HP22.1 Roth Random Primer Kit A für die RAPD-PCR
|
|
|
- Thomasina Flowers
- 5 years ago
- Views:
Transcription
1 HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz Liefermenge (1,0 OD) Molarer Extinkt.koeffiz. Konz. bei Lösg. in 1 ml (pmol/µl) Lösungsmittelvolumen für Konzentration ( 2 C + 4 C-Regel) (G/C-Regel) 01 CAG GCC CTT C ,4 µg / 10,6 nmol ,6 106,2 µl 34,0 C 21,1 C 02 TGC CGA GCT G ,1 µg / 9,6 nmol ,6 96,0 µl 34,0 C 21,1 C 03 AGT CAG CCA C ,3 µg / 9,1 nmol ,1 91,2 µl 32,0 C 17,0 C 04 AAT CGG GCT G ,0 µg / 8,8 nmol ,8 88,3 µl 32,0 C 17,0 C 05 AGG GGT CTT G ,6 µg / 8,9 nmol ,9 89,4 µl 32,0 C 17,0 C 06 GGT CCC TGA C ,2 µg / 10,1 nmol ,1 100,8 µl 34,0 C 21,1 C 07 GAA ACG GGT G ,9 µg / 8,0 nmol ,0 80,3 µl 32,0 C 17,0 C 08 GTG ACG TAG G ,2 µg / 8,5 nmol ,5 84,6 µl 32,0 C 17,0 C 09 GGG TAA CGC C ,5 µg / 9,0 nmol ,0 90,4 µl 34,0 C 21,1 C 10 GTG ATC GCA G ,0 µg / 8,8 nmol ,8 88,3 µl 32,0 C 17,0 C 11 CAA TCG CCG T ,9 µg / 9,7 nmol ,7 96,9 µl 32,0 C 17,0 C 12 TCG GCG ATA G ,0 µg / 8,8 nmol ,8 88,3 µl 32,0 C 17,0 C 13 CAG CAC CCA C ,8 µg / 9,8 nmol ,8 98,0 µl 34,0 C 21,1 C 14 TCT GTG CTG G ,3 µg / 10,0 nmol ,0 99,6 µl 32,0 C 17,0 C 15 TTC CGA ACC C ,9 µg / 10,2 nmol ,2 101,8 µl 32,0 C 17,0 C 16 AGC CAG CGA A ,1 µg / 8,3 nmol ,3 82,6 µl 32,0 C 17,0 C 17 GAC CGC TTG T ,6 µg / 9,8 nmol ,8 98,2 µl 32,0 C 17,0 C 18 AGG TGA CCG T ,0 µg / 8,8 nmol ,8 88,3 µl 32,0 C 17,0 C 19 CAA ACG TCG G ,4 µg / 8,7 nmol ,7 87,3 µl 32,0 C 17,0 C 20 GTT GCG ATC C ,6 µg / 9,8 nmol ,8 98,2 µl 32,0 C 17,0 C 1
2 HP23.1 Roth Random Kit B für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz Liefermenge (1,0 OD) Molarer Extinkt.koeffiz. Konz. bei Lösg. in 1 ml (pmol/µl) Lösungsmittelvol. für Konzentration ( 2 C + 4 C-Regel) (G/C-Regel) 01 GTT TCG CTC C ,8 µg / 11,1 nmol ,1 110,6 µl 32,0 C 17,0 C 02 TGA TCC CTG G ,6 µg / 9,8 nmol ,8 98,2 µl 32,0 C 17,0 C 03 CAT CCC CCT G ,7 µg / 11,2 nmol ,2 112,1 µl 34,0 C 21,1 C 04 GGA CTG GAG T ,2 µg / 8,5 nmol ,5 84,6 µl 32,0 C 17,0 C 05 TGC GCC CTT C ,6 µg / 11,4 nmol ,4 113,9 µl 34,0 C 21,1 C 06 TGC TCT GCC C ,6 µg / 11,4 nmol ,4 113,9 µl 34,0 C 21,1 C 07 GGT GAC GCA G ,7 µg / 8,7 nmol ,7 86,5 µl 34,0 C 21,1 C 08 GTC CAC ACG G ,4 µg / 9,5 nmol ,5 94,7 µl 34,0 C 21,1 C 09 TGG GGG ACT C ,2 µg / 9,2 nmol ,2 91,6 µl 34,0 C 21,1 C 10 CTG CTG GGA C ,1 µg / 9,6 nmol ,6 96,0 µl 34,0 C 21,1 C 11 GTA GAC CCG T ,9 µg / 9,2 nmol ,2 92,4 µl 32,0 C 17,0 C 12 CCT TGA CGC A ,9 µg / 9,7 nmol ,7 96,9 µl 32,0 C 17,0 C 13 TTC CCC CGC T ,1 µg / 12,1 nmol ,1 120,8 µl 34,0 C 21,1 C 14 TCC GCT CTG G ,2 µg / 10,8 nmol ,8 107,8 µl 34,0 C 21,1 C 15 GGA GGG TGT T ,8 µg / 8,6 nmol ,6 85,6 µl 32,0 C 17,0 C 16 TTT GCC CGG A ,6 µg / 9,8 nmol ,8 98,2 µl 32,0 C 17,0 C 17 AGG GAA CGA G ,8 µg / 7,6 nmol ,6 76,3 µl 32,0 C 17,0 C 18 CCA CAG CAG T ,3 µg / 9,1 nmol ,1 91,2 µl 32,0 C 17,0 C 19 ACC CCC GAA G ,8 µg / 9,3 nmol ,3 93,5 µl 34,0 C 21,1 C 20 GGA CCC TTA C ,9 µg / 9,7 nmol ,7 96,9 µl 32,0 C 17,0 C 2
