Fast Exact String Matching Algorithms
|
|
- Anissa York
- 5 years ago
- Views:
Transcription
1 Fast Exact String Matching Algorithms Thierry Lecroq Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore LAW 2007 King s College London February 8th and 9th, 2007
2 Outline 1 Introduction 2 Best Matching Shift 3 Hashing q-grams 4 Experimental results Thierry Lecroq Fast String Matching 2/33
3 Outline 1 Introduction 2 Best Matching Shift 3 Hashing q-grams 4 Experimental results Thierry Lecroq Fast String Matching 3/33
4 Exact String Matching Problem Find one or more generally all the occurrences of a pattern x of length m in a text y of length n. Both x and y are build on an alphabet Σ of size σ. Thierry Lecroq Fast String Matching 4/33
5 Exact String Matching Solutions Many!! See Most famous : Knuth Morris Pratt and Boyer Moore, 1977 Thierry Lecroq Fast String Matching 5/33
6 Exact String Matching Sliding window mechanism KMP : from left to right ( ) BM : from right to left ( ) Thierry Lecroq Fast String Matching 6/33
7 Boyer-Moore Typical situation y x b = a A suffix u of the pattern is found and a mismatch occurs between a character a in the pattern x and a character b in the text y. u = u Thierry Lecroq Fast String Matching 7/33
8 Matching shift y x b = a The matching shift consists in aligning the substring u = x[i + 1..m 1] = y[i + j + 1..j + m 1] with one of its reoccurrences in x. u = u Thierry Lecroq Fast String Matching 8/33
9 Three Types of Matching Shift (I) Weak Matching Shift y x x b = a c No condition on the character c preceding u, it is then possible that c = a. u = u = u shift Thierry Lecroq Fast String Matching 9/33
10 Three Types of Matching Shift (II) Strong Matching Shift y b u = = x a u = = x c u c must be different from the character a. shift Thierry Lecroq Fast String Matching 10/33
11 Three Types of Matching Shift (III) Best Matching Shift y c must be equal to b. x x b = a c u = u = u shift Thierry Lecroq Fast String Matching 11/33
12 Three Types of Matching Shift weak and strong matching shift only depend on x best matching shift depends on x and the alphabet Thierry Lecroq Fast String Matching 12/33
13 Outline 1 Introduction 2 Best Matching Shift 3 Hashing q-grams 4 Experimental results Thierry Lecroq Fast String Matching 13/33
14 Computation of the best matching shift For 0 i m 1 : suff [i] = length of the longest suffix of x ending at position i in x. x a u = = x c u bmatch[m 1 suff[i],c] i suff[i] Thierry Lecroq Fast String Matching 14/33
15 Computation of the best matching shift Scan the position of the table suff from left to right Another proof of linearity Thierry Lecroq Fast String Matching 15/33
16 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
17 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
18 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
19 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
20 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
21 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
22 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
23 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
24 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
25 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
26 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
27 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 16/33
28 Best Matching Shift Degenerate case y x b = a x u = u = v u does not reoccur in x v is the longest prefix of x matching u which is a suffix of x v is a border that can be detected when suff [i] = i + 1 shift Thierry Lecroq Fast String Matching 17/33
29 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 18/33
30 Computation of the best matching shift Example a c g t i x[i] c a t a c a t a a a t a suff [i] Thierry Lecroq Fast String Matching 18/33
31 Outline 1 Introduction 2 Best Matching Shift 3 Hashing q-grams 4 Experimental results Thierry Lecroq Fast String Matching 19/33
32 Hashing q-grams Compute a hash value in [0; 255] for every q-grams of the pattern x. Compute a shift for every hash value. Unroll the loops as much as possible. Thierry Lecroq Fast String Matching 20/33
