Qubit allocation for quantum circuit compilers
|
|
- Nathaniel Ross
- 6 years ago
- Views:
Transcription
1 Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir
2 Compilers for quntum computing The first genertion of usle quntum computers is here e.g. IBM Quntum Experience Enles experimentl computer science Existing nd ner-future rchitectures: 10s to 50 quits No error correction Low-level constrints on circuits: set of gtes, quit connectivity Need compilers of circuits down to lowlevel gtes Mny differences from clssicl compilers Algorithms Quntum circuits Quntum circuit compiler Quntum microrchitecture Quntum computing hrdwre
3 Focus: the quit lloction phse Mp logicl quits to physicl quits Need to meet hrdwre constrints: connectivity etween physicl quits Trnsform circuit to fit on given quntum computer Minimize runtime nd gte count to minimize noise Softwre: circuit on logicl quits rdwre: physicl quits 3
4 Agend The quit lloction prolem An exct lgorithm A greedy heuristic Comprison of lloction ccurcy Future directions 4
5 Level of strction: quntum circuits Input: reversile quntum circuits descried t gte level 0 X 0 T Between initiliztion nd mesurement : unitry gtes only After decomposition into single-quit nd CNOT gtes Expressed in QASM lnguge qreg l[2]; creg c[2]; x l[0]; h l[0]; cx l[0] l[1]; t l[1]; mesure l[0] -> c[0]; mesure l[1] -> c[1]; 5
6 Limited-connectivity quntum computer Trget: superconducting quit sed quntum computers Constrints on which quits re llowed to interct e.g. IBM QX2, 5 quits Quits Possile CNOT gtes e.g. IBM QX5, 16 quits 6
7 The quit ssignment prolem Cn we lel logicl quits with physicl quits so tht ll gtes oey mchine connectivity constrints? Esy prt of quit lloction Alredy NP-Complete (sugrph isomorphism) l0 l1 l2 l3 l4 l4 l0 l2 l3 l1 emed? Circuit Dependencies on logicl quits Connectivity of physicl quits In prctice, most circuits will need trnsformtions to fit the connectivity grph 7
8 Circuit trnsformtion primitives CNOT reversl Trnsformtion Effect on dependency grph (ssuming no other dependency) Bridge ` c c c Swp Chnge mpping! 8
9 The quit lloction prolem Quit lloction with swps only Minimize numer of swps inserted NP-Complete (Token Swpping prolem) Generl quit lloction prolem Use CNOT reversl, ridge nd swp Minimize cost of circuit trnsformtions Suprolem of depth d Circuit depth := numer of CNOT gtes Strts nd ends with logicl-to-physicl quit mppings initil L Q mpping Slice of depth d finl L Q mpping Slice of depth d+1 9
10 Exct lgorithm: dynmic progrmming Assume we know prtil solutions of depth d with finl mpping M nd their cost, for ll M Compute solutions of depth d+1 with finl mpping M, for ll M Select the (solution of depth d) + (permuttion) tht minimizes cost Solutions of depth d: cost Cost of permuttion from Mi to Mj Solutions of depth d+1... Solutions for full circuit M M M Unfesile solutions hve cost Finl solution: minimum cost 10
11 Exct lgorithm: dynmic progrmming Solutions of depth d: cost Cost of permuttion from Mi to Mj Solutions of depth d+1... Solutions for full circuit M M M Unfesile solutions hve cost Finl solution: minimum cost Complexity O((n!) 2 m) for n quits nd circuit depth m Suitle for 8 quits Gives n optiml reference to compre heuristics 11
12 The Weighted Prtil Mtching heuristic 1. Find good initil mpping Fvor most-often used dependencies 2. Extend the mpping, trnsforming circuit s needed Perform swp when it cn e mortized Use CNOT reversl on ckwrd edges If we hve 2-step pth through nother quit, use Bridge If ll else fils, insert s mny swps s needed 12
