15.4 Longest common subsequence
|
|
- Phillip Miller
- 6 years ago
- Views:
Transcription
1 15.4 Longest common subsequence Biological applications often need to compare the DNA of two (or more) different organisms A strand of DNA consists of a string of molecules called bases, where the possible bases are Adenine, Guanine, Cytosine, and Thymine We express a strand of DNA as a string over the alphabet {A,C,G,T} E.g., the DNA of two organisms may be ACCGGTCGAGTGCGCGGAAGCCGGCCGAA = GTCGTTCGGAATGCCGTTGCTCTGTAAA 353 By comparing two strands of DNA we determine how similar they are, as some measure of how closely related the two organisms are We can de ne similarity in many different ways E.g., we can say that two DNA strands are similar if one is a substring of the other Neither nor is a substring of the other Alternatively, we could say that two strands are similar if the number of changes needed to turn one into the other is small 354 1
2 Yet another way to measure the similarity of and is by nding a third strand in which the bases in appear in each of and these bases must appear in the same order, but not necessarily consecutively The longer the strand we can nd, the more similar and are In our example, the longest strand is ACCGGTCGAGTGCGCGGAAGCCGGCCGAA GTCGTTCGGAATGCCGTTGCTCTGTAAA = GTCGTCGGAAGCCGGCCGAA 355 Formalize this notion of similarity as the longestcommon-subsequence problem A subsequence is just the given sequence with zero or more elements left out Formally, given a sequence =,,, another sequence =,, is a subsequence of if there exists a strictly increasing sequence,, of indices of such that for all =1,2,,, we have For example, = is a subsequence of = with corresponding index sequence 2,3,5,
3 A sequence is a common subsequence of and if is a subsequence of both and For example, if = and =, the sequence common subsequence of both and It is not a longest common subsequence (LCS) of and The sequence is also common to both and and has length 4 This sequence is an LCS of and, as is ; and have no common subsequence of length 5 or greater is a 357 In longest-common-subsequence problem, we are given =,, and =,, and wish to nd a max-length common subsequence of and Step 1: Characterizing a longest common subsequence In a brute-force approach, we would enumerate all subsequences of and check each of them to see whether it is also a subsequence of, keeping track of the longest subsequence we nd Each subsequence of corresponds to a subset of the indices 1,2,, of Because has 2 subsequences, this approach requires exponential time, making it impractical for long sequences 358 3
4 The LCS problem has an optimal-substructure property, however, as the following theorem shows The natural classes of subproblems correspond to pairs of pre xes of the two input sequences Precisely, given a sequence =,,, we de ne the th pre x of, for = 0,1,,, as =,, For example, if =, then = and is the empty sequence 359 Theorem 15.1 (Optimal substructure of LCS) Let =,, and =,, be sequences, and let =,, be any LCS of and. 1. If, then and is an LCS of and. 2. If, then implies that is an LCS of and. 3. If, then implies that is an LCS of and
5 Proof (1) If, then we could append to to obtain a common subsequence of and of length +1, contradicting the supposition that is a LCS of and. Thus, we must have. Now, the pre x is a length- 1) common subsequence of and. We wish to show that it is an LCS. Suppose for the purpose of contradiction that there exists a common subsequence of and with length greater than 1. Then, appending to produces a common subsequence of and whose length is greater than, which is a contradiction. 361 (2) If, then is a common subsequence of and. If there were a common subsequence with length greater than, then would also be a common subsequence of and, contradicting the assumption that is an LCS of and. (3) The proof is symmetric to (2). Theorem 15.1 tells us that an LCS of two sequences contains within it an LCS of pre xes of the two sequences Thus, the LCS problem has an optimalsubstructure property 362 5
6 Step 2: A recursive solution We examine either one or two subproblems when nding an LCS of and If, we nd an LCS of and Appending yields an LCS of and If, then we (1) nd an LCS of and and (2) nd an LCS of and Whichever of these two LCSs is longer is an LCS of and These cases exhaust all possibilities, and we know that one of the optimal subproblem solutions must appear within an LCS of and 363 To nd an LCS of and, we may need to nd the LCSs of and and of and Each subproblem has the subsubproblem of nding an LCS of and Many other subproblems share subsubproblems As in the matrix-chain multiplication, recursive solution to the LCS problem involves a recurrence for the value of an optimal solution Let us de ne ] to be the length of an LCS of the sequences and If either =0or =0, one of the sequences has length 0, and so the LCS has length
7 The optimal substructure of the LCS problem gives 0 if = 0 or = 0 = 1, 1 +1 if > 0 and max 1, 1, ) if > 0 and Observe that a condition in the problem restricts which subproblems we may consider When, we consider nding an LCS of and Otherwise, we instead consider the two subproblems of nding an LCS of and and of and In the previous dynamic-programming algorithms for rod cutting and matrix-chain multiplication we ruled out no subproblems due to conditions in the problem 365 Step 3: Computing the length of an LCS Since the LCS problem has only distinct subproblems, we can use dynamic programming to compute the solutions bottom up LCS-LENGTH stores the ] values in [0..,0.. ], and it computes the entries in row-major order I.e., the procedure lls in the rst row of from left to right, then the second row, and so on The procedure also maintains the table [1..,1.. ] Intuitively, ] points to the table entry corresponding to the optimal subproblem solution chosen when computing contains the length of an LCS of and 366 7
