Appendix A. Example code output. Chapter 1. Chapter 3

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications

by the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.

Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,

6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3

6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}

Supplementary Table 1. Data collection and refinement statistics

Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (

TCGR: A Novel DNA/RNA Visualization Technique

TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu

Genome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department

http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:

SUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells

SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh

warm-up exercise Representing Data Digitally goals for today proteins example from nature

Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,

Machine Learning Classifiers

Machine Learning Classifiers Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision trees Naïve Bayes Perceptrons, Multi-layer Neural Networks

Digging into acceptor splice site prediction: an iterative feature selection approach

Digging into acceptor splice site prediction: an iterative feature selection approach Yvan Saeys, Sven Degroeve, and Yves Van de Peer Department of Plant Systems Biology, Ghent University, Flanders Interuniversity

Supplementary Materials:

Supplementary Materials: Amino acid codo n Numb er Table S1. Codon usage in all the protein coding genes. RSC U Proportion (%) Amino acid codo n Numb er RSC U Proportion (%) Phe UUU 861 1.31 5.71 Ser UCU

Supplementary Data. Image Processing Workflow Diagram A - Preprocessing. B - Hough Transform. C - Angle Histogram (Rose Plot)

Supplementary Data Image Processing Workflow Diagram A - Preprocessing B - Hough Transform C - Angle Histogram (Rose Plot) D - Determination of holes Description of Image Processing Workflow The key steps

2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA

176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45

A relation between trinucleotide comma-free codes and trinucleotide circular codes

Theoretical Computer Science 401 (2008) 17 26 www.elsevier.com/locate/tcs A relation between trinucleotide comma-free codes and trinucleotide circular codes Christian J. Michel a,, Giuseppe Pirillo b,c,

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Jean-Louis Lassez*, Ryan A. Rossi Computer Science Department, Coastal Carolina University jlassez@coastal.edu, raross@coastal.edu

LABORATORY STANDARD OPERATING PROCEDURE FOR PULSENET CODE: PNL28 MLVA OF SHIGA TOXIN-PRODUCING ESCHERICHIA COLI

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Shiga toxin-producing Escherichia coli O157 (STEC O157) and Salmonella enterica serotypes Typhimurium and Enteritidis.

Sequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes

Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity

MLiB - Mandatory Project 2. Gene finding using HMMs

MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA

Efficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside

Efficient Selection of Unique and Popular Oligos for Large EST Databases Stefano Lonardi University of California, Riverside joint work with Jie Zheng, Timothy Close, Tao Jiang University of California,

Degenerate Coding and Sequence Compacting

ESI The Erwin Schrödinger International Boltzmanngasse 9 Institute for Mathematical Physics A-1090 Wien, Austria Degenerate Coding and Sequence Compacting Maya Gorel Kirzhner V.M. Vienna, Preprint ESI

Supporting Information

Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2015. Supporting Information for Small, DOI: 10.1002/smll.201501370 A Compact DNA Cube with Side Length 10 nm Max B. Scheible, Luvena

Scalable Solutions for DNA Sequence Analysis

Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000

Structural analysis and haplotype diversity in swine LEP and MC4R genes

J. Anim. Breed. Genet. ISSN - OIGINAL ATICLE Structural analysis and haplotype diversity in swine LEP and MC genes M. D Andrea, F. Pilla, E. Giuffra, D. Waddington & A.L. Archibald University of Molise,

OFFICE OF RESEARCH AND SPONSORED PROGRAMS

OFFICE OF RESEARCH AND SPONSORED PROGRAMS June 9, 2016 Mr. Satoshi Harada Department of Innovation Research Japan Science and Technology Agency (JST) K s Gobancho, 7, Gobancho, Chiyoda-ku, Tokyo, 102-0076

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare

CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly

CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, 2009 http://cs.brown.edu/courses/csci2950-c/ l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset

de Bruijn graphs for sequencing data

de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:

Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data

1/39 Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi ENS Cachan Brittany / IRISA (Genscale team) Advisor : Dominique Lavenier 2/39 INTRODUCTION, YEAR 2000

DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization

Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics

DNA Sequencing. Overview

BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles

Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics

Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments

QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation

QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation Anurag Nagar Southern Methodist University Michael Hahsler Southern Methodist University

Computational Theory MAT542 (Computational Methods in Genomics) - Part 2 & 3 -

Computational Theory MAT542 (Computational Methods in Genomics) - Part 2 & 3 - Benjamin King Mount Desert Island Biological Laboratory bking@mdibl.org Overview of 4 Lectures Introduction to Computation

10/15/2009 Comp 590/Comp Fall

Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg

10/8/13 Comp 555 Fall

10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear

Assembly in the Clouds

Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools

Purpose of sequence assembly

Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery Amplicon sequencing But not for transcript

3. The object system(s)

3. The object system(s) Thomas Lumley Ken Rice Universities of Washington and Auckland Seattle, June 2011 Generics and methods Many functions in R are generic. This means that the function itself (eg plot,

de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January /73

1/73 de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January 2014 2/73 YOUR INSTRUCTOR IS.. - Postdoc at Penn State, USA - PhD at INRIA / ENS Cachan,

WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches

WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches 4-3 DSAP: BLASTn Page p. 7-1 NCBI BLAST Home Page p. 7-1 NCBI BLASTN search page p. 7-2 Copy sequence from DSAP or wave form program p. 7-2 Choose a database

This report is based on sampled data. Jun 1 Jul 6 Aug 10 Sep 14 Oct 19 Nov 23 Dec 28 Feb 1 Mar 8 Apr 12 May 17 Ju

0 - Total Traffic Content View Query This report is based on sampled data. Jun 1, 2009 - Jun 25, 2010 Comparing to: Site 300 Unique Pageviews 300 150 150 0 0 Jun 1 Jul 6 Aug 10 Sep 14 Oct 19 Nov 23 Dec

Detecting Superbubbles in Assembly Graphs. Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)!

Detecting Superbubbles in Assembly Graphs Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)! de Bruijn Graph-based Assembly Reads (substrings of original DNA sequence) de Bruijn

How to Run NCBI BLAST on zcluster at GACRC

How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis.

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis. 2. SCOPE: to provide the PulseNet participants with a single protocol for

DNA Fragment Assembly

Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly Overlap

Algorithms for Bioinformatics

Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms

Global Alignment. Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004

1 Introduction Global Alignment Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004 The purpose of this report is to verify attendance

Sequence Assembly Required!

Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy

software.sci.utah.edu (Select Visitors)

software.sci.utah.edu (Select Visitors) Web Log Analysis Yearly Report 2002 Report Range: 02/01/2002 00:00:0-12/31/2002 23:59:59 www.webtrends.com Table of Contents Top Visitors...3 Top Visitors Over Time...5

HPE Security Data Security. HPE SecureData. Product Lifecycle Status. End of Support Dates. Date: April 20, 2017 Version:

HPE Security Data Security HPE SecureData Product Lifecycle Status End of Support Dates Date: April 20, 2017 Version: 1704-1 Table of Contents Table of Contents... 2 Introduction... 3 HPE SecureData Appliance...

Assignment 2. Summary. Some Important bash Instructions. CSci132 Practical UNIX and Programming Assignment 2, Fall Prof.

Assignment 2 Summary The purpose of this assignment is to give you some practice in bash scripting. When you write a bash script, you are really writing a program in the bash programming language. In class

A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data

International Journal of Electrical and Computer Engineering (IJECE) Vol. 4, No. 1, Feburary 2014, pp. 93~100 ISSN: 2088-8708 93 A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving

Genome 373: Genome Assembly. Doug Fowler

Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-

ICT PROFESSIONAL MICROSOFT OFFICE SCHEDULE MIDRAND

ICT PROFESSIONAL MICROSOFT OFFICE SCHEDULE MIDRAND BYTES PEOPLE SOLUTIONS Bytes Business Park 241 3rd Road Halfway Gardens Midrand Tel: +27 (11) 205-7000 Fax: +27 (11) 205-7110 Email: gauteng.sales@bytes.co.za

Problem statement. CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly. Spring Example.

