Type Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables
|
|
- Clement Francis
- 6 years ago
- Views:
Transcription
1 Type Cheking Rodmp (Where re we?) Lst leture Contet-sensitie nlysis Motition Attriute grmmrs Ad ho Synt-direted trnsltion This leture Type heking Type systems Using synt direted trnsltion Symol tles Leil soping Implementtion Stk Threded stk 2 1
2 Types Type: A set of lues nd meningful opertions on them Types proide semnti snity heks (onsisteny heks) nd determine effiient implementtions for dt ojets Types help identify errors, if n opertor is pplied to n inomptile opernd dereferening of non-pointer dding funtion to something inorret numer of prmeters to proedure whih opertion to use for oerloded nmes nd opertors, or wht type oerion to use (e.g.: ) identifition of polymorphi funtions 3 Type Systems Type system: Eh lnguge onstrut (opertor, epression, sttement, ) is ssoited with type epression. The type system is olletion of rules for ssigning type epressions to these onstruts. Type epressions for si types integer, hr, rel, oolen, typeerror onstruted types // T is type epression rry(lu, T) // rry of T pointer(t) // pointer to T T1 X T2 // tuple of T1, T2 T1 T2 // funtion w/ rg T1 returning T2 4 2
3 Type System Properties Progress Gien epression e, either e is lue with some type T e -> e (e n e eluted to produe epression e ) I.e., preent epressions suh s (2 3) tht nnot e eluted Presertion Gien epression e with type T If e -> e then e must lso he type T I.e., preents type of epression e from hnging t run time Soundness If type system supports progress & presertion, then Gien epression e, e ->* (for some lue ) or e dierges I.e., well-typed progrms don t go wrong 5 Type Cheker A type heker implements type system. It omputes or onstruts type epressions for eh lnguge onstrut Stti type heking Detets type errors t ompile time No run time oerhed Not lwys possile (e.g., A[i]) Dynmi type heking Performed t run time More fleile, llows prototyping Run-time oerhed to mintin & hek tgs 6 3
4 Type Inferene (for Epressions) Speifies the type of n epression Emple If opernds of ddition re of type integer, result is of type integer Result of unry & opertor is pointer to type of opernd Denottionl semntis of type inferene rule E e 1 : integer E e 2 : integer E (e 1 + e 2 ): integer where E is type enironment tht mps onstnts nd riles to their type epressions. Question How to speify rules tht llow type oerion (type widening) from integers to rels in rithmeti epressions? or Type Inferene (in Generl) Gol Gien epression with no type nnottions, reonstrut lid type for the epression, or determine there is no lid typing Approh Use type riles for unknown types Generte equlity onstrints mong types nd type riles Sole onstrints to determine lid typing (unifition) My require generl Constrint Logi Progrmming (CLP) 8 4
5 Type Equilene Struturl - type equilene: type nmes re epnded Nme - type equilene: type nmes re not epnded Emple: type A is rry(1..10) of integer; type B is rry(1..10) of integer; : A; : B;, d: rry(1..10) of integer; e: rry(1..10) of integer; Answer: struturl equilene: nme equilene: (,,, d, e) (), (), (, d, e) 9 Synt Direted Trnsltion Sheme (in CUP) Reisit our type inferene rule for +. ep ::= ep:e1 PLUS ep:e2 {: if (e1 == sym.int && e2 == sym.int ) RESULT = sym.int ; else { RESULT = typeerror; System.out.println( Error: illegl opernd types ); : The definition of type epression s J types (stti finl int fields in lss sym) should e done in my.up. The ssignment of type epression J types to terminls nd nonterminls of the grmmr is done in my.up. 10 5
6 Synt Direted Trnsltion Sheme (in Y) Reisit our type inferene rule for +. ep : ep + ep { if ($1 == integer && $3 == integer) $$ = integer; else { $$ = typeerror; printf( Error: illegl opernd types\n ); The definition of type epression s C types (struts) should e done in ttr.h. ttr. my ontin helper funtions. The ssignment of type epression C types to terminls nd nonterminls of the grmmr is done in prse.y. 11 Type Cheker Emple 12 6
7 Type Cheker Emple (ont.) Hndling delrtions 13 Type Cheker Emple (ont.) Hndling epressions 14 7
