcements. CS 188: Artificial Intelligence

Announcements. CS 188: Artificial Intelligence Announcements Projects: Looking for project partners? --- Come to front after lecture. Try pair programming, not divide-and-conquer Account forms available up front during break and after lecture Assignments

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificial Intelligence Informed Search Instructor: Michele Van Dyne [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available

More information

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras CS 3 : Computer Systems - II Shnkr Blchndrn (shnkr@cse.iitm.c.in) Dept. of Computer Science & Engineering IIT Mdrs Recp Differentite Between s nd s Truth Tbles b AND b OR NOT September 4, 27 Introduction

More information

Improved Fast Replanning for Robot Navigation in Unknown Terrain

Improved Fast Replanning for Robot Navigation in Unknown Terrain Improved Fst Replnning for Robot Nvigtion in Unknown Terrin ollege of omputing Georgi Institute of Technology tlnt, G 0-00 GIT-OGSI-00/ Sven Koenig ollege of omputing Georgi Institute of Technology tlnt,

More information

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM Hving BLAST with SLAM Topic: Softwre Model Checking vi Counter-Exmple Guided Abstrction Refinement There re esily two dozen SLAM/BLAST/MAGIC ppers; I will skim. # # Theorem Proving Combining Strengths

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts

More information

CS 331: Artificial Intelligence Uninformed Search. Real World Search Problems

CS 331: Artificial Intelligence Uninformed Search. Real World Search Problems S 331: rtificial Intelligence Uninformed Search 1 Real World Search Problems 2 1 Simpler Search Problems 3 Static Observable Discrete Deterministic Single-agent ssumptions bout Our Environment 4 2 Search

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

CS 331: Artificial Intelligence Uninformed Search. Real World Search Problems

CS 331: Artificial Intelligence Uninformed Search. Real World Search Problems S 331: rtificial Intelligence Uninformed Search 1 Real World Search Problems 2 1 Simpler Search Problems 3 ssumptions bout Our Environment Fully Observable Deterministic Sequential Static Discrete Single-agent

More information

CS 331: Artificial Intelligence Uninformed Search. Leftovers from last time

CS 331: Artificial Intelligence Uninformed Search. Leftovers from last time S 331: rtificial Intelligence Uninformed Search 1 Leftovers from last time Discrete/ontinuous Discrete: finite number of values eg. Rating can be thumbs up or down ontinuous: infinite continuum of values

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

ARTIFICIAL INTELLIGENCE (CSC9YE ) LECTURES 2 AND 3: PROBLEM SOLVING

ARTIFICIAL INTELLIGENCE (CSC9YE ) LECTURES 2 AND 3: PROBLEM SOLVING ARTIFICIAL INTELLIGENCE (CSC9YE ) LECTURES 2 AND 3: PROBLEM SOLVING BY SEARCH Gabriela Ochoa http://www.cs.stir.ac.uk/~goc/ OUTLINE Problem solving by searching Problem formulation Example problems Search

More information

HW#1 due today. HW#2 due Monday, 9/09/13, in class Continue reading Chapter 3

HW#1 due today. HW#2 due Monday, 9/09/13, in class Continue reading Chapter 3 9-04-2013 Uninformed (blind) search algorithms Breadth-First Search (BFS) Uniform-Cost Search Depth-First Search (DFS) Depth-Limited Search Iterative Deepening Best-First Search HW#1 due today HW#2 due

More information

Lecture 3. Uninformed Search

Lecture 3. Uninformed Search Lecture 3 Uninformed Search 1 Uninformed search strategies Uninformed: While searching you have no clue whether one non-goal state is better than any other. Your search is blind. You don t know if your

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

Search: Advanced Topics and Conclusion

Search: Advanced Topics and Conclusion Search: Advanced Topics and Conclusion CPSC 322 Lecture 8 January 20, 2006 Textbook 2.6 Search: Advanced Topics and Conclusion CPSC 322 Lecture 8, Slide 1 Lecture Overview Recap Branch & Bound A Tricks

More information

ARTIFICIAL INTELLIGENCE. Pathfinding and search

ARTIFICIAL INTELLIGENCE. Pathfinding and search INFOB2KI 2017-2018 Utrecht University The Netherlands ARTIFICIAL INTELLIGENCE Pathfinding and search Lecturer: Silja Renooij These slides are part of the INFOB2KI Course Notes available from www.cs.uu.nl/docs/vakken/b2ki/schema.html

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

An introduction to model checking

An introduction to model checking An introduction to model checking Slide 1 University of Albert Edmonton July 3rd, 2002 Guy Trembly Dépt d informtique UQAM Outline Wht re forml specifiction nd verifiction methods? Slide 2 Wht is model