8 LCS-LENGTH ) let [1..,1.. ]and [0.., 0.. be new tables 4. for to 5., for 0to 7. 0, 0 8. for to 9. for 1to 10. if 11. 1, elseif 1, 1] 14. 1, ] else 1] return and Running time: ) 367 The and tables computed by LCS-LENGTH on = and = 368 8
9 Step 4: Constructing an LCS The table returned by LCS-LENGTH enables us to quickly construct an LCS of and We simply begin at ] and trace through the table by following the arrows Whenever we encounter a in entry, it implies that is an element of the LCS that LCS-LENGTH found With this method, we encounter the elements of this LCS in reverse order A recursive procedure prints out an LCS of and in the proper, forward order 369 The square in row and column contains the value of and the appropriate arrow for the value of ] The entry 4 in [7,6] the lower right-hand corner of the table is the length of an LCS For >0, entry depends only on whether and the values in entries 1,, 1, and 1, 1, which are computed before To reconstruct the elements of an LCS, follow the ] arrows from the lower right-hand corner Each on the shaded sequence corresponds to an entry (highlighted) for which is a member of an LCS 370 9
10 Improving the code Each entry depends on only 3 other table entries: 1,, 1, and 1, 1 Given the value of, we can determine in (1) time which of these three values was used to compute, without inspecting table We can reconstruct an LCS in ) time The auxiliary space requirement for computing an LCS does not asymptotically decrease, since we need space for the table anyway 371 We can, however, reduce the asymptotic space requirements for LCS-LENGTH, since it needs only two rows of table at a time the row being computed and the previous row This improvement works if we need only the length of an LCS if we need to reconstruct the elements of an LCS, the smaller table does not keep enough information to retrace our steps in ) time
11 15.5 Optimal binary search trees We are designing a program to translate text Perform lookup operations by building a BST with words as keys and their equivalents as satellite data We can ensure an (lg ) search time per occurrence by using a RBT or any other balanced BST A frequently used word may appear far from the root while a rarely used word appears near the root We want frequent words to be placed nearer the root How do we organize a BST so as to minimize the number of nodes visited in all searches, given that we know how often each word occurs? 373 What we need is an optimal binary search tree Formally, given a sequence =,, distinct sorted keys ( ), we wish to build a BST from these keys For each key, we have a probability that a search will be for Some searches may be for values not in, so we also have +1 dummy keys,, representing values not in In particular, represents all values less than, represents all values greater than of
12 For = 1,2,, 1, the dummy key represents all values between and For each dummy key, we have a probability that a search will correspond to 375 Each key is an internal node, and each dummy key is a leaf Every search is either successful ( nds a key ) or unsuccessful ( nds a dummy key ), and so we have + =1 Because we have probabilities of searches for each key and each dummy key, we can determine the expected cost of a search in a given BST
13 Let us assume that the actual cost of a search equals the number of nodes examined, i.e., the depth of the node found by the search in +1 Then the expected cost of a search in, E search cost in = depth +1 + (depth +1) =1+ depth + depth, where depth denotes a node s depth in tree 377 Node Depth Probability Contribution Total
14 For a given set of probabilities, we wish to construct a BST whose expected search cost is smallest We call such a tree an optimal binary search tree An optimal BST for the probabilities given has expected cost 2.75 An optimal BST is not necessarily a tree whose overall height is smallest Nor can we necessarily construct an optimal BST by always putting the key with the greatest probability at the root The lowest expected cost of any BST with at the root is
15 Step 1: The structure of an optimal BST Consider any subtree of a BST It must contain keys in a contiguous range,,, for some In addition, a subtree that contains keys,, must also have as its leaves the dummy keys,, If an optimal BST has a subtree containing keys,,, then this subtree must be optimal as well for the subproblem with keys,, and dummy keys,, 381 Given keys,,, one of them, say, is the root of an optimal subtree containing these keys The left subtree of the root contains the keys,, (and dummy keys,, ) The right subtree contains the keys,, (and dummy keys,, ) As long as we examine all candidate roots, where, and determine all optimal BSTs containing,, and those containing,,, we are guaranteed to nd an optimal BST
16 Suppose that in a subtree with keys,,, we select as the root s left subtree contains the keys,, Interpret this sequence as containing no keys Subtrees, however, also contain dummy keys Adopt the convention that a subtree containing keys,, has no actual keys but does contain the single dummy key Symmetrically, if we select as the root, then s right subtree contains no actual keys, but it does contain the dummy key 383 Step 2: A recursive solution We pick our subproblem domain as nding an optimal BST containing the keys,,, where 1,, and 1 Let us de ne ] as the expected cost of searching an optimal BST containing the keys,, Ultimately, we wish to compute [1, ] The easy case occurs when 1 Then we have just the dummy key The expected search cost is 1 =