CS267 Assignment 3: Problem statement 2 Parallelize Graph Algorithms for de Novo Genome Assembly k-mers are sequences of length k (alphabet is A/C/G/T). An extension is a simple symbol (A/C/G/T/F). The

debgr: An Efficient and Near-Exact Representation of the Weighted de Bruijn Graph Prashant Pandey Stony Brook University, NY, USA

debgr: An Efficient and Near-Exact Representation of the Weighted de Bruijn Graph Prashant Pandey Stony Brook University, NY, USA De Bruijn graphs are ubiquitous [Pevzner et al. 2001, Zerbino and Birney,

EECS2301. Example. Testing 3/22/2017. Linux/Unix Part 3. for SCRIPT in /path/to/scripts/dir/* do if [ -f $SCRIPT -a -x $SCRIPT ] then $SCRIPT fi done

Warning: These notes are not complete, it is a Skelton that will be modified/add-to in the class. If you want to us them for studying, either attend the class or get the completed notes from someone who

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 13 Lopresti Fall 2007 Lecture 13-1 - Outline Introduction to graph theory Eulerian & Hamiltonian Cycle

GATB programming day

GATB programming day G.Rizk, R.Chikhi Genscale, Rennes 15/06/2016 G.Rizk, R.Chikhi (Genscale, Rennes) GATB workshop 15/06/2016 1 / 41 GATB INTRODUCTION NGS technologies produce terabytes of data Efficient

DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM

DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM Daniela Maria Cirillo San Raffaele Scientific Institute, Milan COI/CA OSR as signed MTA with Janssen and Otzuka as SRL and is involved

Asks for clarification of whether a GOP must communicate to a TOP that a generator is in manual mode (no AVR) during start up or shut down.

# Name Duration 1 Project 2011-INT-02 Interpretation of VAR-002 for Constellation Power Gen 185 days Jan Feb Mar Apr May Jun Jul Aug Sep O 2012 2 Start Date for this Plan 0 days 3 A - ASSEMBLE SDT 6 days

Multiple Sequence Alignment. With thanks to Eric Stone and Steffen Heber, North Carolina State University

Multiple Sequence Alignment With thanks to Eric Stone and Steffen Heber, North Carolina State University Definition: Multiple sequence alignment Given a set of sequences, a multiple sequence alignment

Read Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015

Mapping de Novo Assembly Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #2 WS 2014/2015 Today Genome assembly: the basics Hamiltonian and Eulerian

In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition

In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition D. Bošnački 1, T.E. Pronk 2, and E.P. de Vink 3, 1 Dept. of Biomedical Engineering, Eindhoven University of Technology 2 Swammerdam

./pharo Pharo.image eval 3 + 4 ./pharo Pharo.image my_script.st BioSequence newdna: atcggtcggctta. BioSequence newambiguousdna: AAGTCAGTGTACTATTAGCATGCATGTGCAACACATTAGCTG. BioSequence newunambiguousdna:

CSE 341 Section Handout #6 Cheat Sheet

Cheat Sheet Types numbers: integers (3, 802), reals (3.4), rationals (3/4), complex (2+3.4i) symbols: x, y, hello, r2d2 booleans: #t, #f strings: "hello", "how are you?" lists: (list 3 4 5) (list 98.5

Annex A to the DVD-R Disc and DVD-RW Disc Patent License Agreement Essential Sony Patents relevant to DVD-RW Disc

Annex A to the DVD-R Disc and DVD-RW Disc Patent License Agreement Essential Sony Patents relevant to DVD-RW Disc AT-EP S95P0391 1103087.1 09-Feb-01 1126619 8/16 Modulation AT-EP S95P0391 1120568.9 29-Aug-01

Technical University of Munich - FTP Site Statistics. Top 20 Directories Sorted by Disk Space

Technical University of Munich - FTP Site Statistics Property Value FTP Server ftp.ldv.e-technik.tu-muenchen.de Description Technical University of Munich Country Germany Scan Date 23/May/2014 Total Dirs