3 HP24.1 Roth Random Kit C für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz Liefermenge (1,0 OD) Molarer Extinkt.koeffiz. Konz. bei Lösg. in 1 ml (pmol/µl) Lösungsmittelvol. für Konzentration ( 2 C + 4 C-Regel) (G/C-Regel) 01 TTC GAG CCA G ,9 µg / 9,2 nmol ,2 92,4 µl 32,0 C 17,0 C 02 GTG AGG CGT C ,2 µg / 9,2 nmol ,2 91,6 µl 34,0 C 21,1 C 03 GGG GGT CTT T ,2 µg / 9,5 nmol ,5 94,9 µl 32,0 C 17,0 C 04 CCG CAT CTA C ,9 µg / 10,2 nmol ,2 101,8 µl 32,0 C 17,0 C 05 GAT GAC CGC C ,4 µg / 9,5 nmol ,5 94,7 µl 34,0 C 21,1 C 06 GAA CGG ACT C ,4 µg / 8,7 nmol ,7 87,3 µl 32,0 C 17,0 C 07 GTC CCG ACG A ,4 µg / 9,5 nmol ,5 94,7 µl 34,0 C 21,1 C 08 TGG ACC GGT G ,2 µg / 9,2 nmol ,2 91,6 µl 34,0 C 21,1 C 09 CTC ACC GTC C ,7 µg / 11,2 nmol ,2 112,1 µl 34,0 C 21,1 C 10 TGT CTG GGT G ,2 µg / 9,5 nmol ,5 94,9 µl 32,0 C 17,0 C 11 AAA GCT GCG G ,7 µg / 8,4 nmol ,4 83,6 µl 32,0 C 17,0 C 12 TGT CAT CCC C ,9 µg / 10,9 nmol ,9 108,9 µl 32,0 C 17,0 C 13 AAG CCT CGT C ,9 µg / 9,7 nmol ,7 96,9 µl 32,0 C 17,0 C 14 TGC GTG CTT G ,3 µg / 10,0 nmol ,0 99,6 µl 32,0 C 17,0 C 15 GAC GGA TCA G ,7 µg / 8,4 nmol ,4 83,6 µl 32,0 C 17,0 C 16 CAC ACT CCA G ,2 µg / 9,6 nmol ,6 95,6 µl 32,0 C 17,0 C 17 TTC CCC CCA G ,7 µg / 11,2 nmol ,2 112,1 µl 34,0 C 21,1 C 18 TGA GTG GGT G ,8 µg / 8,6 nmol ,6 85,6 µl 32,0 C 17,0 C 19 GTT GCC AGC C ,2 µg / 10,1 nmol ,1 100,8 µl 34,0 C 21,1 C 20 ACT TCG CCA C ,9 µg / 10,2 nmol ,2 101,8 µl 32,0 C 17,0 C 3
4 HP25.1 Roth Random Kit D für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz Liefermenge (1,0 OD) Molarer Extinkt.koeffiz. Konz. bei Lösg. in 1 ml (pmol/µl) Lösungsmittelvol. für Konzentration ( 2 C + 4 C-Regel) (G/C-Regel) 01 ACC GCG AAG G ,1 µg / 8,5 nmol ,5 85,5 µl 34,0 C 21,1 C 02 GGA CCC AAC C ,8 µg / 9,3 nmol ,3 93,5 µl 34,0 C 21,1 C 03 GTC GCC GTC A ,2 µg / 10,1 nmol ,1 100,8 µl 34,0 C 21,1 C 04 TCT GGT GAG G ,6 µg / 8,9 nmol ,9 89,4 µl 32,0 C 17,0 C 05 TGA GCG GAC A ,7 µg / 8,4 nmol ,4 83,6 µl 32,0 C 17,0 C 06 ACC TGA ACG G ,4 µg / 8,7 nmol ,7 87,3 µl 32,0 C 17,0 C 07 TTG GCA CGG G ,2 µg / 9,2 nmol ,2 91,6 µl 34,0 C 21,1 C 08 GTG TGC CCC A ,2 µg / 10,1 nmol ,1 100,8 µl 34,0 C 21,1 C 09 CTC TGG AGA C ,9 µg / 9,2 nmol ,2 92,4 µl 32,0 C 17,0 C 10 GGT CTA CAC C ,9 µg / 9,7 nmol ,7 96,9 µl 32,0 C 17,0 C 11 AGC GCC ATT G ,9 µg / 9,2 nmol ,2 92,4 µl 32,0 C 17,0 C 12 CAC CGT ATC C ,9 µg / 10,2 nmol ,2 101,8 µl 32,0 C 17,0 C 13 GGG GTG ACG A ,9 µg / 8,3 nmol ,3 82,9 µl 34,0 C 21,1 C 14 CTT CCC CAA G ,9 µg / 10,2 nmol ,2 101,8 µl 32,0 C 17,0 C 15 CAT CCG TGC T ,7 µg / 10,3 nmol ,3 103,3 µl 32,0 C 17,0 C 16 AGG GCG TAA G ,9 µg / 8,0 nmol ,0 80,3 µl 32,0 C 17,0 C 17 TTT CCC ACG G ,7 µg / 10,3 nmol ,3 103,3 µl 32,0 C 17,0 C 18 GAG AGC CAA C ,1 µg / 8,3 nmol ,3 82,6 µl 32,0 C 17,0 C 19 CTG GGG ACT T ,6 µg / 9,4 nmol ,4 93,6 µl 32,0 C 17,0 C 20 ACC CGG TCA C ,5 µg / 9,9 nmol ,9 99,4 µl 34,0 C 21,1 C 4