13 Results: cost on IBM QX2, ctul circuits Exct lgorithm Other heuristics from the literture Our heuristic with rndom initil mpping Our heuristic quiter heuristic with improved initil mpping euristic outperforms stte of the rt in this 5-quit configurtion Exct lgorithm shows heuristics hve potentil for improvement Both in initil mpping choice nd migrtion strtegy 13
14 Next steps for quit lloction Improved heuristics Seek run-time vs. ccurcy trdeoffs Specilize for regulr quntum computer structures Tke dvntge of quntum circuit properties: spcil, temporl loclity Coordinte circuit optimiztion with quit lloction e.g. optimize wy redundnt dmrd gtes when plcing reverse CNOT next to gtes Recycle ncille quits Quit with completely known equl stte re interchngele (e.g. 0 ) Sttic nlysis to find quit equlities? Optimize for device chrcteristics Different quits nd couplings hve different noise levels 14
15 Compiler optimiztion for quntum circuits Mpping high-level gtes to hrdwre-supported gtes Single-quit gtes: ccurcy/cost trdeoffs Toffoli gtes: exploit freedom on reltive phse Time/spce trdeoffs Adpt numer of ncille quits to resource vilility Formliztion Which semntics for quntum progrms nd quntum computers? Which intermedite representtion for quntum circuits? Correctness proofs of compiler trnsformtions 15
ECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationShould be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night
Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationFault injection attacks on cryptographic devices and countermeasures Part 2
Fult injection ttcks on cryptogrphic devices nd countermesures Prt Isrel Koren Deprtment of Electricl nd Computer Engineering University of Msschusetts Amherst, MA Countermesures - Exmples Must first detect
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev
Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms
More informationDigital Signal Processing: A Hardware-Based Approach
Digitl Signl Processing: A Hrdwre-Bsed Approch Roert Esposito Electricl nd Computer Engineering Temple University troduction Teching Digitl Signl Processing (DSP) hs included the utilition of simultion
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationSelf-Adjusting Output Data Compression: An Efficient BIST Technique for RAMs
Design, Automtion nd Test in Europe, DATE 98, Pris, Frnce, Ferury 23-26, 998 Self-Adjusting Output Dt Compression: An Efficient BIST Technique for s V. N. Yrmolik Computer Systems Deprtment Belrussin Stte
More informationCourse Administration
/4/7 Spring 7 EE 363: Computer Orgniztion Arithmetic for Computers Numer Representtion & ALU Avinsh Kodi Deprtment of Electricl Engineering & Computer Science Ohio University, Athens, Ohio 457 E-mil: kodi@ohio.edu
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationAddress Register Assignment for Reducing Code Size
Address Register Assignment for Reducing Code Size M. Kndemir 1, M.J. Irwin 1, G. Chen 1, nd J. Rmnujm 2 1 CSE Deprtment Pennsylvni Stte University University Prk, PA 16802 {kndemir,mji,guilchen}@cse.psu.edu
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationIt consists of two cold rooms, each with their own evaporator but sharing the same cooling flui d R134a system ( compressor, condenser...).