33 Hashing q-grams Example i x[i] c a t a c a t a a a t a shift[i] 10 i [0; 255] Thierry Lecroq Fast String Matching 21/33
34 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(cat) = ((rank(c) 2 + rank(a)) 2 + rank(t) = 194 shift[194] = 10 shift[194] 9 Thierry Lecroq Fast String Matching 21/33
35 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(ata) = ((rank(a) 2 + rank(a)) 2 + rank(a) = 205 shift[205] = 10 shift[205] 8 Thierry Lecroq Fast String Matching 21/33
36 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(tac) = ((rank(t) 2 + rank(a)) 2 + rank(c) = 245 shift[245] = 10 shift[245] 7 Thierry Lecroq Fast String Matching 21/33
37 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(aca) = ((rank(a) 2 + rank(c)) 2 + rank(a) = 171 shift[171] = 10 shift[171] 6 Thierry Lecroq Fast String Matching 21/33
38 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(cat) = ((rank(c) 2 + rank(a)) 2 + rank(t) = 194 shift[194] = 9 shift[194] 5 Thierry Lecroq Fast String Matching 21/33
39 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(ata) = ((rank(a) 2 + rank(t)) 2 + rank(a) = 205 shift[205] = 8 shift[205] 4 Thierry Lecroq Fast String Matching 21/33
40 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(taa) = ((rank(t) 2 + rank(a)) 2 + rank(a) = 243 shift[243] = 10 shift[243] 3 Thierry Lecroq Fast String Matching 21/33
41 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(aaa) = ((rank(a) 2 + rank(a)) 2 + rank(a) = 167 shift[167] = 10 shift[167] 2 Thierry Lecroq Fast String Matching 21/33
42 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(aat) = ((rank(a) 2 + rank(a)) 2 + rank(t) = 186 shift[186] = 10 shift[186] 1 Thierry Lecroq Fast String Matching 21/33
43 Hashing q-grams Example i x[i] c a t a c a t a a a t a h(ata) = ((rank(a) 2 + rank(t)) 2 + rank(a) = 205 shift[205] = 4 = sh1 4 shift[205] 0 Thierry Lecroq Fast String Matching 21/33
44 Hashing q-grams Algorithm Newq(x, m, y, n) for q = 3 Preprocessing for i 0 to 255 do shift[i] m 2 for i 2 to m 2 do h ((x[i 2] 2 + x[i 1]) 2) + x[i] shift[h mod 256] m 1 i h ((x[m 3] 2 + x[m 2]) 2) + x[m 1] sh1 shift[h mod 256] shift[h mod 256] 0 Thierry Lecroq Fast String Matching 22/33
45 Hashing q-grams Algorithm Newq(x, m, y, n) for q = 3 Searching y[n..n + m 1] x Sentinel j m 1 while True do sh 1 while sh 0 do h ((y[j 2] 2 + y[j 1]) 2) + y[j] sh shift[h mod 256] j j + sh if j < n then if x = y[j m + 1..j] then Report(j m + 1) j j + sh1 else Return Thierry Lecroq Fast String Matching 23/33
46 Outline 1 Introduction 2 Best Matching Shift 3 Hashing q-grams 4 Experimental results Thierry Lecroq Fast String Matching 24/33
47 Experimental results Conditions Intel Pentium processor at 1300MHz Texts Linux Red Hat version gcc with the full optimization option -O3 clock function 100 patterns randomly chosen in the texts Binary alphabet, random (uniform distribution), 4Mb E.coli from Large Canterbury Corpus, 4.6Mb Alphabet of size 8, random (uniform distribution), 4Mb world192.txt from Large Canterbury Corpus, 4.3Mb Thierry Lecroq Fast String Matching 25/33
48 Experimental results Algorithms BM2fast Boyer Moore with best matching shift and fast loop NEWq for q [3; 8] TBM Tuned Boyer Moore (Hume & Sunday, 1991) SSABS (Sheik, Aggarwal, Poddar, Balakrishnan & Sekar, 2004) SBNDM2 (Holub & Durian, 2005) Thierry Lecroq Fast String Matching 26/33
49 Experimental results Binary alphabet Thierry Lecroq Fast String Matching 27/33
50 Experimental results E.coli from the Large Canterbury corpus Thierry Lecroq Fast String Matching 28/33
51 Experimental results Alphabet of size 8 Thierry Lecroq Fast String Matching 29/33
52 Experimental results Natural language Thierry Lecroq Fast String Matching 30/33
53 Conclusions Binary alphabet : NEW5-8 for m [9; 256] Alphabet of size 4 : NEW3-5 for m [7; 128] Alphabet of size 8 : NEW3-5 for m [13; 64] Natural language : BM2fast for m [7; 15] Thierry Lecroq Fast String Matching 31/33
54 References Coming soon... Best matching shift and many other interesting things Thierry Lecroq Fast String Matching 32/33
55 References M. Crochemore and T. Lecroq A fast implementation of the Boyer Moore string matching algorithm Submitted T. Lecroq Fast string matching algorithms Information Processing Letters Accepted Thierry Lecroq Fast String Matching 33/33