17 When >, we need to select a root from among,, and make an optimal BST with keys,, as its left subtree and an optimal BST with keys,, as its right subtree What happens to the expected search cost of a subtree when it becomes a subtree of a node? Depth of each node increases by 1 Expected search cost of this subtree increases by the sum of all the probabilities in it For a subtree with keys,,, let us denote this sum of probabilities as, = Thus, if is the root of an optimal subtree containing keys,,, we have ( +1, +1, ) Noting that , ) we rewrite , ) We choose the root that gives the lowest expected search cost: = if 1 min , ) if
18 The values give the expected search costs in optimal BSTs To help us keep track of the structure of optimal BSTs, we de ne root, for, to be the index for which is the root of an optimal BST containing keys,, Although we will see how to compute the values of root, we leave the construction of an optimal binary search tree from these values as en exercise 387 Step 3: Computing the expected search cost of an optimal BST We store values in a table ,0.. The rst index needs to run to +1because to have a subtree containing only the dummy key, we need to compute and store +1, The second index needs to start from 0 because to have a subtree containing only the dummy key, we need to compute and store 1,
19 We use only the entries for which 1 We also use a table root, for recording the root of the subtree containing keys,, This table uses only the entries We also store the [1.. +1,0.. ] values in a table For the base case, we compute 1 = For, we compute 1 + Thus, we can compute the ) values of, in (1) time each 389 OPTIMAL-BST(,, ) 1. let ,0.., [1.. +1,0.. ], root 1..,1.. be new tables 2. for = 1 to = 4. 1 = 5. for = 1 to 6. for = 1 to for to , ] 12. if ] root 15.return and root
20 391 The OPTIMAL-BST procedure takes ) time, just like MATRIX-CHAIN-ORDER Its running time is ), since its for loops are nested three deep and each loop index takes on at most values The loop indices in OPTIMAL-BST do not have exactly the same bounds as those in MATRIX- CHAIN-ORDER, but they are within 1in all directions Thus, like MATRIX-CHAIN-ORDER, the OPTIMAL- BST procedure takes ( ) time
15.4 Longest common subsequence
15.4 Longest common subsequence Biological applications often need to compare the DNA of two (or more) different organisms A strand of DNA consists of a string of molecules called bases, where the possible
More informationChapter 3 Dynamic programming
Chapter 3 Dynamic programming 1 Dynamic programming also solve a problem by combining the solutions to subproblems. But dynamic programming considers the situation that some subproblems will be called
More informationWe augment RBTs to support operations on dynamic sets of intervals A closed interval is an ordered pair of real
14.3 Interval trees We augment RBTs to support operations on dynamic sets of intervals A closed interval is an ordered pair of real numbers ], with Interval ]represents the set Open and half-open intervals
More informationWe assume uniform hashing (UH):
We assume uniform hashing (UH): the probe sequence of each key is equally likely to be any of the! permutations of 0,1,, 1 UH generalizes the notion of SUH that produces not just a single number, but a
More informationCS473-Algorithms I. Lecture 10. Dynamic Programming. Cevdet Aykanat - Bilkent University Computer Engineering Department
CS473-Algorithms I Lecture 1 Dynamic Programming 1 Introduction An algorithm design paradigm like divide-and-conquer Programming : A tabular method (not writing computer code) Divide-and-Conquer (DAC):
More informationIntroduction to Algorithms
Introduction to Algorithms Dynamic Programming Well known algorithm design techniques: Brute-Force (iterative) ti algorithms Divide-and-conquer algorithms Another strategy for designing algorithms is dynamic
More information9/24/ Hash functions
11.3 Hash functions A good hash function satis es (approximately) the assumption of SUH: each key is equally likely to hash to any of the slots, independently of the other keys We typically have no way
More informationEnsures that no such path is more than twice as long as any other, so that the tree is approximately balanced
13 Red-Black Trees A red-black tree (RBT) is a BST with one extra bit of storage per node: color, either RED or BLACK Constraining the node colors on any path from the root to a leaf Ensures that no such
More informationElements of Dynamic Programming. COSC 3101A - Design and Analysis of Algorithms 8. Discovering Optimal Substructure. Optimal Substructure - Examples
Elements of Dynamic Programming COSC 3A - Design and Analysis of Algorithms 8 Elements of DP Memoization Longest Common Subsequence Greedy Algorithms Many of these slides are taken from Monica Nicolescu,
More information16 Greedy Algorithms
16 Greedy Algorithms Optimization algorithms typically go through a sequence of steps, with a set of choices at each For many optimization problems, using dynamic programming to determine the best choices
More informationEfficient Sequential Algorithms, Comp309. Motivation. Longest Common Subsequence. Part 3. String Algorithms
Efficient Sequential Algorithms, Comp39 Part 3. String Algorithms University of Liverpool References: T. H. Cormen, C. E. Leiserson, R. L. Rivest Introduction to Algorithms, Second Edition. MIT Press (21).