5 HP22.1 Roth Random Kit A for RAPD-PCR Kit contains 20 primers, aliquoted in 2 vials, each with 1.0 OD Please note: Information below referring to one vial each! Sequence Amount (1.0 OD) Molar extinct. coeffic. Conc. when solubilized in 1 ml (pmol/µl) Required solvent volume for conc. ( 2 C + 4 C rule) (G/C rule) 01 CAG GCC CTT C µg / 10.6 nmol µl 34.0 C 21.1 C 02 TGC CGA GCT G µg / 9.6 nmol µl 34.0 C 21.1 C 03 AGT CAG CCA C µg / 9.1 nmol µl 32.0 C 17.0 C 04 AAT CGG GCT G µg / 8.8 nmol µl 32.0 C 17.0 C 05 AGG GGT CTT G µg / 8.9 nmol µl 32.0 C 17.0 C 06 GGT CCC TGA C µg / 10.1 nmol µl 34.0 C 21.1 C 07 GAA ACG GGT G µg / 8.0 nmol µl 32.0 C 17.0 C 08 GTG ACG TAG G µg / 8.5 nmol µl 32.0 C 17.0 C 09 GGG TAA CGC C µg / 9.0 nmol µl 34.0 C 21.1 C 10 GTG ATC GCA G µg / 8.8 nmol µl 32.0 C 17.0 C 11 CAA TCG CCG T µg / 9.7 nmol µl 32.0 C 17.0 C 12 TCG GCG ATA G µg / 8.8 nmol µl 32.0 C 17.0 C 13 CAG CAC CCA C µg / 9.8 nmol µl 34.0 C 21.1 C 14 TCT GTG CTG G µg / 10.0 nmol µl 32.0 C 17.0 C 15 TTC CGA ACC C µg / 10.2 nmol µl 32.0 C 17.0 C 16 AGC CAG CGA A µg / 8.3 nmol µl 32.0 C 17.0 C 17 GAC CGC TTG T µg / 9.8 nmol µl 32.0 C 17.0 C 18 AGG TGA CCG T µg / 8.8 nmol µl 32.0 C 17.0 C 19 CAA ACG TCG G µg / 8.7 nmol µl 32.0 C 17.0 C 20 GTT GCG ATC C µg / 9.8 nmol µl 32.0 C 17.0 C 5
6 HP23.1 Roth Random Kit B for RAPD-PCR Kit contains 20 primers, aliquoted in 2 vials, each with 1.0 OD Please note: Information below referring to one vial each! Sequence Amount (1.0 OD) Molar extinct. coeffic. Conc., when solubilized in 1 ml (pmol/µl) Required solvent volume for conc. ( 2 C + 4 C rule) (G/C rule) 01 GTT TCG CTC C µg / 11.1 nmol µl 32.0 C 17.0 C 02 TGA TCC CTG G µg / 9.8 nmol µl 32.0 C 17.0 C 03 CAT CCC CCT G µg / 11.2 nmol µl 34.0 C 21.1 C 04 GGA CTG GAG T µg / 8.5 nmol µl 32.0 C 17.0 C 05 TGC GCC CTT C µg / 11.4 nmol µl 34.0 C 21.1 C 06 TGC TCT GCC C µg / 11.4 nmol µl 34.0 C 21.1 C 07 GGT GAC GCA G µg / 8.7 nmol µl 34.0 C 21.1 C 08 GTC CAC ACG G µg / 9.5 nmol µl 34.0 C 21.1 C 09 TGG GGG ACT C µg / 9.2 nmol µl 34.0 C 21.1 C 10 CTG CTG GGA C µg / 9.6 nmol µl 34.0 C 21.1 C 11 GTA GAC CCG T µg / 9.2 nmol µl 32.0 C 17.0 C 12 CCT TGA CGC A µg / 9.7 nmol µl 32.0 C 17.0 C 13 TTC CCC CGC T µg / 12.1 nmol µl 34.0 C 21.1 C 14 TCC GCT CTG G µg / 10.8 nmol µl 34.0 C 21.1 C 15 GGA GGG TGT T µg / 8.6 nmol µl 32.0 C 17.0 C 16 TTT GCC CGG A µg / 9.8 nmol µl 32.0 C 17.0 C 17 AGG GAA CGA G µg / 7.6 nmol µl 32.0 C 17.0 C 18 CCA CAG CAG T µg / 9.1 nmol µl 32.0 C 17.0 C 19 ACC CCC GAA G µg / 9.3 nmol µl 34.0 C 21.1 C 20 GGA CCC TTA C µg / 9.7 nmol µl 32.0 C 17.0 C 6