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Knowledge States: A Tool in Randomized Online Algorithms

Knowledge States: A Tool in Randomized Online Algorithms : A Tool in Rndomized Online Algorithms Center for the Advnced Study of Algorithms School of Computer Science University of Nevd, Ls Vegs ADS 2007 couthors: Lwrence L. Lrmore, John Nog, Rüdiger Reischuk

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

CS540 Uninformed Search

CS540 Uninformed Search CS540 Uninformed Search Xiaojin Zhu jerryzhu@cs.wisc.edu Computer Sciences Department University of Wisconsin, Madison slide 1 Main messages Many AI problems can be formulated as search. Iterative deepening

More information

Uninformed Search. CPSC 322 Lecture 5. September 14, 2007 Textbook 2.4. Graph Search Searching Depth-First Search

Uninformed Search. CPSC 322 Lecture 5. September 14, 2007 Textbook 2.4. Graph Search Searching Depth-First Search Uninformed Search CPSC 322 Lecture 5 September 14, 2007 Textbook 2.4 Uninformed Search CPSC 322 Lecture 5, Slide 1 Lecture Overview 1 Graph Search 2 Searching 3 Depth-First Search Uninformed Search CPSC

More information

Artificial Intelligence Informed Search

Artificial Intelligence Informed Search Artificial Intelligence Informed Search Instructors: David Suter and Qince Li Course Delivered @ Harbin Institute of Technology [Many slides adapted from those created by Dan Klein and Pieter Abbeel for

More information

CS 188: Artificial Intelligence Fall Search Gone Wrong?

CS 188: Artificial Intelligence Fall Search Gone Wrong? CS 188: Artificial Intelligence Fall 2009 Lecture 3: A* Search 9/3/2009 Pieter Aeel UC Berkeley Many slides from Dan Klein Search Gone Wrong? 1 Announcements Assignments: Project 0 (Python tutorial): due

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Artificial Intelligence: Search Part 1: Uninformed graph search

Artificial Intelligence: Search Part 1: Uninformed graph search rtificial Intelligence: Search Part 1: Uninformed graph search Thomas Trappenberg January 8, 2009 ased on the slides provided by Russell and Norvig, hapter 3 Search outline Part 1: Uninformed search (tree

More information

521495A: Artificial Intelligence

521495A: Artificial Intelligence 521495A: Artificial Intelligence Informed Search Lectured by Abdenour Hadid Adjunct Professor, CMVS, University of Oulu Slides adopted from http://ai.berkeley.edu Today Informed Search Heuristics Greedy

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

PAC-MAN is one of the most popular game

PAC-MAN is one of the most popular game SCHOOL OF DATA SCIENCE 1 Assignment1. Search in Pacman Project Report Shihan Ran - 15307130424 Abstract This project is aimed at designing a intelligent Pacman agent that is able to find optimal paths

More information

ARTIFICIAL INTELLIGENCE SOLVING PROBLEMS BY SEARCHING. Chapter 3

ARTIFICIAL INTELLIGENCE SOLVING PROBLEMS BY SEARCHING. Chapter 3 ARTIFICIAL INTELLIGENCE SOLVING PROBLEMS BY SEARCHING Chapter 3 1 PROBLEM SOLVING We want: To automatically solve a problem We need: A representation of the problem Algorithms that use some strategy to

More information

CS 188: Artificial Intelligence

CS 188: Artificial Intelligence CS 188: Artificial Intelligence Today Informed Search Informed Search Heuristics Greedy Search A* Search Instructor: Marco Alvarez University of Rhode Island (These slides were created/modified by Dan

More information

Artificial Intelligence

Artificial Intelligence Artificial Intelligence Dr Ahmed Rafat Abas Computer Science Dept, Faculty of Computers and Informatics, Zagazig University arabas@zu.edu.eg http://www.arsaliem.faculty.zu.edu.eg/ Solving problems by searching

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Uninformed Search Strategies AIMA

Uninformed Search Strategies AIMA Uninformed Search Strategies AIMA 3.3-3.4 CIS 421/521 - Intro to AI - Fall 2017 1 Review: Formulating search problems Formulate search problem States: configurations of the puzzle (9! configurations) Actions:

More information

Chapter 4. Uninformed Search Strategies

Chapter 4. Uninformed Search Strategies Chapter 4. Uninformed Search Strategies An uninformed (a.k.a. blind, brute-force) search algorithm generates the search tree without using any domain specific knowledge. The two basic approaches differ

More information