Week 4. Week 4 Goals & Reading. Strict pragma P24H: Hour 8: Making a stricter Perl PP: Ch 6 (using the strict pragma)

Transcription

1 Week 4 Week 4 Goals & Reading Strict pragma P24H: Hour 8: Making a stricter Perl PP: Ch 6 (using the strict pragma) Regular Expressions P24H: Hour 6, Hour 9: Transliteration PP: Ch10, Ch15 Special variables complete list at (its long and scary) PP Sorting P24H: Hour 4 (reordering arrays) Biol Practical Biocomputing 1

2 Strict Syntax Why? Perl's ability to create variables on-the-fly is a two edged sword. simple programs can be written extremely quickly typographical errors are hard to detect What does "use strict;" require? All variables must be declared with "my" No "barewords" except as hash keys. All other barewords must correspond to functions No "symbolic references" X $foo = "some stuff; $var_name = "foo"; print $$var_name; # prints "some stuff" Biol Practical Biocomputing 2

3 Strict Syntax # read the file line-by-line count the number of reads and total length $line_num = 0; while ( $line = <> ) { # remove the newline character chomp $line; # The counts of the four bases at each position of the sequence are each # stored in separate arrays. An additional holds all other # characters if ( $line_num % 4 == 1 ) { # the second line is the sequence line #print "$line_num: $line:\n"; # split the sequence into an array of characters and increment the count # arrays for each = split "", $line; foreach $i ( 0.. $#base ) { if ( $base[$i] eq 'A' ) { $A[ $i ]++; Biol Practical Biocomputing 3

4 Strict Syntax after adding use strict; Global symbol "$line_num" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 21. Global symbol "$line" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 22. Global symbol "$line" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 24. Global symbol "$line_num" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 30. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 36. Global symbol "$line" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 36. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 37. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 37. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 38. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 38. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 39. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 39. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 41. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 41. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 42. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 42. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 44. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 44. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 45. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 45. Global symbol requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 47. Global symbol "$i" requires explicit package name at C:/Users/mgribsko/workspace/work/2016perl/hw2_key.pl line 47. Biol Practical Biocomputing 4

5 Strict Syntax # read the file line-by-line count the number of reads and total length my $line_num = 0; while ( my $line = <> ) { # remove the newline character chomp $line; # The counts of the four bases at each position of the sequence are each # stored in separate arrays. An additional holds all other # characters if ( $line_num % 4 == 1 ) { # the second line is the sequence line #print "$line_num: $line:\n"; # split the sequence into an array of characters and increment the count # arrays for each position = split "", $line; foreach $i ( 0.. $#base ) { if ( $base[$i] eq 'A' ) { $A[ $i ]++; Biol Practical Biocomputing 5

6 Strict Syntax declare variable using my location of my determines scope variable is defined only within the nearest {. Loop variables defined inside loop, not outside global variables, in main program, are defined everywhere declared outside of all { # read the file line-by-line count the number of reads and total length ); = (); my $line_num = 0; while ( my $line = <> ) { # remove the newline character chomp $line; = split "", $line; foreach $i ( 0.. $#base ) { if ( $base[$i] eq 'A' ) { $A[ $i ]++; while ) { $na = print "$na\t$nc\t$ng\t$nt\t$frac_at\t$frac_gc\n"; Biol Practical Biocomputing 6

7 Style and Strict syntax From now on (for homework) Always use strict always declare all variables (even in main program) with "my" Scripts should have no errors or warnings with perl w use warnings; does the same Explicitly pass and return values to/from subroutines All subroutine variables must be local (declared with "my") Biol Practical Biocomputing 7

8 Regular Expressions (regex, re) Finding and replacing text (pattern matching) One of the most powerful features of Perl A tool for parsing and manipulating text parsing: identifying and labeling pieces of text e.g., noun verb subject object for english e.g., sequence, organism, gene name, etc., for bioinformatics Regular expressions are often cryptic always include a comment explaining what the regex does Biol Practical Biocomputing 8

9 Regular Expressions Three operations The "regular expression" (regex) describes what kind of string you are looking for, you can use the regex to Find (match) find a particular piece of text Replace (substitute) find a piece of test and change it Translate change every example of something in a text Biol Practical Biocomputing 9