7 HP24.1 Roth Random Kit C for RAPD-PCR Kit contains 20 primers, aliquoted in 2 vials, each with 1.0 OD Please note: Information below referring to one vial each! Sequence Amount (1.0 OD) Molar extinct. coeffic. Conc., when solubilized in 1 ml (pmol/µl) Required solvent volume for conc. ( 2 C + 4 C rule) (G/C rule) 01 TTC GAG CCA G µg / 9.2 nmol µl 32.0 C 17.0 C 02 GTG AGG CGT C µg / 9.2 nmol µl 34.0 C 21.1 C 03 GGG GGT CTT T µg / 9.5 nmol µl 32.0 C 17.0 C 04 CCG CAT CTA C µg / 10.2 nmol µl 32.0 C 17.0 C 05 GAT GAC CGC C µg / 9.5 nmol µl 34.0 C 21.1 C 06 GAA CGG ACT C µg / 8.7 nmol µl 32.0 C 17.0 C 07 GTC CCG ACG A µg / 9.5 nmol µl 34.0 C 21.1 C 08 TGG ACC GGT G µg / 9.2 nmol µl 34.0 C 21.1 C 09 CTC ACC GTC C µg / 11.2 nmol µl 34.0 C 21.1 C 10 TGT CTG GGT G µg / 9.5 nmol µl 32.0 C 17.0 C 11 AAA GCT GCG G µg / 8.4 nmol µl 32.0 C 17.0 C 12 TGT CAT CCC C µg / 10.9 nmol µl 32.0 C 17.0 C 13 AAG CCT CGT C µg / 9.7 nmol µl 32.0 C 17.0 C 14 TGC GTG CTT G µg / 10.0 nmol µl 32.0 C 17.0 C 15 GAC GGA TCA G µg / 8.4 nmol µl 32.0 C 17.0 C 16 CAC ACT CCA G µg / 9.6 nmol µl 32.0 C 17.0 C 17 TTC CCC CCA G µg / 11.2 nmol µl 34.0 C 21.1 C 18 TGA GTG GGT G µg / 8.6 nmol µl 32.0 C 17.0 C 19 GTT GCC AGC C µg / 10.1 nmol µl 34.0 C 21.1 C 20 ACT TCG CCA C µg / 10.2 nmol µl 32.0 C 17.0 C 7
8 HP25.1 Roth Random Kit D for RAPD-PCR Kit contains 20 primers, aliquoted in 2 vials, each with 1.0 OD Please note: Information below referring to one vial each! Sequence Amount (1.0 OD) Molar extinct. coeffic. Conc., when solubilized in 1 ml (pmol/µl) Required solvent volume for conc. ( 2 C + 4 C rule) (G/C rule) 01 ACC GCG AAG G µg / 8.5 nmol µl 34.0 C 21.1 C 02 GGA CCC AAC C µg / 9.3 nmol µl 34.0 C 21.1 C 03 GTC GCC GTC A µg / 10.1 nmol µl 34.0 C 21.1 C 04 TCT GGT GAG G µg / 8.9 nmol µl 32.0 C 17.0 C 05 TGA GCG GAC A µg / 8.4 nmol µl 32.0 C 17.0 C 06 ACC TGA ACG G µg / 8.7 nmol µl 32.0 C 17.0 C 07 TTG GCA CGG G µg / 9.2 nmol µl 34.0 C 21.1 C 08 GTG TGC CCC A µg / 10.1 nmol µl 34.0 C 21.1 C 09 CTC TGG AGA C µg / 9.2 nmol µl 32.0 C 17.0 C 10 GGT CTA CAC C µg / 9.7 nmol µl 32.0 C 17.0 C 11 AGC GCC ATT G µg / 9.2 nmol µl 32.0 C 17.0 C 12 CAC CGT ATC C µg / 10.2 nmol µl 32.0 C 17.0 C 13 GGG GTG ACG A µg / 8.3 nmol µl 34.0 C 21.1 C 14 CTT CCC CAA G µg / 10.2 nmol µl 32.0 C 17.0 C 15 CAT CCG TGC T µg / 10.3 nmol µl 32.0 C 17.0 C 16 AGG GCG TAA G µg / 8.0 nmol µl 32.0 C 17.0 C 17 TTT CCC ACG G µg / 10.3 nmol µl 32.0 C 17.0 C 18 GAG AGC CAA C µg / 8.3 nmol µl 32.0 C 17.0 C 19 CTG GGG ACT T µg / 9.4 nmol µl 32.0 C 17.0 C 20 ACC CGG TCA C µg / 9.9 nmol µl 34.0 C 21.1 C Carl Roth GmbH + Co. KG Schoemperlenstraße Karlsruhe Postfach Karlsruhe Telefon: +49 (0) 721/ Telefax: +49 (0) 721/ info@carlroth.de Internet: 8
by the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.
Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator
Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner
Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications
6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3
6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}
Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds
Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,
Appendix A. Example code output. Chapter 1. Chapter 3
Appendix A Example code output This is a compilation of output from selected examples. Some of these examples requires exernal input from e.g. STDIN, for such examples the interaction with the program
Supplementary Table 1. Data collection and refinement statistics
Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (
Genome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department
http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:
SUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells
SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh
TCGR: A Novel DNA/RNA Visualization Technique
TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu
warm-up exercise Representing Data Digitally goals for today proteins example from nature
Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,
Machine Learning Classifiers
Machine Learning Classifiers Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision trees Naïve Bayes Perceptrons, Multi-layer Neural Networks
Digging into acceptor splice site prediction: an iterative feature selection approach
Digging into acceptor splice site prediction: an iterative feature selection approach Yvan Saeys, Sven Degroeve, and Yves Van de Peer Department of Plant Systems Biology, Ghent University, Flanders Interuniversity
LABORATORY STANDARD OPERATING PROCEDURE FOR PULSENET CODE: PNL28 MLVA OF SHIGA TOXIN-PRODUCING ESCHERICHIA COLI
1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Shiga toxin-producing Escherichia coli O157 (STEC O157) and Salmonella enterica serotypes Typhimurium and Enteritidis.
Supplementary Data. Image Processing Workflow Diagram A - Preprocessing. B - Hough Transform. C - Angle Histogram (Rose Plot)
Supplementary Data Image Processing Workflow Diagram A - Preprocessing B - Hough Transform C - Angle Histogram (Rose Plot) D - Determination of holes Description of Image Processing Workflow The key steps
Supplementary Materials:
Supplementary Materials: Amino acid codo n Numb er Table S1. Codon usage in all the protein coding genes. RSC U Proportion (%) Amino acid codo n Numb er RSC U Proportion (%) Phe UUU 861 1.31 5.71 Ser UCU
2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA
176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45
A relation between trinucleotide comma-free codes and trinucleotide circular codes
Theoretical Computer Science 401 (2008) 17 26 www.elsevier.com/locate/tcs A relation between trinucleotide comma-free codes and trinucleotide circular codes Christian J. Michel a,, Giuseppe Pirillo b,c,
Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame
Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Jean-Louis Lassez*, Ryan A. Rossi Computer Science Department, Coastal Carolina University jlassez@coastal.edu, raross@coastal.edu
Efficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside
Efficient Selection of Unique and Popular Oligos for Large EST Databases Stefano Lonardi University of California, Riverside joint work with Jie Zheng, Timothy Close, Tao Jiang University of California,
Degenerate Coding and Sequence Compacting
ESI The Erwin Schrödinger International Boltzmanngasse 9 Institute for Mathematical Physics A-1090 Wien, Austria Degenerate Coding and Sequence Compacting Maya Gorel Kirzhner V.M. Vienna, Preprint ESI
MLiB - Mandatory Project 2. Gene finding using HMMs
MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
Supporting Information
Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2015. Supporting Information for Small, DOI: 10.1002/smll.201501370 A Compact DNA Cube with Side Length 10 nm Max B. Scheible, Luvena
Structural analysis and haplotype diversity in swine LEP and MC4R genes
J. Anim. Breed. Genet. ISSN - OIGINAL ATICLE Structural analysis and haplotype diversity in swine LEP and MC genes M. D Andrea, F. Pilla, E. Giuffra, D. Waddington & A.L. Archibald University of Molise,
OFFICE OF RESEARCH AND SPONSORED PROGRAMS
OFFICE OF RESEARCH AND SPONSORED PROGRAMS June 9, 2016 Mr. Satoshi Harada Department of Innovation Research Japan Science and Technology Agency (JST) K s Gobancho, 7, Gobancho, Chiyoda-ku, Tokyo, 102-0076
Sequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes
Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity
Scalable Solutions for DNA Sequence Analysis
Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000
1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis.