More informationLongest Common Subsequence. Definitions
Longest Common Subsequence LCS is an interesting variation on the classical string matching problem: the task is that of finding the common portion of two strings (more precise definition in a couple of
More information10/24/ Rotations. 2. // s left subtree s right subtree 3. if // link s parent to elseif == else 11. // put x on s left
13.2 Rotations MAT-72006 AA+DS, Fall 2013 24-Oct-13 368 LEFT-ROTATE(, ) 1. // set 2. // s left subtree s right subtree 3. if 4. 5. // link s parent to 6. if == 7. 8. elseif == 9. 10. else 11. // put x
More informationII (Sorting and) Order Statistics
II (Sorting and) Order Statistics Heapsort Quicksort Sorting in Linear Time Medians and Order Statistics 8 Sorting in Linear Time The sorting algorithms introduced thus far are comparison sorts Any comparison
More informationComputer Sciences Department 1
1 Advanced Design and Analysis Techniques (15.1, 15.2, 15.3, 15.4 and 15.5) 3 Objectives Problem Formulation Examples The Basic Problem Principle of optimality Important techniques: dynamic programming
More information15.Dynamic Programming
15.Dynamic Programming Dynamic Programming is an algorithm design technique for optimization problems: often minimizing or maximizing. Like divide and conquer, DP solves problems by combining solutions
More informationDynamic Programming II
June 9, 214 DP: Longest common subsequence biologists often need to find out how similar are 2 DNA sequences DNA sequences are strings of bases: A, C, T and G how to define similarity? DP: Longest common
More informationV Advanced Data Structures
V Advanced Data Structures B-Trees Fibonacci Heaps 18 B-Trees B-trees are similar to RBTs, but they are better at minimizing disk I/O operations Many database systems use B-trees, or variants of them,
More informationV Advanced Data Structures
V Advanced Data Structures B-Trees Fibonacci Heaps 18 B-Trees B-trees are similar to RBTs, but they are better at minimizing disk I/O operations Many database systems use B-trees, or variants of them,
More informationAlgorithms Dr. Haim Levkowitz
91.503 Algorithms Dr. Haim Levkowitz Fall 2007 Lecture 4 Tuesday, 25 Sep 2007 Design Patterns for Optimization Problems Greedy Algorithms 1 Greedy Algorithms 2 What is Greedy Algorithm? Similar to dynamic
More informationAlgorithm Design Techniques part I
Algorithm Design Techniques part I Divide-and-Conquer. Dynamic Programming DSA - lecture 8 - T.U.Cluj-Napoca - M. Joldos 1 Some Algorithm Design Techniques Top-Down Algorithms: Divide-and-Conquer Bottom-Up
More information22 Elementary Graph Algorithms. There are two standard ways to represent a
VI Graph Algorithms Elementary Graph Algorithms Minimum Spanning Trees Single-Source Shortest Paths All-Pairs Shortest Paths 22 Elementary Graph Algorithms There are two standard ways to represent a graph
More informationDynamic Programming (Part #2)
Dynamic Programming (Part #) Introduction to Algorithms MIT Press (Chapter 5) Matrix-Chain Multiplication Problem: given a sequence A, A,, A n, compute the product: A A A n Matrix compatibility: C = A
More informationCS 380 ALGORITHM DESIGN AND ANALYSIS
CS 380 ALGORITHM DESIGN AND ANALYSIS Lecture 14: Dynamic Programming Text Reference: Chapter 15 Dynamic Programming We know that we can use the divide-and-conquer technique to obtain efficient algorithms
More informationSubsequence Definition. CS 461, Lecture 8. Today s Outline. Example. Assume given sequence X = x 1, x 2,..., x m. Jared Saia University of New Mexico
Subsequence Definition CS 461, Lecture 8 Jared Saia University of New Mexico Assume given sequence X = x 1, x 2,..., x m Let Z = z 1, z 2,..., z l Then Z is a subsequence of X if there exists a strictly
More informationThe divide-and-conquer paradigm involves three steps at each level of the recursion: Divide the problem into a number of subproblems.
2.3 Designing algorithms There are many ways to design algorithms. Insertion sort uses an incremental approach: having sorted the subarray A[1 j - 1], we insert the single element A[j] into its proper
More informationIntroduction to Algorithms
Introduction to Algorithms 6.046J/18.401J LECTURE 12 Dynamic programming Longest common subsequence Optimal substructure Overlapping subproblems Prof. Charles E. Leiserson Dynamic programming Design technique,
More informationLecture 8. Dynamic Programming
Lecture 8. Dynamic Programming T. H. Cormen, C. E. Leiserson and R. L. Rivest Introduction to Algorithms, 3rd Edition, MIT Press, 2009 Sungkyunkwan University Hyunseung Choo choo@skku.edu Copyright 2000-2018
More information22 Elementary Graph Algorithms. There are two standard ways to represent a
VI Graph Algorithms Elementary Graph Algorithms Minimum Spanning Trees Single-Source Shortest Paths All-Pairs Shortest Paths 22 Elementary Graph Algorithms There are two standard ways to represent a graph
More informationWorst-case running time for RANDOMIZED-SELECT
Worst-case running time for RANDOMIZED-SELECT is ), even to nd the minimum The algorithm has a linear expected running time, though, and because it is randomized, no particular input elicits the worst-case
More informationIN101: Algorithmic techniques Vladimir-Alexandru Paun ENSTA ParisTech
IN101: Algorithmic techniques Vladimir-Alexandru Paun ENSTA ParisTech License CC BY-NC-SA 2.0 http://creativecommons.org/licenses/by-nc-sa/2.0/fr/ Outline Previously on IN101 Python s anatomy Functions,
More information1. [1 pt] What is the solution to the recurrence T(n) = 2T(n-1) + 1, T(1) = 1
Asymptotics, Recurrence and Basic Algorithms 1. [1 pt] What is the solution to the recurrence T(n) = 2T(n-1) + 1, T(1) = 1 2. O(n) 2. [1 pt] What is the solution to the recurrence T(n) = T(n/2) + n, T(1)
More informationDynamic Programming. An Enumeration Approach. Matrix Chain-Products. Matrix Chain-Products (not in book)
Matrix Chain-Products (not in book) is a general algorithm design paradigm. Rather than give the general structure, let us first give a motivating example: Matrix Chain-Products Review: Matrix Multiplication.