Fast exact string matching algorithms
Information Processing Letters 102 (2007) 229 235 www.elsevier.com/locate/ipl Fast exact string matching algorithms Thierry Lecroq LITIS, Faculté des Sciences et des Techniques, Université de Rouen, 76821
More informationA very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)
A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de
More informationExperiments on string matching in memory structures
Experiments on string matching in memory structures Thierry Lecroq LIR (Laboratoire d'informatique de Rouen) and ABISS (Atelier de Biologie Informatique Statistique et Socio-Linguistique), Universite de
More informationExperimental Results on String Matching Algorithms
SOFTWARE PRACTICE AND EXPERIENCE, VOL. 25(7), 727 765 (JULY 1995) Experimental Results on String Matching Algorithms thierry lecroq Laboratoire d Informatique de Rouen, Université de Rouen, Facultés des
More informationString Matching Algorithms
String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational
More informationA Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms
A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms Charalampos S. Kouzinopoulos and Konstantinos G. Margaritis Parallel and Distributed Processing Laboratory Department
More informationString Matching Algorithms
String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -
More informationA New String Matching Algorithm Based on Logical Indexing
The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department
More informationAn efficient matching algorithm for encoded DNA sequences and binary strings
An efficient matching algorithm for encoded DNA sequences and binary strings Simone Faro 1 and Thierry Lecroq 2 1 Dipartimento di Matematica e Informatica, Università di Catania, Italy 2 University of
More informationA Unifying Look at the Apostolico Giancarlo String-Matching Algorithm
A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm MAXIME CROCHEMORE, IGM (Institut Gaspard-Monge), Université de Marne-la-Vallée, 77454 Marne-la-Vallée CEDEX 2, France. E-mail: mac@univ-mlv.fr,
More informationPractical and Optimal String Matching
Practical and Optimal String Matching Kimmo Fredriksson Department of Computer Science, University of Joensuu, Finland Szymon Grabowski Technical University of Łódź, Computer Engineering Department SPIRE
More informationChapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input
More informationExact String Matching. The Knuth-Morris-Pratt Algorithm
Exact String Matching The Knuth-Morris-Pratt Algorithm Outline for Today The Exact Matching Problem A simple algorithm Motivation for better algorithms The Knuth-Morris-Pratt algorithm The Exact Matching
More informationApplied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017
Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of
More informationImproving Practical Exact String Matching
Improving Practical Exact String Matching Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We present improved variations of the BNDM algorithm for exact string matching. At each alignment
More informationEnhanced Two Sliding Windows Algorithm For Pattern Matching (ETSW) University of Jordan, Amman Jordan
Enhanced Two Sliding Windows Algorithm For Matching (ETSW) Mariam Itriq 1, Amjad Hudaib 2, Aseel Al-Anani 2, Rola Al-Khalid 2, Dima Suleiman 1 1. Department of Business Information Systems, King Abdullah
More informationCSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs
CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to
More informationInexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming)
Inexact Matching, Alignment See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Outline Yet more applications of generalized suffix trees, when combined with a least common ancestor
More informationKnuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011
Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given
More informationThe Exact Online String Matching Problem: A Review of the Most Recent Results