1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis. 2. SCOPE: to provide the PulseNet participants with a single protocol for
de Bruijn graphs for sequencing data
de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:
3. The object system(s)
3. The object system(s) Thomas Lumley Ken Rice Universities of Washington and Auckland Seattle, June 2011 Generics and methods Many functions in R are generic. This means that the function itself (eg plot,
DNA Sequencing. Overview
BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles
CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly
CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, 2009 http://cs.brown.edu/courses/csci2950-c/ l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset
Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data
1/39 Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi ENS Cachan Brittany / IRISA (Genscale team) Advisor : Dominique Lavenier 2/39 INTRODUCTION, YEAR 2000
QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation
QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation Anurag Nagar Southern Methodist University Michael Hahsler Southern Methodist University
DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization
Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just
10/15/2009 Comp 590/Comp Fall
Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg
Assembly in the Clouds
Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools
10/8/13 Comp 555 Fall
10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear
Graph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics
Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics
Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments
de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January /73
1/73 de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January 2014 2/73 YOUR INSTRUCTOR IS.. - Postdoc at Penn State, USA - PhD at INRIA / ENS Cachan,
Problem statement. CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly. Spring Example.
CS267 Assignment 3: Problem statement 2 Parallelize Graph Algorithms for de Novo Genome Assembly k-mers are sequences of length k (alphabet is A/C/G/T). An extension is a simple symbol (A/C/G/T/F). The
Algorithms and Data Structures
Algorithms and Data Structures Sorting beyond Value Comparisons Marius Kloft Content of this Lecture Radix Exchange Sort Sorting bitstrings in linear time (almost) Bucket Sort Marius Kloft: Alg&DS, Summer
DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM
DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM Daniela Maria Cirillo San Raffaele Scientific Institute, Milan COI/CA OSR as signed MTA with Janssen and Otzuka as SRL and is involved
A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data
International Journal of Electrical and Computer Engineering (IJECE) Vol. 4, No. 1, Feburary 2014, pp. 93~100 ISSN: 2088-8708 93 A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving
Detecting Superbubbles in Assembly Graphs. Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)!
Detecting Superbubbles in Assembly Graphs Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)! de Bruijn Graph-based Assembly Reads (substrings of original DNA sequence) de Bruijn
WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches
WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches 4-3 DSAP: BLASTn Page p. 7-1 NCBI BLAST Home Page p. 7-1 NCBI BLASTN search page p. 7-2 Copy sequence from DSAP or wave form program p. 7-2 Choose a database
debgr: An Efficient and Near-Exact Representation of the Weighted de Bruijn Graph Prashant Pandey Stony Brook University, NY, USA
debgr: An Efficient and Near-Exact Representation of the Weighted de Bruijn Graph Prashant Pandey Stony Brook University, NY, USA De Bruijn graphs are ubiquitous [Pevzner et al. 2001, Zerbino and Birney,
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
Purpose of sequence assembly
Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery Amplicon sequencing But not for transcript
Supporting Information
Supprting Inrmatin Ultraspeciic Multiplexed Detectin Lw-Abundance Single-Nucletide Variants by Cmbining a Masking Tactic with Flurescent Nanparticle Cunting Xiajing Pei, Tiancheng Lai, Guangyu Ta, Hu Hng,
Algorithms for Bioinformatics
Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms
In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition
In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition D. Bošnački 1, T.E. Pronk 2, and E.P. de Vink 3, 1 Dept. of Biomedical Engineering, Eindhoven University of Technology 2 Swammerdam
DNA Fragment Assembly
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly Overlap
PERFORMANCE ANALYSIS OF DATAMINIG TECHNIQUE IN RBC, WBC and PLATELET CANCER DATASETS
PERFORMANCE ANALYSIS OF DATAMINIG TECHNIQUE IN RBC, WBC and PLATELET CANCER DATASETS Mayilvaganan M 1 and Hemalatha 2 1 Associate Professor, Department of Computer Science, PSG College of arts and science,
Sequence Assembly Required!
Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy
Supplemental Information
Supplemental Information Title: Generation of clonal zebrafish line by androgenesis without egg irradiation Jilun Hou a,, Takafumi Fujimoto b, *, Taiju Saito c, Etsuro Yamaha d, Katsutoshi Arai b 1 Supplemental
./pharo Pharo.image eval 3 + 4 ./pharo Pharo.image my_script.st BioSequence newdna: atcggtcggctta. BioSequence newambiguousdna: AAGTCAGTGTACTATTAGCATGCATGTGCAACACATTAGCTG. BioSequence newunambiguousdna:
How to Run NCBI BLAST on zcluster at GACRC
How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?