10 Regular Expressions The basic idea: Regular expression uses the =~ operator (string binding operator) Expression evaluates to true or false $string =~ m/pattern/; # match (m can be omitted) $string =~ s/pattern/pattern/; # replace (substitute, s) $string =~ tr/pattern/pattern/; # translate Matching text if ( $name =~ m/derren/ ) if ( $name =~ /derren/ ) if ( /derren/ ) # legal but deprecated matching is the default if you omit the "m" matching is case sensitive (unless you specify otherwise) Biol Practical Biocomputing 10

11 Regular Expressions Simple patterns letters only, every letter must match /GATTACA/ delimiter // You can use other delimiters :GATTACA: : #!{ and most non whitespace characters, but some invoke special rules not \ ( ) + < [ Matching process Matches are processed left to right The first possible match (leftmost) is matched first. Once a match is found, matching stops (unless otherwise directed) The largest possible match is made (for instance if you include a *) The match is true only if the entire pattern matches Biol Practical Biocomputing 11

12 Regular Expressions Count restrictions (quantifiers) Apply to the preceding character or parenthesized group Repeated characters {n,m must occur at least n times but not more than m {n, must occur at least n times {n must occur exactly n times Shorthands (these are used much more than the forms above) * must occur zero or more times (same as {0,) + must occur or more times (same as {1,)? must occur 0 or 1 time (same as {0,1) Character classes. matches anything (except \n) [characters] matches to anything in the set of characters [^characters] matches anything NOT in the set of characters Biol Practical Biocomputing 12

13 Regular Expressions Character classes [ ] [abcd] matches any of a, b, c, or d [abcd]+ matches a run of a, b, c, or d or any length >= 1 [abcd]* matches a run of a, b, c, or d of any length, including zero [aaccggtt] matches DNA bases in upper or lower case [a-z0-9] matches lower case letters and digits [^A-Z] matches anything that is not an uppercase letter predefined character classes Note: uppercase is systematically used to mean the inverse \w [a-za-z0-9] \W [^a-za-z0-9] \d [0-9] \D [^0-9] \s [ \t\f\r\n] (includes space) \S [^\t\f\r\n] Biol Practical Biocomputing 13

14 Regular Expressions Without regular expressions, you can find things in strings using index, but it is cumbersome while ( $line = <IN> ) { ($name, $seqlen ) = split " ", $line, 2; if ( index( $name, "at1g" ) or index( $name, "at2g" ) or index( $name, "at3g" ) or index( $name, "at3g" ) or index( $name, "at3g" ) ) { print "$name\n"; while ( $line = <IN> ) { ($name, $seqlen ) = split " ", $line, 2; if ( $name =~ /at\dg/ ) { print "$name\n"; Biol Practical Biocomputing 14

15 Regular Expressions Wildcards A period matches any character # match to Arabidopsis AGI numbers if ( $name=~/at1g/ ) { print "chromosome 1: $name\n"; if ( $name=~/at.g/ ) { print "$name is in AGI format\n"; What if you want to match a period or other special character such as \ +*? Similar to strings, use a backslash to escape the special meaning Biol Practical Biocomputing 15

16 Regular Expression Escaping special characters # escaping special = ( "Arabidopsis thaliana", "A. thaliana" ); foreach $test ) { if ( $test=~/a./ ) { # test for presence of A. print "Found an abbreviation: $test\n"; if ( $test=~/a\./ ) { # correctly test for presence of A. print "Oops really found it this time: $test\n"; Biol Practical Biocomputing 16

17 Regular Expressions Wildcards Repeats * - zero or more times + - one or more times $string = "aabbbbcee"; # no d in this string if ( $string =~ /a*b*c*d*e/ ) { print "found a*b*c*d*e\n"; if ( $string =~ /a+b+c+e/ ) { print "found a+b+c+e"; Biol Practical Biocomputing 17

18 Regular Expressions Alternation match this or that /this that/ Grouping limit the alternation to just a part of the match $line =~ /frog log bog cog dog/ vs $line =~ /(fr l b c d)og/ Biol Practical Biocomputing 18