More informationGreedy Algorithms. CLRS Chapters Introduction to greedy algorithms. Design of data-compression (Huffman) codes
Greedy Algorithms CLRS Chapters 16.1 16.3 Introduction to greedy algorithms Activity-selection problem Design of data-compression (Huffman) codes (Minimum spanning tree problem) (Shortest-path problem)
More information15-451/651: Design & Analysis of Algorithms January 26, 2015 Dynamic Programming I last changed: January 28, 2015
15-451/651: Design & Analysis of Algorithms January 26, 2015 Dynamic Programming I last changed: January 28, 2015 Dynamic Programming is a powerful technique that allows one to solve many different types
More informationS. Dasgupta, C.H. Papadimitriou, and U.V. Vazirani 165
S. Dasgupta, C.H. Papadimitriou, and U.V. Vazirani 165 5.22. You are given a graph G = (V, E) with positive edge weights, and a minimum spanning tree T = (V, E ) with respect to these weights; you may
More informationCS60020: Foundations of Algorithm Design and Machine Learning. Sourangshu Bhattacharya
CS60020: Foundations of Algorithm Design and Machine Learning Sourangshu Bhattacharya Dynamic programming Design technique, like divide-and-conquer. Example: Longest Common Subsequence (LCS) Given two
More informationDynamic Programming Algorithms
CSC 364S Notes University of Toronto, Fall 2003 Dynamic Programming Algorithms The setting is as follows. We wish to find a solution to a given problem which optimizes some quantity Q of interest; for
More informationFigure 4.1: The evolution of a rooted tree.
106 CHAPTER 4. INDUCTION, RECURSION AND RECURRENCES 4.6 Rooted Trees 4.6.1 The idea of a rooted tree We talked about how a tree diagram helps us visualize merge sort or other divide and conquer algorithms.
More informationTreaps. 1 Binary Search Trees (BSTs) CSE341T/CSE549T 11/05/2014. Lecture 19
CSE34T/CSE549T /05/04 Lecture 9 Treaps Binary Search Trees (BSTs) Search trees are tree-based data structures that can be used to store and search for items that satisfy a total order. There are many types
More informationScribe: Virginia Williams, Sam Kim (2016), Mary Wootters (2017) Date: May 22, 2017
CS6 Lecture 4 Greedy Algorithms Scribe: Virginia Williams, Sam Kim (26), Mary Wootters (27) Date: May 22, 27 Greedy Algorithms Suppose we want to solve a problem, and we re able to come up with some recursive
More informationExercises Optimal binary search trees root
5.5 Optimal binary search trees 403 e w 5 5 j 4.75 i j 4.00 i 3.75.00 3 3 0.70 0.80 3.5.0. 4 0.55 0.50 0.60 4 0.90 0.70 0.60 0.90 5 0.45 0.35 0. 0.50 5 0 0.45 0.40 0.5 0. 0.50 6 0 0. 0.5 0.5 0.0 0.35 6
More informationFriday Four Square! 4:15PM, Outside Gates
Binary Search Trees Friday Four Square! 4:15PM, Outside Gates Implementing Set On Monday and Wednesday, we saw how to implement the Map and Lexicon, respectively. Let's now turn our attention to the Set.
More information8 SortinginLinearTime
8 SortinginLinearTime We have now introduced several algorithms that can sort n numbers in O(n lg n) time. Merge sort and heapsort achieve this upper bound in the worst case; quicksort achieves it on average.
More informationDynamic Programming Group Exercises
Name: Name: Name: Dynamic Programming Group Exercises Adapted from material by Cole Frederick Please work the following problems in groups of 2 or 3. Use additional paper as needed, and staple the sheets
More information1 i n (p i + r n i ) (Note that by allowing i to be n, we handle the case where the rod is not cut at all.)
Dynamic programming is a problem solving method that is applicable to many different types of problems. I think it is best learned by example, so we will mostly do examples today. 1 Rod cutting Suppose
More informationFramework for Design of Dynamic Programming Algorithms
CSE 441T/541T Advanced Algorithms September 22, 2010 Framework for Design of Dynamic Programming Algorithms Dynamic programming algorithms for combinatorial optimization generalize the strategy we studied
More informationCSE 417 Dynamic Programming (pt 4) Sub-problems on Trees
CSE 417 Dynamic Programming (pt 4) Sub-problems on Trees Reminders > HW4 is due today > HW5 will be posted shortly Dynamic Programming Review > Apply the steps... 1. Describe solution in terms of solution
More informationA Revised Algorithm to find Longest Common Subsequence
A Revised Algorithm to find Longest Common Subsequence Deena Nath 1, Jitendra Kurmi 2, Deveki Nandan Shukla 3 1, 2, 3 Department of Computer Science, Babasaheb Bhimrao Ambedkar University Lucknow Abstract:
More informationHow many leaves on the decision tree? There are n! leaves, because every permutation appears at least once.