8 Type Cheker Emple (ont.) Hndling sttements 15 Type Cheker Emple (ont.) Hndling funtions 16 8
9 Symol Tles Symol tle Compile-time strutures for resoling referenes to nmes Will look t run-time strutures lter Cn lso ssoite ttriutes with nme Attriutes possily ssoited with nme Type Delring proedure Leil leel If rry, numer nd size of dimensions If funtion, numer nd type of prmeters 17 Leilly-soped Symol Tles 5.7 in EC The prolem The ompiler needs distint reord for eh delrtion Nested leil sopes dmit duplite delrtions The interfe insert(nme, leel ) retes reord for nme t leel lookup(nme, leel ) returns pointer or inde delete(leel ) remoes ll nmes delred t leel Mny implementtion shemes he een proposed We ll sty t the oneptul leel Hsh tle implementtion is triky, detiled, & fun (see B.4) 18 9
10 Emple proedure p { int,, proedure q { int,,, w proedure r { int, y, z. proedure s { int,, r s q B0: { int,, B1: { int,,, w B2: { int, y, z. B3: { int,, 19 Emple proedure p { int,, proedure q { int,,, w proedure r { int, y, z., w,, q proedure s { int,, r s B0: { int 0, 1, 2 B1: { int 3, 4, 5, w 6 B2: { int 7, y 8, z 9. B3: { int 10, 11, 12 11, 4, 2, 12, w 6,, 10, no y or z Pituring it s series of Algol-like proedures 20 10
11 Leilly-soped Symol Tles High-leel ide Crete new tle for eh sope Chin them together for lookup s q w... p... Chin of tles implementtion insert() my need to rete tle it lwys inserts t urrent leel lookup() wlks hin of tles & returns first ourrene of nme delete() throws wy tle for leel p, if it is top tle in the hin Indiidul tles n e hsh tles. 21 Leilly-soped Symol Tles High-leel ide Crete new tle for eh sope Chin them together for lookup s q w... p... Rememer 11, 4, 2, 12, w 6,, 10, no y or z the nmes isile in s If we dd the susripts, the reltionship etween the ode nd the tle eomes ler 22 11
12 Implementing Leilly Soped Symol Tles Stk orgniztion netfree s (leel 2) q (leel 1) p (leel 0) w growth Implementtion insert () retes new leel pointer if needed nd inserts t netfree lookup () serhes linerly from netfree 1 forwrd delete () sets netfree to the equl the strt lotion of the leel deleted. Adntge Uses muh less spe Disdntge Lookups n e epensie 23 Implementing Leilly Soped Symol Tles Stk orgniztion 11, 4, 2, 12, w 6,, 10, no y or z netfree s (leel 2) q (leel 1) p (leel 0) w growth Implementtion insert () retes new leel pointer if needed nd inserts t netfree lookup () serhes linerly from netfree 1 forwrd delete () sets netfree to the equl the strt lotion of the leel deleted. Adntge Uses muh less spe Disdntge Lookups n e epensie 24 12
13 Implementing Leilly Soped Symol Tles Threded stk orgniztion h() w growth s q p Implementtion insert () puts new entry t the hed of the list for the nme lookup () goes diret to lotion delete () proesses eh element in leel eing deleted to remoe from hed of list Adntge lookup is fst Disdntge delete tkes time proportionl to numer of delred riles in leel 25 Implementing Leilly Soped Symol Tles Threded stk orgniztion 11, 4, 2, 12, w 6,, 10, no y or z h() w growth s q p Implementtion insert () puts new entry t the hed of the list for the nme lookup () goes diret to lotion delete () proesses eh element in leel eing deleted to remoe from hed of list Adntge lookup is fst Disdntge delete tkes time proportionl to numer of delred riles in leel 26 13
Compilers. Topic 4. The Symbol Table and Block Structure PART II. Mick O Donnell: Alfonso Ortega:
Compilers Topi 4 The ol Tle nd Blok Struture PART II Mik O Donnell: mihel.odonnell@um.es Alfonso Orteg: lfonso.orteg@um.es Topi 2: Blok Struture 2 1 ol tles with lok strutures Blok Struture Progrmming
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationClass Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414
Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationParallelization Optimization of System-Level Specification
Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion
More informationMidterm Exam CSC October 2001
Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationAdvanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs.