19 Regular Expressions Style # match phone numbers $phone_number =~ /\d\d\d-\d\d\d\d/ #1 $phone_number =~ /\d+-\d+/ #2 $phone_numer =~ /\(\d{3,3\)\s\d{3,3\s-\s\d{4,4/ #3 $phone_number =~ /\(\d{3,3\)\s\d{3,3\s-\s\d{4,4 \d+-\d+/ #4 Regular expressions can be very cryptic always include a comment explaining what you are testing # match phone numbers $phone_number =~ /\d\d\d-\d\d\d\d/ # $phone_number =~ /\d+-\d+/ # 1-4 $phone_numer =~ /\(\d{3,3\)\s\d{3,3\s-\s\d{4,4/ #(123) $phone_number =~ /\(\d{3,3\)\s\d{3,3\s-\s\d{4,4 \d+-\d+/ # 2 or #3 Biol Practical Biocomputing 19

20 Regular Expressions Replace (substitution, s) Change the matched expression to a new one Substitution syntax $x =~ s/ PATTERN / REPLACEMENT /; # example of substitution $name = "A. thaliana"; $name =~ s/a\./arabidopsis/; # substitute Arabidopsis for A. print "$name\n"; Biol Practical Biocomputing 20

21 Regular Expression Translation Change all the letters in PATTERN to the corresponding ones in REPLACEMENT Translation syntax $x =~ tr/ PATTERN / REPLACEMENT /; return value of translation is the number of replacements. this is useful for counting the number of occurances of something # examples of translation $name = "A. thaliana"; $name =~ tr/a-z/a-z/; print "$name\n"; # change to upper case $sequence = "ACTGACTGGTA"; print "DNA sequence is $sequence\n"; $sequence =~ tr/t/u/; print "RNA sequence is $sequence\n"; $number_of_u = $sequence =~ tr/u/u/; print "there are $number_of_u Us in this sequence\n"; Biol Practical Biocomputing 21

22 Regular Expressions Anchors tie the pattern match to the beginning (^) or end ($) of the match string greatly improves speed Modifiers modifiers follow a regular expression and effect the details of the operation i g m s case insensitive, /[aaccggtt]+/ same as /[acgt]+/i global, match or substitute across the entire string can be used to iterate over matches treat as multiple lines (^ and $ match at each line) treat as single string (allow matches that cross \n) # test regular expression modifiers $hello = "hello Hello hello"; print "original: $hello\n"; $hello =~ s/hello/hi/g; print "final: $hello\n"; $hello = "hello Hello hello"; print "original: $hello\n"; $hello =~ s/hello/hi/ig; print "final: $hello\n"; Biol Practical Biocomputing 22

23 Regular Expressions Dynamic matching Regular expression patterns can be Perl variables $pattern = '234'; $text = '12345'; print "yes!\n" if $text =~ /$pattern/; Biol Practical Biocomputing 23

24 Regular Expressions Extracting the value of a match Perl Special Variables String matching $& the string matched by the last pattern match (not counting exited blocks) $` the string preceding the last pattern match $' the string following the last pattern match Biol Practical Biocomputing 24

25 Regular Expressions Regions surrounding the match $` string before match $& matching string $' string after match $string = "To be, or not to be, that is the question, eh?"; print "\nstring:$string\n"; $n = 0; while ( $string =~ /(^ )\w\w( $)/g ) { # what does this do? include comment $n++; print "match $n\n before:$`:\n match:$&:\n after:$':\n\n"; Biol Practical Biocomputing 25

26 Regular Expressions Extracting (capturing) the value of a regular expression match parentheses meaning overloaded with grouping parentheses indicate text to be saved $line =~ /name:\s*/; $line =~ /name:\s*[^ ]+/ ; $line =~ /name:\s*([^ ]+)/ ; where is the match saved? special variables: $1, $2, $3 $name = $1; or ($name) = $line =~ /name:\s*([^ ]+)/ multiple matches # matches name: # matches name: <stuff> # saves text following "name:" ( $first, $last ) = $line =~ /surname:\s*([^ ]+)\s+first name:\s*([^ ]+)/ $1 $2 Biol Practical Biocomputing 26