13 The Exact Online String Matching Problem: A Review of the Most Recent Results SIMONE FARO, Università di Catania THIERRY LECROQ, Université derouen This article addresses the online exact string matching
More informationIndexing and Searching
Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)
More informationString matching algorithms
String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A
More informationAlgorithms and Data Structures Lesson 3
Algorithms and Data Structures Lesson 3 Michael Schwarzkopf https://www.uni weimar.de/de/medien/professuren/medieninformatik/grafische datenverarbeitung Bauhaus University Weimar May 30, 2018 Overview...of
More informationText Algorithms (6EAP) Lecture 3: Exact pa;ern matching II
Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)
More informationMax-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms
Regular Paper Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms Mohammed Sahli 1,a) Tetsuo Shibuya 2 Received: September 8, 2011, Accepted: January 13, 2012 Abstract:
More informationEfficient String Matching Using Bit Parallelism
Efficient String Matching Using Bit Parallelism Kapil Kumar Soni, Rohit Vyas, Dr. Vivek Sharma TIT College, Bhopal, Madhya Pradesh, India Abstract: Bit parallelism is an inherent property of computer to
More informationarxiv: v1 [cs.ds] 3 Jul 2017
Speeding Up String Matching by Weak Factor Recognition Domenico Cantone, Simone Faro, and Arianna Pavone arxiv:1707.00469v1 [cs.ds] 3 Jul 2017 Università di Catania, Viale A. Doria 6, 95125 Catania, Italy
More informationComputing Patterns in Strings I. Specific, Generic, Intrinsic
Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems
More informationText Algorithms (6EAP) Lecture 3: Exact paaern matching II
Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND
More informationUniversity of Huddersfield Repository
University of Huddersfield Repository Klaib, Ahmad and Osborne, Hugh OE Matching for Searching Biological Sequences Original Citation Klaib, Ahmad and Osborne, Hugh (2009) OE Matching for Searching Biological
More informationAccelerating Boyer Moore Searches on Binary Texts
Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il
More informationApplication of String Matching in Auto Grading System
Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern
More informationA Practical Distributed String Matching Algorithm Architecture and Implementation
A Practical Distributed String Matching Algorithm Architecture and Implementation Bi Kun, Gu Nai-jie, Tu Kun, Liu Xiao-hu, and Liu Gang International Science Index, Computer and Information Engineering
More informationEnhanced Two Sliding Windows Algorithm For Pattern Matching (ETSW) University of Jordan, Amman Jordan.
Enhanced Two Sliding Windows Algorithm For Matching (ETSW) Mariam Itriq 1, Amjad Hudaib 2, Aseel Al-Anani 2, Rola Al-Khalid 2, Dima Suleiman 1 1. Department of Business Information Systems, King Abdullah
More informationStudy of Selected Shifting based String Matching Algorithms
Study of Selected Shifting based String Matching Algorithms G.L. Prajapati, PhD Dept. of Comp. Engg. IET-Devi Ahilya University, Indore Mohd. Sharique Dept. of Comp. Engg. IET-Devi Ahilya University, Indore
More informationSurvey of Exact String Matching Algorithm for Detecting Patterns in Protein Sequence
Advances in Computational Sciences and Technology ISSN 0973-6107 Volume 10, Number 8 (2017) pp. 2707-2720 Research India Publications http://www.ripublication.com Survey of Exact String Matching Algorithm
More informationString Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42
String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt
More informationFast Substring Matching
Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which
More informationString Searching Algorithm Implementation-Performance Study with Two Cluster Configuration
International Journal of Computer Science & Communication Vol. 1, No. 2, July-December 2010, pp. 271-275 String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration Prasad
More informationAlgorithms and Data Structures
Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction
More informationGiven a text file, or several text files, how do we search for a query string?