Polycom Advantage Service Endpoint Utilization Report

Polycom Advantage Service Endpoint Utilization Report ABC Company 9/1/2018-9/30/2018 Polycom, Inc. All rights reserved. SAMPLE REPORT d This report is for demonstration purposes only. Any resemblance to

All King County Summary Report

September, 2016 MTD MARKET UPDATE Data Current Through: September, 2016 18,000 16,000 14,000 12,000 10,000 8,000 6,000 4,000 2,000 0 Active, Pending, & Months Supply of Inventory 15,438 14,537 6.6 6.7

Algorithms and Data Structures

Algorithms and Data Structures Sorting beyond Value Comparisons Marius Kloft Content of this Lecture Radix Exchange Sort Sorting bitstrings in linear time (almost) Bucket Sort Marius Kloft: Alg&DS, Summer

Polycom Advantage Service Endpoint Utilization Report

Polycom Advantage Service Endpoint Utilization Report ABC Company 3/1/2016-3/31/2016 Polycom, Inc. All rights reserved. SAMPLE REPORT d This report is for demonstration purposes only. Any resemblance to

Parallel de novo Assembly of Complex (Meta) Genomes via HipMer

Parallel de novo Assembly of Complex (Meta) Genomes via HipMer Aydın Buluç Computational Research Division, LBNL May 23, 2016 Invited Talk at HiCOMB 2016 Outline and Acknowledgments Joint work (alphabetical)

Computational Architecture of Cloud Environments Michael Schatz. April 1, 2010 NHGRI Cloud Computing Workshop

Computational Architecture of Cloud Environments Michael Schatz April 1, 2010 NHGRI Cloud Computing Workshop Cloud Architecture Computation Input Output Nebulous question: Cloud computing = Utility computing

Omega Engineering Software Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space

Omega Engineering Software Archive - FTP Site Statistics Property Value FTP Server ftp.omega.com Description Omega Engineering Software Archive Country United States Scan Date 14/Apr/2015 Total Dirs 460

UAE PUBLIC TRAINING CALENDAR

UAE 102-R8.3 Primavera P6 Professional Fundamentals Rel 8.3 5 Abu Dhabi 4-Jan 8-Jan 19.5 106-R8.3 Primavera P6 Professional Advanced Rel8.3 3 Dubai 18-Jan 20-Jan 13.0 PMI-SP01 SP) Certification) 5 Abu

Genome 373: Intro to Python I. Doug Fowler

Genome 373: Intro to Python I Doug Fowler Outline Intro to Python I What is a program? Dealing with data Strings in Python Numbers in Python What is a program? What is a program? A series of instruc2ons,

Solutions Exercise Set 3 Author: Charmi Panchal

Solutions Exercise Set 3 Author: Charmi Panchal Problem 1: Suppose we have following fragments: f1 = ATCCTTAACCCC f2 = TTAACTCA f3 = TTAATACTCCC f4 = ATCTTTC f5 = CACTCCCACACA f6 = CACAATCCTTAACCC f7 =

Eulerian Tours and Fleury s Algorithm

Eulerian Tours and Fleury s Algorithm CSE21 Winter 2017, Day 12 (B00), Day 8 (A00) February 8, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Vocabulary Path (or walk): describes a route from one vertex

Grade 4 Mathematics Pacing Guide

Jul 2014 ~ August 2014 ~ Sep 2014 1 2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 Routines 19 Routines 20 Routines BOY 22 BOY 23 24 11 12 14 29 15 30 31 Notes: Found Online @ wwweverydaymathonlinecom 1 More Calendars

Seattle (NWMLS Areas: 140, 380, 385, 390, 700, 701, 705, 710) Summary

September, 2016 MTD MARKET UPDATE Data Current Through: September, 2016 (NWMLS Areas: 140, 380, 385, 390,, 701, 705, 710) Summary Active, Pending, & Months Supply of Inventory 5,000 4,500 4,000 3,500 4,091

Fluidity Trader Historical Data for Ensign Software Playback

Fluidity Trader Historical Data for Ensign Software Playback This support document will walk you through the steps of obtaining historical data for esignal into your Ensign Software program so that you