Chapter 8. Sorting in Linear Time Types of Sort Algorithms The only operation that may be used to gain order information about a sequence is comparison of pairs of elements. Quick Sort -- comparison-based
More informationToday: Matrix Subarray (Divide & Conquer) Intro to Dynamic Programming (Rod cutting) COSC 581, Algorithms January 21, 2014
Today: Matrix Subarray (Divide & Conquer) Intro to Dynamic Programming (Rod cutting) COSC 581, Algorithms January 21, 2014 Reading Assignments Today s class: Chapter 4.1, 15.1 Reading assignment for next
More informationDepartment of Computer Applications. MCA 312: Design and Analysis of Algorithms. [Part I : Medium Answer Type Questions] UNIT I
MCA 312: Design and Analysis of Algorithms [Part I : Medium Answer Type Questions] UNIT I 1) What is an Algorithm? What is the need to study Algorithms? 2) Define: a) Time Efficiency b) Space Efficiency
More informationCS 206 Introduction to Computer Science II
CS 206 Introduction to Computer Science II 04 / 26 / 2017 Instructor: Michael Eckmann Today s Topics Questions? Comments? Balanced Binary Search trees AVL trees Michael Eckmann - Skidmore College - CS
More informationDynamic Programming Algorithms
Based on the notes for the U of Toronto course CSC 364 Dynamic Programming Algorithms The setting is as follows. We wish to find a solution to a given problem which optimizes some quantity Q of interest;
More informationCS521 \ Notes for the Final Exam
CS521 \ Notes for final exam 1 Ariel Stolerman Asymptotic Notations: CS521 \ Notes for the Final Exam Notation Definition Limit Big-O ( ) Small-o ( ) Big- ( ) Small- ( ) Big- ( ) Notes: ( ) ( ) ( ) ( )
More informationCMPS 102 Solutions to Homework 7
CMPS 102 Solutions to Homework 7 Kuzmin, Cormen, Brown, lbrown@soe.ucsc.edu November 17, 2005 Problem 1. 15.4-1 p.355 LCS Determine an LCS of x = (1, 0, 0, 1, 0, 1, 0, 1) and y = (0, 1, 0, 1, 1, 0, 1,
More informationDefinition: A graph G = (V, E) is called a tree if G is connected and acyclic. The following theorem captures many important facts about trees.
Tree 1. Trees and their Properties. Spanning trees 3. Minimum Spanning Trees 4. Applications of Minimum Spanning Trees 5. Minimum Spanning Tree Algorithms 1.1 Properties of Trees: Definition: A graph G
More informationMID TERM MEGA FILE SOLVED BY VU HELPER Which one of the following statement is NOT correct.
MID TERM MEGA FILE SOLVED BY VU HELPER Which one of the following statement is NOT correct. In linked list the elements are necessarily to be contiguous In linked list the elements may locate at far positions
More informationCS473-Algorithms I. Lecture 11. Greedy Algorithms. Cevdet Aykanat - Bilkent University Computer Engineering Department
CS473-Algorithms I Lecture 11 Greedy Algorithms 1 Activity Selection Problem Input: a set S {1, 2,, n} of n activities s i =Start time of activity i, f i = Finish time of activity i Activity i takes place
More informationIII Data Structures. Dynamic sets
III Data Structures Elementary Data Structures Hash Tables Binary Search Trees Red-Black Trees Dynamic sets Sets are fundamental to computer science Algorithms may require several different types of operations
More informationComparison Based Sorting Algorithms. Algorithms and Data Structures: Lower Bounds for Sorting. Comparison Based Sorting Algorithms
Comparison Based Sorting Algorithms Algorithms and Data Structures: Lower Bounds for Sorting Definition 1 A sorting algorithm is comparison based if comparisons A[i] < A[j], A[i] A[j], A[i] = A[j], A[i]
More informationSo far... Finished looking at lower bounds and linear sorts.
So far... Finished looking at lower bounds and linear sorts. Next: Memoization -- Optimization problems - Dynamic programming A scheduling problem Matrix multiplication optimization Longest Common Subsequence
More information/463 Algorithms - Fall 2013 Solution to Assignment 3
600.363/463 Algorithms - Fall 2013 Solution to Assignment 3 (120 points) I (30 points) (Hint: This problem is similar to parenthesization in matrix-chain multiplication, except the special treatment on
More informationParallel and Sequential Data Structures and Algorithms Lecture (Spring 2012) Lecture 16 Treaps; Augmented BSTs
Lecture 16 Treaps; Augmented BSTs Parallel and Sequential Data Structures and Algorithms, 15-210 (Spring 2012) Lectured by Margaret Reid-Miller 8 March 2012 Today: - More on Treaps - Ordered Sets and Tables
More informationDecreasing a key FIB-HEAP-DECREASE-KEY(,, ) 3.. NIL. 2. error new key is greater than current key 6. CASCADING-CUT(, )
Decreasing a key FIB-HEAP-DECREASE-KEY(,, ) 1. if >. 2. error new key is greater than current key 3.. 4.. 5. if NIL and.