CS 840 Fall 2016 Text Search and Succinct Data Structures: Unit 4 Given a text file, or several text files, how do we search for a query string? Note the query/pattern is not of fixed length, unlike key
More informationCSCI S-Q Lecture #13 String Searching 8/3/98
CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching
More informationThis article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author s institution, sharing
More informationData Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation
Data Structures and Algorithms Course slides: String Matching, Algorithms growth evaluation String Matching Basic Idea: Given a pattern string P, of length M Given a text string, A, of length N Do all
More informationCSC152 Algorithm and Complexity. Lecture 7: String Match
CSC152 Algorithm and Complexity Lecture 7: String Match Outline Brute Force Algorithm Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm Boyer-Moore algorithm String Matching Aims to Detecting the occurrence
More informationTUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH UNROLLING Q-GRAMS AND HASH
Computer Modelling and New Technologies, 2013, Vol.17, No. 4, 58-65 Transport and Telecommunication Institute, Lomonosov 1, LV-1019, Riga, Latvia TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH
More informationA Multipattern Matching Algorithm Using Sampling and Bit Index
A Multipattern Matching Algorithm Using Sampling and Bit Index Jinhui Chen, Zhongfu Ye Department of Automation University of Science and Technology of China Hefei, P.R.China jeffcjh@mail.ustc.edu.cn,
More informationTuning BNDM with q-grams
Tuning BNDM with q-grams Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We develop bit-parallel algorithms for exact string matching. Our algorithms are variations of the BNDM and Shift-Or
More informationMultithreaded Sliding Window Approach to Improve Exact Pattern Matching Algorithms
Multithreaded Sliding Window Approach to Improve Exact Pattern Matching Algorithms Ala a Al-shdaifat Computer Information System Department The University of Jordan Amman, Jordan Bassam Hammo Computer
More informationString Matching in Scribblenauts Unlimited
String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia
More informationAn introduction to suffix trees and indexing
An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet
More informationClever Linear Time Algorithms. Maximum Subset String Searching
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationString matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي
String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred
More informationA Fast Order-Preserving Matching with q-neighborhood Filtration Using SIMD Instructions
A Fast Order-Preserving Matching with q-neighborhood Filtration Using SIMD Instructions Yohei Ueki, Kazuyuki Narisawa, and Ayumi Shinohara Graduate School of Information Sciences, Tohoku University, Japan
More informationEfficient validation and construction of border arrays
Efficient validation and construction of border arrays Jean-Pierre Duval Thierry Lecroq Arnaud Lefebvre LITIS, University of Rouen, France, {Jean-Pierre.Duval,Thierry.Lecroq,Arnaud.Lefebvre}@univ-rouen.fr
More informationFast Hybrid String Matching Algorithms
Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms
More informationString Patterns and Algorithms on Strings
String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms
More informationSORTING. Practical applications in computing require things to be in order. To consider: Runtime. Memory Space. Stability. In-place algorithms???
SORTING + STRING COMP 321 McGill University These slides are mainly compiled from the following resources. - Professor Jaehyun Park slides CS 97SI - Top-coder tutorials. - Programming Challenges book.