Computational Architecture of Cloud Environments Michael Schatz. April 1, 2010 NHGRI Cloud Computing Workshop
Computational Architecture of Cloud Environments Michael Schatz April 1, 2010 NHGRI Cloud Computing Workshop Cloud Architecture Computation Input Output Nebulous question: Cloud computing = Utility computing
Graph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 13 Lopresti Fall 2007 Lecture 13-1 - Outline Introduction to graph theory Eulerian & Hamiltonian Cycle
NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints
1 NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints Youxi Wu, Yao Tong, Xingquan Zhu, Senior, IEEE, and Xindong Wu, Fellow, IEEE Abstract Sequence pattern mining aims to discover frequent
Programming Applications. What is Computer Programming?
Programming Applications What is Computer Programming? An algorithm is a series of steps for solving a problem A programming language is a way to express our algorithm to a computer Programming is the
Read Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015
Mapping de Novo Assembly Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #2 WS 2014/2015 Today Genome assembly: the basics Hamiltonian and Eulerian
Eulerian Tours and Fleury s Algorithm
Eulerian Tours and Fleury s Algorithm CSE21 Winter 2017, Day 12 (B00), Day 8 (A00) February 8, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Vocabulary Path (or walk): describes a route from one vertex
Genome 373: Genome Assembly. Doug Fowler
Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-
Phylogenetics on CUDA (Parallel) Architectures Bradly Alicea
Descent w/modification Descent w/modification Descent w/modification Descent w/modification CPU Descent w/modification Descent w/modification Phylogenetics on CUDA (Parallel) Architectures Bradly Alicea
Global Alignment. Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004
1 Introduction Global Alignment Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004 The purpose of this report is to verify attendance
Working with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step
Mining more complex patterns: frequent subsequences and subgraphs. Department of Computers, Czech Technical University in Prague
Mining more complex patterns: frequent subsequences and subgraphs Jiří Kléma Department of Computers, Czech Technical University in Prague http://cw.felk.cvut.cz/wiki/courses/a4m33sad/start poutline Motivation
Working with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step
de novo assembly & k-mers
de novo assembly & k-mers Rayan Chikhi CNRS Workshop on Genomics - Cesky Krumlov January 2018 1 YOUR INSTRUCTOR IS.. - Junior CNRS bioinformatics researcher in Lille, France - Postdoc: Penn State, USA;
Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
Strings. Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas
Strings Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas Run a program by typing at a terminal prompt (which may be > or $ or something else depending on your computer;
Solutions Exercise Set 3 Author: Charmi Panchal
Solutions Exercise Set 3 Author: Charmi Panchal Problem 1: Suppose we have following fragments: f1 = ATCCTTAACCCC f2 = TTAACTCA f3 = TTAATACTCCC f4 = ATCTTTC f5 = CACTCCCACACA f6 = CACAATCCTTAACCC f7 =
DNA Fragment Assembly
SIGCSE 009 Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly
DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats
San Jose State University SJSU ScholarWorks Master's Projects Master's Theses and Graduate Research 2008 DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats Ching Li San Jose State University
Eulerian tours. Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck. April 20, 2016
Eulerian tours Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck http://cseweb.ucsd.edu/classes/sp16/cse21-bd/ April 20, 2016 Seven Bridges of Konigsberg Is there a path that crosses each
Algorithms for Bioinformatics
Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 582670 Algorithms for Bioinformatics Lecture 3: Graph Algorithms
Graphs and Puzzles. Eulerian and Hamiltonian Tours.
Graphs and Puzzles. Eulerian and Hamiltonian Tours. CSE21 Winter 2017, Day 11 (B00), Day 7 (A00) February 3, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Exam Announcements Seating Chart on Website Good
Hybrid Parallel Programming
Hybrid Parallel Programming for Massive Graph Analysis KameshMdd Madduri KMadduri@lbl.gov ComputationalResearch Division Lawrence Berkeley National Laboratory SIAM Annual Meeting 2010 July 12, 2010 Hybrid
7.36/7.91 recitation. DG Lectures 5 & 6 2/26/14
7.36/7.91 recitation DG Lectures 5 & 6 2/26/14 1 Announcements project specific aims due in a little more than a week (March 7) Pset #2 due March 13, start early! Today: library complexity BWT and read
The Beauty of the Symmetric Sierpinski Relatives
Bridges 2018 Conference Proceedings The Beauty of the Symmetric Sierpinski Relatives Tara Taylor Department of Mathematics, Statistics and Computer Science, St. Francis Xavier University, Antigonish, Nova
CSE 549: Genome Assembly De Bruijn Graph. All slides in this lecture not marked with * courtesy of Ben Langmead.