More informationAlgorithms and Data Structures: Lower Bounds for Sorting. ADS: lect 7 slide 1
Algorithms and Data Structures: Lower Bounds for Sorting ADS: lect 7 slide 1 ADS: lect 7 slide 2 Comparison Based Sorting Algorithms Definition 1 A sorting algorithm is comparison based if comparisons
More information18.3 Deleting a key from a B-tree
18.3 Deleting a key from a B-tree B-TREE-DELETE deletes the key from the subtree rooted at We design it to guarantee that whenever it calls itself recursively on a node, the number of keys in is at least
More informationAlgorithm classification
Types of Algorithms Algorithm classification Algorithms that use a similar problem-solving approach can be grouped together We ll talk about a classification scheme for algorithms This classification scheme
More informationFinal Exam in Algorithms and Data Structures 1 (1DL210)
Final Exam in Algorithms and Data Structures 1 (1DL210) Department of Information Technology Uppsala University February 0th, 2012 Lecturers: Parosh Aziz Abdulla, Jonathan Cederberg and Jari Stenman Location:
More informationCPE702 Algorithm Analysis and Design Week 7 Algorithm Design Patterns
CPE702 Algorithm Analysis and Design Week 7 Algorithm Design Patterns Pruet Boonma pruet@eng.cmu.ac.th Department of Computer Engineering Faculty of Engineering, Chiang Mai University Based on Slides by
More informationMulti-Way Search Trees
Multi-Way Search Trees Manolis Koubarakis 1 Multi-Way Search Trees Multi-way trees are trees such that each internal node can have many children. Let us assume that the entries we store in a search tree
More informationProblem Set 6 Solutions
Introduction to Algorithms November 15, 2002 Massachusetts Institute of Technology 6.046J/18.410J Professors Erik Demaine and Shafi oldwasser Handout 22 Problem Set 6 Solutions (Exercises were not to be
More informationECE608 - Chapter 8 answers
¼ À ÈÌ Ê ÈÊÇ Ä ÅË ½µ º½¹ ¾µ º¾¹ µ º ¹½ µ º ¹ µ º ¹ µ º ¹¾ µ ¹ µ ¹ ½ ECE608 - Chapter 8 answers (1) CLR 8.1-3 If the sort runs in linear time for m input permutations, then the height h of those paths of
More informationModule 2: Classical Algorithm Design Techniques
Module 2: Classical Algorithm Design Techniques Dr. Natarajan Meghanathan Associate Professor of Computer Science Jackson State University Jackson, MS 39217 E-mail: natarajan.meghanathan@jsums.edu Module
More informationLongest Common Subsequence, Knapsack, Independent Set Scribe: Wilbur Yang (2016), Mary Wootters (2017) Date: November 6, 2017
CS161 Lecture 13 Longest Common Subsequence, Knapsack, Independent Set Scribe: Wilbur Yang (2016), Mary Wootters (2017) Date: November 6, 2017 1 Overview Last lecture, we talked about dynamic programming
More informationCS 206 Introduction to Computer Science II
CS 206 Introduction to Computer Science II 04 / 25 / 2018 Instructor: Michael Eckmann Today s Topics Questions? Comments? Balanced Binary Search trees AVL trees / Compression Uses binary trees Balanced
More informationUnit 4: Dynamic Programming
Unit 4: Dynamic Programming Course contents: Assembly-line scheduling Matrix-chain multiplication Longest common subsequence Optimal binary search trees Applications: Cell flipping, rod cutting, optimal
More informationAnalysis of Algorithms
Algorithm An algorithm is a procedure or formula for solving a problem, based on conducting a sequence of specified actions. A computer program can be viewed as an elaborate algorithm. In mathematics and
More informationCMPS 2200 Fall Dynamic Programming. Carola Wenk. Slides courtesy of Charles Leiserson with changes and additions by Carola Wenk
CMPS 00 Fall 04 Dynamic Programming Carola Wenk Slides courtesy of Charles Leiserson with changes and additions by Carola Wenk 9/30/4 CMPS 00 Intro. to Algorithms Dynamic programming Algorithm design technique
More information1. Draw the state graphs for the finite automata which accept sets of strings composed of zeros and ones which:
P R O B L E M S Finite Autom ata. Draw the state graphs for the finite automata which accept sets of strings composed of zeros and ones which: a) Are a multiple of three in length. b) End with the string
More informationDesign and Analysis of Algorithms Lecture- 9: Binary Search Trees
Design and Analysis of Algorithms Lecture- 9: Binary Search Trees Dr. Chung- Wen Albert Tsao 1 Binary Search Trees Data structures that can support dynamic set operations. Search, Minimum, Maximum, Predecessor,
More informationCSC 505, Spring 2005 Week 6 Lectures page 1 of 9
CSC 505, Spring 2005 Week 6 Lectures page 1 of 9 Objectives: learn general strategies for problems about order statistics learn how to find the median (or k-th largest) in linear average-case number of
More informationOptimum Alphabetic Binary Trees T. C. Hu and J. D. Morgenthaler Department of Computer Science and Engineering, School of Engineering, University of C