27 Regular Expressions in an array or list context, the match operator returns (captures) the parts of the string that match parentheses can be nested #!/usr/bin/perl = qw( dogs ddogs cat cats log clog flogging ); foreach $word ) { if ( ($inner,$outer) = $word =~ /(fr b d (f c)?l)og/ ) { $inner = " " unless $inner; $outer = " " unless $outer; print "$word inner:$inner outer:$outer\n"; else { print "$word did not match\n"; dogs inner:d outer: ddogs inner:d outer: cat did not match cats did not match log inner:l outer: clog inner:cl outer:c flogging inner:fl outer:f Biol Practical Biocomputing 27

28 Split vs Regular Expression If regex does not match, no values are returned Very sensitive to format changes Very sensitive to missing letters, case differences, columns Id:At1G10000 Location:1,1000 GC:0.45 Id:At1G10100 location:1001,2000 GC:0.46 Id:At1G10200 Location:3001,4000 GC:0.52 The following regex is wrong, why? While ( $line = <> ) { ($id, $loc, $gc ) = $line =~ /Id:(\w+) Location:(\d+,\d+) GC:(\d+)/; No match for line two and three, all values undefined Biol Practical Biocomputing 28

29 Split vs Regular Expression Split is often more robust for column oriented formats Id:At1G10000 Location:1,1000 GC:0.45 Id:At1G10100 location:1001,2000 GC:0.46 Id:At1G10200 Location:3001,4000 GC:0.52 While ( $line = <> ) = split, $line; foreach $f ) { ($tag, $value ) = split :, $f; $info{$tag = $value; Biol Practical Biocomputing 29

30 Special Variables Predefined Variables full list: Special variables are variables predefined by the interpreter. STDIN predefined filehandle for standard input STDERR predefined filehandle for standard error STDOUT predefined filehandle for standard output $_ default input/pattern search space $. current line number in the last filehandle read $/ input record separator, default is \n $\ output record separator (prints at end of print, not between terms) $, output field separator (prints between terms) $# default output format for numbers $$ process number of the process running the script $0 name of the Perl script being an array containing the command line arguments intended for the script ARGV special filehandle that iterates over command line filenames Used in the null input operation <> $ARGV the name of the current file when reading from <ARGV> or <> %ENV has containing the current environment. Environment is the system symbols on your computer (OS specific) Biol Practical Biocomputing 30

31 Special Variables $_ default input/pattern search space Used in many contexts as a default value, among others default variable for input <> operator default target for print default target for string matching default target for chomp and chop Makes code brief, but Risky because many operations change it, and hard to understand while ( <> ) { print; while ( $_ = <> ) { print $_; while ( $line = <> ) { print $line; # $_ is implicit # means the same # much less likely to go wrong Biol Practical Biocomputing 31

32 Special Variables default input/pattern search space, more examples while ( <> ) { chomp; if ( /^>/ ) { print; # beginning of FASTA sequence while ( $_ = <> ) { chomp $_; # means the same if ( $_ =~ /^>/ ) { print $_; while ( $line = <> ) { chomp $line; # preferred method, easier to understand # less susceptible to side effects if ( $line =~ /^>/ ) { print $line; Biol Practical Biocomputing 32

33 Special Variables Command line The line of text you type when you run a program Command line is used to specify "switches" and files % myprogram.pl file1.txt file2.txt % perl myprogram.pl file1.txt file2.txt % myprogram.pl v n100 file1.txt is used to see what is on the command line don t process by hand, use Getopt package # command line print "command line parameters\n"; $count = 0; foreach $param ) { print "parameter $count: $ARGV[$count]\n"; $count++; Biol Practical Biocomputing 33

34 Special Variables Command line $ARGV tells the current file when reading from <STDIN> ( <> ) # files on command line #initialize filename to be blank, number of files to be zero $file = ""; $file_count = 0; while ( <> ) { if ( $ARGV ne $file ) { # if the current file is different than the one in the last line # print out the file name $file_count++; $file = $ARGV; print "file $file_count:$file:\n"; pro:~/perlcourse(95)% perl argv.pl split2.txt split.txt file 1:split2.txt: file 2:split.txt: Biol Practical Biocomputing 34

35 Special Variables What is this process? # Echo the name and ID of this process $script = $0; $id = $$; print "script = $script ID = $id\n"; What is my environment? Environment is a set of symbols that are known to the operating system # Echo the process environment foreach $symbol ( keys %ENV ) { print "$symbol => $ENV{ $symbol \n"; Biol Practical Biocomputing 35