This system llows study of refrigertion systems implementtion of rmodyn mic clcultions pplied to refrigertion Its uniqueness is tht it is fully controllble vi Internet directly from web browser like Internet
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationTaming Subgraph Isomorphism for RDF Query Processing
Tming Sugrph Isomorphism for RDF Query Processing Jinh Kim # jinh.kim@orcle.com Hyungyu Shin hgshin@dl.postech.c.kr Sungpck Hong # Hssn Chfi # {sungpck.hong, hssn.chfi}@orcle.com POSTECH, South Kore #
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCompiling a Parallel DSL to GPU
Compiling Prllel DSL to GPU Rmesh Nrynswmy Bdri Gopln Synopsys In. Synopsys 2012 1 Agend Overview of Verilog Simultion Prllel Verilog Simultion Algorithms Prllel Simultion Trdeoffs on GPU Chllenges Synopsys
More informationAn introduction to model checking
An introduction to model checking Slide 1 University of Albert Edmonton July 3rd, 2002 Guy Trembly Dépt d informtique UQAM Outline Wht re forml specifiction nd verifiction methods? Slide 2 Wht is model
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationEfficient K-NN Search in Polyphonic Music Databases Using a Lower Bounding Mechanism
Efficient K-NN Serch in Polyphonic Music Dtses Using Lower Bounding Mechnism Ning-Hn Liu Deprtment of Computer Science Ntionl Tsing Hu University Hsinchu,Tiwn 300, R.O.C 886-3-575679 nhliou@yhoo.com.tw
More informationEfficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc
4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationCombinatorial synthesis approach employing graph networks
ville online t www.sciencedirect.com VN NGINRING INFORMTIS dvnced ngineering Informtics (00) www.elsevier.com/locte/ei omintoril synthesis pproch employing grph networks Offer Shi, *, Noel Titus, Krthik
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationA Sparse Grid Representation for Dynamic Three-Dimensional Worlds
A Sprse Grid Representtion for Dynmic Three-Dimensionl Worlds Nthn R. Sturtevnt Deprtment of Computer Science University of Denver Denver, CO, 80208 sturtevnt@cs.du.edu Astrct Grid representtions offer
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationAccelerating 3D convolution using streaming architectures on FPGAs
Accelerting 3D convolution using streming rchitectures on FPGAs Hohun Fu, Robert G. Clpp, Oskr Mencer, nd Oliver Pell ABSTRACT We investigte FPGA rchitectures for ccelerting pplictions whose dominnt cost
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationApproximate computations
Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationECEN 468 Advanced Logic Design Lecture 36: RTL Optimization
ECEN 468 Advnced Logic Design Lecture 36: RTL Optimiztion ECEN 468 Lecture 36 RTL Design Optimiztions nd Trdeoffs 6.5 While creting dtpth during RTL design, there re severl optimiztions nd trdeoffs, involving
More informationA Comparison of High-Level Approaches for Speeding Up Pathfinding
A Comprison of High-Level Approches for Speeding Up Pthfinding Nthn R. Sturtevnt Deprtment of Computing Science University of Alert Edmonton, Alert, Cnd nthnst@cs.ulert.c Roert Geiserger Fculty of Informtics
More informationSymbol Table management
TDDD Compilers nd interpreters TDDB44 Compiler Construction Symol Tles Symol Tles in the Compiler Symol Tle mngement source progrm Leicl nlysis Syntctic nlysis Semntic nlysis nd Intermedite code gen Code
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationTopological Queries on Graph-structured XML Data: Models and Implementations
Topologicl Queries on Grph-structured XML Dt: Models nd Implementtions Hongzhi Wng, Jinzhong Li, nd Jizhou Luo Astrct In mny pplictions, dt is in grph structure, which cn e nturlly represented s grph-structured
More informationEngineer-to-Engineer Note
Engineer-to-Engineer Note EE-232 Technicl notes on using Anlog Devices DSPs, processors nd development tools Contct our technicl support t dsp.support@nlog.com nd t dsptools.support@nlog.com Or visit our
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationA REINFORCEMENT LEARNING APPROACH TO SCHEDULING DUAL-ARMED CLUSTER TOOLS WITH TIME VARIATIONS
A REINFORCEMENT LEARNING APPROACH TO SCHEDULING DUAL-ARMED CLUSTER TOOLS WITH TIME VARIATIONS Ji-Eun Roh (), Te-Eog Lee (b) (),(b) Deprtment of Industril nd Systems Engineering, Kore Advnced Institute
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationTOWARDS GRADIENT BASED AERODYNAMIC OPTIMIZATION OF WIND TURBINE BLADES USING OVERSET GRIDS
TOWARDS GRADIENT BASED AERODYNAMIC OPTIMIZATION OF WIND TURBINE BLADES USING OVERSET GRIDS S. H. Jongsm E. T. A. vn de Weide H. W. M. Hoeijmkers Overset symposium 10-18-2012 Deprtment of mechnicl engineering
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationMemory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples
EURSIP Journl on pplied Signl Processing 2003:6, 54 529 c 2003 Hindwi Publishing orportion Memory-Optimized Softwre Synthesis from tflow Progrm Grphs withlrgesizetsmples Hyunok Oh The School of Electricl
More information