Avne Progrmming Hnout 5 Purel Funtionl Dt Strutures: A Cse Stu in Funtionl Progrmming Persistent vs. Ephemerl An ephemerl t struture is one for whih onl one version is ville t time: fter n upte opertion,
More informationCOMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More informationProblem Final Exam Set 2 Solutions
CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More informationSymbol Table management
TDDD Compilers nd interpreters TDDB44 Compiler Construction Symol Tles Symol Tles in the Compiler Symol Tle mngement source progrm Leicl nlysis Syntctic nlysis Semntic nlysis nd Intermedite code gen Code
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationCSE 401 Compilers. Agenda. Lecture 4: Implemen:ng Scanners Michael Ringenburg Winter 2013
CSE 401 Compilers Leture 4: Implemen:ng Snners Mihel Ringenurg Winter 013 Winter 013 UW CSE 401 (Mihel Ringenurg) Agend Lst week we overed regulr expressions nd finite utomt. Tody, we ll finish our finl
More informationCSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I
C 45 Compilers n ystems oftwre 6 : op-down Prsing I Christin Collberg Deprtment of Computer iene University of rizon ollberg@gmil.om Copyright 2009 Christin Collberg eptember 14, 2009 1 Overview 2 Compiler
More informationJava CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications
Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code
More informationINTEGRATED WORKFLOW ART DIRECTOR
ART DIRECTOR Progrm Resoures INTEGRATED WORKFLOW PROGRAM PLANNING PHASE In this workflow phse proess, you ollorte with the Progrm Mnger, the Projet Mnger, nd the Art Speilist/ Imge Led to updte the resoures
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationOperator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or
Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,
More informationReview from Thursday. Computer Animation II. Grid acceleration. Debugging. Computer-Assisted Animation. Final project
Computer Animtion II Orienttion interpoltion Dynmis Some slides ourtesy of Leonrd MMilln nd Jon Popoi Reiew from Thursdy Interpoltion Splines Artiulted odies Forwrd kinemtis Inerse Kinemtis Optimiztion
More informationContainers: Queue and List
Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of
More informationCourse Administration
/4/7 Spring 7 EE 363: Computer Orgniztion Arithmetic for Computers Numer Representtion & ALU Avinsh Kodi Deprtment of Electricl Engineering & Computer Science Ohio University, Athens, Ohio 457 E-mil: kodi@ohio.edu
More informationc s ha2 c s Half Adder Figure 2: Full Adder Block Diagram
Adder Tk: Implement 2-it dder uing 1-it full dder nd 1-it hlf dder omponent (Figure 1) tht re onneted together in top-level module. Derie oth omponent in VHDL. Prepre two implementtion where VHDL omponent
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationMcAfee Web Gateway
Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationTroubleshooting. Verify the Cisco Prime Collaboration Provisioning Installation (for Advanced or Standard Mode), page
Trouleshooting This setion explins the following: Verify the Ciso Prime Collortion Provisioning Instlltion (for Advned or Stndrd Mode), pge 1 Upgrde the Ciso Prime Collortion Provisioning from Smll to
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationDoubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral
Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA:
In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationComputational geometry
Leture 23 Computtionl geometry Supplementl reding in CLRS: Chpter 33 exept 33.3 There re mny importnt prolems in whih the reltionships we wish to nlyze hve geometri struture. For exmple, omputtionl geometry
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More information10/9/2012. Operator is an operation performed over data at runtime. Arithmetic, Logical, Comparison, Assignment, Etc. Operators have precedence
/9/22 P f Performing i Si Simple l Clcultions C l l ti with ith C#. Opertors in C# nd Opertor Precedence 2. Arithmetic Opertors 3. Logicl Opertors 4. Bitwise Opertors 5. Comprison Opertors 6. Assignment
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More information1 Which of the following keyword can not be appeared inside the class? a)virtual b)static c)template d)friend c
1 Whih of the following keywor n not e ppere insie the lss? )virtul )stti )templte )frien 2 Wht is templte? )Templte is formul for reting generi lss )Templte is use to mnipulte lss )Templte is use for
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More informationPointers and Arrays. More Pointer Examples. Pointers CS 217
Pointers nd Arrs CS 21 1 2 Pointers More Pointer Emples Wht is pointer A vrile whose vlue is the ddress of nother vrile p is pointer to vrile v Opertions &: ddress of (reference) *: indirection (dereference)
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More information1. Be able to do System Level Designs by: 2. Become proficient in a hardware-description language (HDL)
Ojetives CENG53 Digitl Sstem Design Digitl Mhine Design Overview 1. Be le to do Sstem Level Designs : Mstering design issues in ottom-up fshion nd Designing sstems for speifi pplitions in top-down methodolog
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationFinal Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book
inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.