Section 1.2: What is a Function? y = 4x

Section 1.2: What is a Function? y = 4x y is the dependent variable because it depends on what x is. x is the independent variable because any value can be chosen to replace x. Domain: a set of values

Seattle (NWMLS Areas: 140, 380, 385, 390, 700, 701, 705, 710) Summary

October, 2016 MTD MARKET UPDATE Data Current Through: October, 2016 (NWMLS Areas: 140, 380, 385, 390,, 701, 705, 710) Summary Active, Pending, & Months Supply of Inventory 4,500 4,000 3,500 4,197 4,128

SCI - software.sci.utah.edu (Select Visitors)

SCI - software.sci.utah.edu (Select Visitors) Web Log Analysis Yearly Report 2004 Report Range: 01/01/2004 00:00:00-12/31/2004 23:59:59 www.webtrends.com Table of Contents Top Visitors...3 Top Visitors

If Case Loop Next Exit

If Case Loop Next Exit If statement If_statement ::= if condition then sequence of sequential statements {elsif condition then sequence of sequential statements} [else sequence of sequential statements]

Seattle (NWMLS Areas: 140, 380, 385, 390, 700, 701, 705, 710) Summary

November, 2016 MTD MARKET UPDATE Data Current Through: November, 2016 (NWMLS Areas: 140, 380, 385, 390,, 701, 705, 710) Summary 4,000 3,500 3,000 2,500 2,000 1,500 1,000 500 0 Active, Pending, & Months

High Performance Computing

High Performance Computing MPI and C-Language Seminars 2009 Photo Credit: NOAA (IBM Hardware) High Performance Computing - Seminar Plan Seminar Plan for Weeks 1-5 Week 1 - Introduction, Data Types, Control

Sand Pit Utilization

Sand Pit Utilization A construction company obtains sand, fine gravel, and coarse gravel from three different sand pits. The pits have different average compositions for the three types of raw materials

Graphs and Puzzles. Eulerian and Hamiltonian Tours.

Graphs and Puzzles. Eulerian and Hamiltonian Tours. CSE21 Winter 2017, Day 11 (B00), Day 7 (A00) February 3, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Exam Announcements Seating Chart on Website Good

GWDG Software Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space

GWDG Software Archive - FTP Site Statistics Property Value FTP Server ftp5.gwdg.de Description GWDG Software Archive Country Germany Scan Date 18/Jan/2016 Total Dirs 1,068,408 Total Files 30,248,505 Total

NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints

1 NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints Youxi Wu, Yao Tong, Xingquan Zhu, Senior, IEEE, and Xindong Wu, Fellow, IEEE Abstract Sequence pattern mining aims to discover frequent

CMIS 102 Hands-On Lab

CMIS 10 Hands-On Lab Week 8 Overview This hands-on lab allows you to follow and experiment with the critical steps of developing a program including the program description, analysis, test plan, and implementation

IKS Service GmbH - FTP Site Statistics. Top 20 Directories Sorted by Disk Space

IKS Service GmbH - FTP Site Statistics Property Value FTP Server ftp.iks-jena.de Description IKS Service GmbH Country Germany Scan Date 20/Nov/2015 Total Dirs 5,112 Total Files 8,741 Total Data 1.44 GB

COURSE LISTING. Courses Listed. with SAP Hybris Marketing Cloud. 24 January 2018 (23:53 GMT) HY760 - SAP Hybris Marketing Cloud

with SAP Hybris Marketing Cloud Courses Listed HY760 - SAP Hybris Marketing Cloud C_HYMC_1702 - SAP Certified Technology Associate - SAP Hybris Marketing Cloud (1702) Implementation Page 1 of 12 All available

Similarly, example of memory address of array and hash are: ARRAY(0x1a31d44) and HASH(0x80f6c6c) respectively.

Lecture #9 What is reference? Perl Reference A Perl reference is a scalar value that holds the location of another value which could be scalar, arrays, hashes, or even a subroutine. In other words, a reference