More informationClever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationFast Hybrid String Matching Algorithm based on the Quick-Skip and Tuned Boyer-Moore Algorithms
Fast Hybrid String Matching Algorithm based on the Quick-Skip and Tuned Boyer-Moore Algorithms Sinan Sameer Mahmood Al-Dabbagh Department of Parallel and Distributed Processing School of Computer Sciences
More informationarxiv: v2 [cs.ds] 15 Oct 2008
Efficient Pattern Matching on Binary Strings Simone Faro 1 and Thierry Lecroq 2 arxiv:0810.2390v2 [cs.ds] 15 Oct 2008 1 Dipartimento di Matematica e Informatica, Università di Catania, Italy 2 University
More informationBoyer-Moore. Ben Langmead. Department of Computer Science
Boyer-Moore Ben Langmead Department of Computer Science Please sign guestbook (www.langmead-lab.org/teaching-materials) to tell me briefly how you are using the slides. For original Keynote files, email
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationHigh Performance Pattern Matching Algorithm for Network Security
IJCSNS International Journal of Computer Science and Network Security, VOL.6 No., October 6 83 High Performance Pattern Matching Algorithm for Network Security Yang Wang and Hidetsune Kobayashi Graduate
More informationCMPUT 403: Strings. Zachary Friggstad. March 11, 2016
CMPUT 403: Strings Zachary Friggstad March 11, 2016 Outline Tries Suffix Arrays Knuth-Morris-Pratt Pattern Matching Tries Given a dictionary D of strings and a query string s, determine if s is in D. Using
More informationCS/COE 1501
CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ String Pattern Matching General idea Have a pattern string p of length m Have a text string t of length n Can we find an index i of string t such that each of
More informationA Survey of String Matching Algorithms
RESEARCH ARTICLE OPEN ACCESS A Survey of String Matching Algorithms Koloud Al-Khamaiseh*, Shadi ALShagarin** *(Department of Communication and Electronics and Computer Engineering, Tafila Technical University,
More informationData structures for string pattern matching: Suffix trees
Suffix trees Data structures for string pattern matching: Suffix trees Linear algorithms for exact string matching KMP Z-value algorithm What is suffix tree? A tree-like data structure for solving problems
More informationkvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx
COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?
More informationVolume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies
Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com
More informationProject Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio
Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade
More informationA Suffix Tree Construction Algorithm for DNA Sequences
A Suffix Tree Construction Algorithm for DNA Sequences Hongwei Huo School of Computer Science and Technol Xidian University Xi 'an 710071, China Vojislav Stojkovic Computer Science Department Morgan State
More informationPLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [Universiteit Twente] On: 21 May 2010 Access details: Access Details: [subscription number 907217948] Publisher Taylor & Francis Informa Ltd Registered in England and Wales
More informationApplication of the BWT Method to Solve the Exact String Matching Problem
Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com
More informationText Algorithms. Jaak Vilo 2016 fall. MTAT Text Algorithms
Text Algorithms Jaak Vilo 2016 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Topics Exact matching of one pattern(string) Exact matching of multiple patterns Suffix trie and tree indexes Applications Suffix
More informationFast Searching in Biological Sequences Using Multiple Hash Functions
Fast Searching in Biological Sequences Using Multiple Hash Functions Simone Faro Dip. di Matematica e Informatica, Università di Catania Viale A.Doria n.6, 95125 Catania, Italy Email: faro@dmi.unict.it
More informationCombined string searching algorithm based on knuth-morris- pratt and boyer-moore algorithms
IOP Conference Series: Materials Science and Engineering PAPER OPEN ACCESS Combined string searching algorithm based on knuth-morris- pratt and boyer-moore algorithms To cite this article: R Yu Tsarev
More informationSmall-Space 2D Compressed Dictionary Matching
Small-Space 2D Compressed Dictionary Matching Shoshana Neuburger 1 and Dina Sokol 2 1 Department of Computer Science, The Graduate Center of the City University of New York, New York, NY, 10016 shoshana@sci.brooklyn.cuny.edu
More informationAdvanced Algorithms: Project
Advanced Algorithms: Project (deadline: May 13th, 2016, 17:00) Alexandre Francisco and Luís Russo Last modified: February 26, 2016 This project considers two different problems described in part I and
More informationKeywords Pattern Matching Algorithms, Pattern Matching, DNA and Protein Sequences, comparison per character
Volume 3, Issue 5, May 2013 ISSN: 2277 128X International Journal of Advanced Research in Computer Science and Software Engineering Research Paper Available online at: www.ijarcsse.com Index Based Multiple
More informationSuffix-based text indices, construction algorithms, and applications.