More informationXML and Databases. Outline. XPath. Outline - Lectures. XPath Data Model. Outline - Assignments. XPath. Sebastian Maneth NICTA and UNSW
Outline XML n Dtses Leture 6 Noe Seleting Queries: XPth 1.0 1. XPth Dt Moel: 7 types of noes 2. Simple Exmples 3. Lotion Steps n Pths 4. Vlue Comprison, n Other Funtions Sestin Mneth NICTA n UNSW CSE@UNSW
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationEnterprise Digital Signage Create a New Sign
Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationConvex Hull Algorithms. Convex hull: basic facts
CG Leture D Conve Hull Algorithms Bsi fts Algorithms: Nïve, Gift wrpping, Grhm sn, Quik hull, Divide-nd-onquer Lower ound 3D Bsi fts Algorithms: Gift wrpping, Divide nd onquer, inrementl Conve hulls in
More informationRobust Boolean Reasoning for Equivalence Checking and Functional Property Verification
IEEE TRANSACTIONS ON COMPUTER-AIDED DESIGN OF INTEGRATED CIRCUITS AND SYSTEMS, VOL., NO. Y, MONTH Roust Boolen Resoning for Equivlene Cheking nd Funtionl Property Verifition Andres Kuehlmnn, Senior Memer,
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationClass 04 MUX / DMUX and Full Adder
lss 4 MUX / DMUX nd Full dder June 3, 23 2 Multiplexer MUX S S Y D D D 2 D 3 S S Y 3 D 3 D 3 D 23 D 33 Y 2 D 2 D 2 D 22 D 32 Y D D D 2 D 3 Y D D D 2 D 3 June 3, 23 3 Multiplexer MUX ENTITY mux4sel IS s:
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationArchitecture and Data Flows Reference Guide
Arhiteture nd Dt Flows Referene Guide BES12 Version 12.5 Pulished: 2016-06-29 SWD-20160620150844487 Contents Aout this guide... 5 Arhiteture: BES12 EMM solution... 6 BES12 omponents...8 Components used
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationSelecting the Most Highly Correlated Pairs within a Large Vocabulary
Seleting the Most Highl Correlted Pirs within Lrge Voulr Koji Umemur Deprtment of Computer Siene Toohshi Universit of Tehnolog umemur@tutistutjp Astrt Ourene ptterns of words in douments n e epressed s
More informationWORKSHOP 9 HEX MESH USING SWEEP VECTOR
WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re
More informationEECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining
EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationEfficient Subscription Management in Content-based Networks
Effiient Susription Mngement in Content-sed Networks Rphël Chnd, Psl A. Feler Institut EURECOM 06904 Sophi Antipolis, Frne {hnd feler}@eureom.fr Astrt Content-sed pulish/susrie systems offer onvenient
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationTo access your mailbox from inside your organization. For assistance, call:
2001 Ative Voie, In. All rights reserved. First edition 2001. Proteted y one or more of the following United Sttes ptents:,070,2;,3,90;,88,0;,33,102;,8,0;,81,0;,2,7;,1,0;,90,88;,01,11. Additionl U.S. nd
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More information6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page.
6045J/18400J: Automt, Computbility nd Complexity Mrh 30, 2005 Quiz 2: Solutions Prof Nny Lynh Vinod Vikuntnthn Plese write your nme in the upper orner of eh pge Problem Sore 1 2 3 4 5 6 Totl Q2-1 Problem
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationDon Thomas, 1998, Page 1
The Verilog Hrdwre Desription Lnguge Professor Don Thoms Crnegie Mellon University (CMU) thoms@ee.mu.edu http://www.ee.mu.edu/~thoms This is not one ohesive presenttion on Verilog. The slides ontined here
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (XML ) SA:
In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
More informationTriple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding
Triple/Qudruple Ptterning Lyout Deomposition vi Novel Liner Progrmming nd Itertive Rounding Yio Lin, Xioqing Xu, Bei Yu, Ross Bldik nd Dvid Z. Pn ECE Dept., University of Texs t Austin, Austin, TX USA
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More information