CSE 549: Genome Assembly De Bruijn Graph All slides in this lecture not marked with * courtesy of Ben Langmead. Real-world assembly methods OLC: Overlap-Layout-Consensus assembly DBG: De Bruijn graph assembly
GATB programming day
GATB programming day G.Rizk, R.Chikhi Genscale, Rennes 15/06/2016 G.Rizk, R.Chikhi (Genscale, Rennes) GATB workshop 15/06/2016 1 / 41 GATB INTRODUCTION NGS technologies produce terabytes of data Efficient
E cient Index Maintenance Under Dynamic Genome Modification
E cient Index Maintenance Under Dynamic Genome Modification Nitish Gupta úı,1 Komal Sanjeev ı,1, Tim Wall 2, Carl Kingsford 3, Rob Patro 1 1 Department of Computer Science, Stony Brook University, Stony
The Message Of 1 Peter Bible Speaks Today
THE MESSAGE OF 1 PETER BIBLE SPEAKS TODAY PDF - Are you looking for the message of 1 peter bible speaks today Books? Now, you will be happy that at this time the message of 1 peter bible speaks today PDF
Accelerating Genome Assembly with Power8
Accelerating enome Assembly with Power8 Seung-Jong Park, Ph.D. School of EECS, CCT, Louisiana State University Revolutionizing the Datacenter Join the Conversation #OpenPOWERSummit Agenda The enome Assembly
ngaio.)' Thif. as you ore doubtless aware U the
c G c2 VV VV $60 c V X G Y Y 4 4 2 G F cg V c / g q c c c g c c c g c c g c c c cg VY gc c //Y 0 G!«> ] gc g 25 c Y g) g! c cg c c X c c 5 Y g g F g F g F «g c 3 x «(c X c! c c c g F VG ) g < c c c c g
Towards a de novo short read assembler for large genomes using cloud computing
Towards a de novo short read assembler for large genomes using cloud computing Michael Schatz April 21, 2009 AMSC664 Advanced Scientific Computing Outline 1.! Genome assembly by analogy 2.! DNA sequencing
Genome 373: Intro to Python I. Doug Fowler
Genome 373: Intro to Python I Doug Fowler Outline Intro to Python I What is a program? Dealing with data Strings in Python Numbers in Python What is a program? What is a program? A series of instruc2ons,
Gene Finding & Review
Gene Finding & Review Michael Schatz Bioinformatics Lecture 4 Quantitative Biology 2010 Illumina DNA Sequencing http://www.youtube.com/watch?v=77r5p8ibwjk Pacific Biosciences http://www.pacificbiosciences.com/video_lg.html
Automated Alignment of RNA Sequences to Pseudoknotted Structures
From: ISMB-97 Proceedings. Copyright 1997, AAAI (www.aaai.org). All rights reserved. Automated Alignment of RNA Sequences to Pseudoknotted Structures Jack E. Tabaska and Gary D. Stormo Dept. of Molecular,
Canine Coronavirus Detection in Feces from Diarrhea and Healthy. Dogs by Nested2PCR
PCR 3 1, 133, 1,2 (1.,210095 ;2.,210012) Canine Coronavirus Detection in Feces from Diarrhea and Healthy Dogs by Nested2PCR WAN G Yu2yan 1, LU Cheng2ping 133, WEN Hai 1,2 (1. Key L ab of A nimal disease
Multiple Sequence Alignment. With thanks to Eric Stone and Steffen Heber, North Carolina State University
Multiple Sequence Alignment With thanks to Eric Stone and Steffen Heber, North Carolina State University Definition: Multiple sequence alignment Given a set of sequences, a multiple sequence alignment
Genome Sequencing & Assembly. Slides by Carl Kingsford
Genome Sequencing & Assembly Slides by Carl Kingsford Genome Sequencing ACCGTCCAATTGG...! TGGCAGGTTAACC... E.g. human: 3 billion bases split into 23 chromosomes Main tool of traditional sequencing: DNA
Cloud Computing and the DNA Data Race
Cloud Computing and the DNA Data Race Michael Schatz, Ph.D. June 16, 2010 Mayo Clinic Genomics Interest Group Outline 1.! Genome Assembly by Analogy 2.! DNA Sequencing and Genomics 3.! Sequence Analysis
I519 Introduction to Bioinformatics, Genome assembly. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics, 2014 Genome assembly Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Genome assembly problem Approaches Comparative assembly The string
Assignment 2. Summary. Some Important bash Instructions. CSci132 Practical UNIX and Programming Assignment 2, Fall Prof.
Assignment 2 Summary The purpose of this assignment is to give you some practice in bash scripting. When you write a bash script, you are really writing a program in the bash programming language. In class
Parallel de novo Assembly of Complex (Meta) Genomes via HipMer
Parallel de novo Assembly of Complex (Meta) Genomes via HipMer Aydın Buluç Computational Research Division, LBNL May 23, 2016 Invited Talk at HiCOMB 2016 Outline and Acknowledgments Joint work (alphabetical)
TL6 Ultra Micro-volume Spectrophotometer
TL6 Ultra Micro-volume Spectrophotometer TL6 is the latest Ultra Micro-volume Spectrophotometer of PERSEE ANALYTICS. It is a small portable instrument for fast analysis of nucleic acid and protein concentrations