Suffix-based text indices, construction algorithms, and applications. F. Franek Computing and Software McMaster University Hamilton, Ontario 2nd CanaDAM Conference Centre de recherches mathématiques in
More informationA NEW STRING MATCHING ALGORITHM
Intern. J. Computer Math., Vol. 80, No. 7, July 2003, pp. 825 834 A NEW STRING MATCHING ALGORITHM MUSTAQ AHMED a, *, M. KAYKOBAD a,y and REZAUL ALAM CHOWDHURY b,z a Department of Computer Science and Engineering,
More informationUniversity of Waterloo CS240R Fall 2017 Review Problems
University of Waterloo CS240R Fall 2017 Review Problems Reminder: Final on Tuesday, December 12 2017 Note: This is a sample of problems designed to help prepare for the final exam. These problems do not
More informationAlgorithms for Order- Preserving Matching
Departm en tofcom pu terscien ce Algorithms for Order- Preserving Matching TamannaChhabra 90 80 text pattern 70 60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10 11 DOCTORAL DISSERTATIONS Preface First, I
More informationMulti-Pattern String Matching with Very Large Pattern Sets
Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume
More informationStrings. Zachary Friggstad. Programming Club Meeting
Strings Zachary Friggstad Programming Club Meeting Outline Suffix Arrays Knuth-Morris-Pratt Pattern Matching Suffix Arrays (no code, see Comp. Prog. text) Sort all of the suffixes of a string lexicographically.
More informationImplementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature
Implementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature Yodi Pramudito (13511095) Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi
More informationString Processing Workshop
String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string
More information17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching.
17 dicembre 2003 Luca Bortolussi SUFFIX TREES From exact to approximate string matching. An introduction to string matching String matching is an important branch of algorithmica, and it has applications
More informationDocument Compression and Ciphering Using Pattern Matching Technique
Document Compression and Ciphering Using Pattern Matching Technique Sawood Alam Department of Computer Engineering, Jamia Millia Islamia, New Delhi, India, ibnesayeed@gmail.com Abstract This paper describes
More informationA string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers.
STRING ALGORITHMS : Introduction A string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers. There are many functions those can be applied on strings.
More informationGRASPm: an efficient algorithm for exact pattern-matching in genomic sequences
Int. J. Bioinformatics Research and Applications, Vol. GRASPm: an efficient algorithm for exact pattern-matching in genomic sequences Sérgio Deusdado* Centre for Mountain Research (CIMO), Polytechnic Institute
More informationCOMPARISON AND IMPROVEMENT OF STRIN MATCHING ALGORITHMS FOR JAPANESE TE. Author(s) YOON, Jeehee; TAKAGI, Toshihisa; US
Title COMPARISON AND IMPROVEMENT OF STRIN MATCHING ALGORITHMS FOR JAPANESE TE Author(s) YOON, Jeehee; TAKAGI, Toshihisa; US Citation 数理解析研究所講究録 (1986), 586: 18-34 Issue Date 1986-03 URL http://hdl.handle.net/2433/99393
More informationUniversity of Waterloo CS240R Winter 2018 Help Session Problems
University of Waterloo CS240R Winter 2018 Help Session Problems Reminder: Final on Monday, April 23 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems do
More informationAssignment 2 (programming): Problem Description
CS2210b Data Structures and Algorithms Due: Monday, February 14th Assignment 2 (programming): Problem Description 1 Overview The purpose of this assignment is for students to practice on hashing techniques
More informationLecture 7 February 26, 2010
6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some
More informationWAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA
WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA 2010 WAVE-FRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND
More informationString Algorithms. CITS3001 Algorithms, Agents and Artificial Intelligence. 2017, Semester 2. CLRS Chapter 32
String Algorithms CITS3001 Algorithms, Agents and Artificial Intelligence Tim French School of Computer Science and Software Engineering The University of Western Australia CLRS Chapter 32 2017, Semester
More informationParallel and Sequential Data Structures and Algorithms Lecture (Spring 2012) Lecture 25 Suffix Arrays
Lecture 25 Suffix Arrays Parallel and Sequential Data Structures and Algorithms, 15-210 (Spring 2012) Lectured by Kanat Tangwongsan April 17, 2012 Material in this lecture: The main theme of this lecture
More information