Optimum Alphabetic Binary Trees T. C. Hu and J. D. Morgenthaler Department of Computer Science and Engineering, School of Engineering, University of California, San Diego CA 92093{0114, USA Abstract. We
More informationRecursive-Fib(n) if n=1 or n=2 then return 1 else return Recursive-Fib(n-1)+Recursive-Fib(n-2)
Dynamic Programming Any recursive formula can be directly translated into recursive algorithms. However, sometimes the compiler will not implement the recursive algorithm very efficiently. When this is
More informationData Structures and Algorithms Week 8
Data Structures and Algorithms Week 8 Dynamic programming Fibonacci numbers Optimization problems Matrix multiplication optimization Principles of dynamic programming Longest Common Subsequence Algorithm
More informationLecture 5: Sorting Part A
Lecture 5: Sorting Part A Heapsort Running time O(n lg n), like merge sort Sorts in place (as insertion sort), only constant number of array elements are stored outside the input array at any time Combines
More informationAlgorithms: COMP3121/3821/9101/9801
NEW SOUTH WALES Algorithms: COMP3121/3821/9101/9801 Aleks Ignjatović School of Computer Science and Engineering University of New South Wales TOPIC 5: DYNAMIC PROGRAMMING COMP3121/3821/9101/9801 1 / 38
More informationUC Berkeley CS 170: Efficient Algorithms and Intractable Problems Handout 15 Lecturer: Michael Jordan October 26, Notes 15 for CS 170
UC Berkeley CS 170: Efficient Algorithms and Intractable Problems Handout 15 Lecturer: Michael Jordan October 26, 2005 Notes 15 for CS 170 1 Introduction to Dynamic Programming Consider the following algorithm
More informationAlgorithms IV. Dynamic Programming. Guoqiang Li. School of Software, Shanghai Jiao Tong University
Algorithms IV Dynamic Programming Guoqiang Li School of Software, Shanghai Jiao Tong University Dynamic Programming Shortest Paths in Dags, Revisited Shortest Paths in Dags, Revisited The special distinguishing
More informationMergeSort. Algorithm : Design & Analysis [5]
MergeSort Algorithm : Design & Analysis [5] In the last class Insertion sort Analysis of insertion sorting algorithm Lower bound of local comparison based sorting algorithm General pattern of divide-and-conquer
More informationThese are not polished as solutions, but ought to give a correct idea of solutions that work. Note that most problems have multiple good solutions.
CSE 591 HW Sketch Sample Solutions These are not polished as solutions, but ought to give a correct idea of solutions that work. Note that most problems have multiple good solutions. Problem 1 (a) Any
More informationDynamic Programming. Lecture Overview Introduction
Lecture 12 Dynamic Programming 12.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationLecture 3 February 9, 2010
6.851: Advanced Data Structures Spring 2010 Dr. André Schulz Lecture 3 February 9, 2010 Scribe: Jacob Steinhardt and Greg Brockman 1 Overview In the last lecture we continued to study binary search trees
More informationSolutions. Suppose we insert all elements of U into the table, and let n(b) be the number of elements of U that hash to bucket b. Then.
Assignment 3 1. Exercise [11.2-3 on p. 229] Modify hashing by chaining (i.e., bucketvector with BucketType = List) so that BucketType = OrderedList. How is the runtime of search, insert, and remove affected?
More informationOutline. Definition. 2 Height-Balance. 3 Searches. 4 Rotations. 5 Insertion. 6 Deletions. 7 Reference. 1 Every node is either red or black.
Outline 1 Definition Computer Science 331 Red-Black rees Mike Jacobson Department of Computer Science University of Calgary Lectures #20-22 2 Height-Balance 3 Searches 4 Rotations 5 s: Main Case 6 Partial
More informationDynamic Access Binary Search Trees
Dynamic Access Binary Search Trees 1 * are self-adjusting binary search trees in which the shape of the tree is changed based upon the accesses performed upon the elements. When an element of a splay tree
More informationAn undirected graph is a tree if and only of there is a unique simple path between any 2 of its vertices.
Trees Trees form the most widely used subclasses of graphs. In CS, we make extensive use of trees. Trees are useful in organizing and relating data in databases, file systems and other applications. Formal
More informationAnalysis of Algorithms - Greedy algorithms -
Analysis of Algorithms - Greedy algorithms - Andreas Ermedahl MRTC (Mälardalens Real-Time Reseach Center) andreas.ermedahl@mdh.se Autumn 2003 Greedy Algorithms Another paradigm for designing algorithms
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationComputer Science 236 Fall Nov. 11, 2010
Computer Science 26 Fall Nov 11, 2010 St George Campus University of Toronto Assignment Due Date: 2nd December, 2010 1 (10 marks) Assume that you are given a file of arbitrary length that contains student
More information