36 Special Variables Use English qw( -no_match_vars ); Avoids problems with regexes Provides English equivalents for special variables See for details, e.g., $_ == $ARG $ == $LIST_SEPARATOR $$ == $PROCESS_ID $0 == $PROGRAM_NAME $; == $SUBSCRIPT_SEPARATOR Biol Practical Biocomputing 36

37 Intermediate Perl Sorting The sort function can use any function we provide to sort allows other sorts than alphabetical allows multiple key sorts Custom sorting is performed by including a function inside { between "sort" and the list being sorted, e.g., ( sort { $a cmp ) $a and $b are special variables that refer to two objects in the list being sorted (defined only within sort) You must provide a function that can be used to compare the things be sorted as pairs of objects <=> (numeric) and cmp (alphabetic) are two such functions comparison function returns -1 for $a < $b $a lt $b 0 for $a == $b $a eq $b +1 for $a > $b $a gt $b Biol Practical Biocomputing 37

38 Intermediate Perl Sorting the sort function works on a list $a and $b are predefined local variables that represent any two items in the list being sorted The sort function tells how to compare two items in the list ($a and $b) and decide which goes first sort { $a <=> $b ( 0, 12, 7,14 ); sort { $b <=> $a ( 0, 12, 7, 14 ); sort { $age[$a] <=> $age[$b] ( 0..9 ); # sorts by number small to large # sorts by number large to small # sorts by values Biol Practical Biocomputing 38

39 Intermediate Perl Sorting Bubble Sort (not a very efficient sort, O(n 2 ) ) $swapped = 1; while ( $swapped ) { $swapped = 0; foreach $i ( 1.. $#a ) { if ( $a[$i-1] > $a[$i] ) { swap( $a[$i-1], $a[$i] ); $swapped = 1; for a = qw( ) # exchange position $i-1 and $i in list Biol Practical Biocomputing 39

40 Intermediate Perl Sorting Perl uses a more efficient sort called a quicksort (or qsort) which uses O(n log n) time (bubble sort is O(n 2 ) = ( 47, 34, 8, 23, 1 = sort { $result=$a cmp $b; print "$a\t$b\t$result; $a > $b $a > $b $a > $b $a < $b no change $a < $b no change $a > $b Biol Practical Biocomputing 40

41 Intermediate Perl Sorting Sorting the indices instead of the array Useful with parallel = ( 47, 34, 8, 23, 1 = ( 0.. $#a ); $a[$index] $swapped = 1; while ( $swapped ) { $swapped = 0; foreach $i ( 1.. $#index ) { if ( $a[$index[$i-1]] > $a[$index[$i]] ) { swap( $index[$i-1], $index[$i] ); # exchange index $i-1 and $i $swapped = 1; if ( $swapped ) { print "@a\t@index\n"; Biol Practical Biocomputing 41

42 Intermediate Perl Sorting Sorting in the opposite order foreach $i ( ) { foreach $i ( sort { $a cmp ) { foreach $i ( sort { $b cmp ) { # default, means the same # opposite = qw( jane jeff, william, kejie, aditi ); print " = print " = sort { $b cmp print " reverse original list: jane jeff william kejie aditi default sort: aditi jane jeff kejie william reverse sort: william kejie jeff jane aditi Biol Practical Biocomputing 42

43 Intermediate Perl Sorting Sorting in numerical rather than alphabetical = ( 47, 34, 8, 23, 1 = sort { $a cmp # same as default = sort { $a <=> print = sort { $b <=> print "\nnumerically alphabetically: numerically ascending: numerically descending: Biol Practical Biocomputing 43

44 Intermediate Perl Sorting Sorting hashes %height = ( jane => 165, jeff => 188, william => 177, aditi => 160 ); # sort by name print "\nby name\n"; foreach $person ( sort keys %height ) { print "$person: $height{ $person \n"; # sort by height print "\nby height\n"; by name aditi: 160 jane: 165 jeff: 188 william: 177 by height aditi: 160 jane: 165 william: 177 jeff: 188 foreach $person ( sort { $height{$a <=> $height{$b keys %height ) { print "$person: $height{ $person \n"; Biol Practical Biocomputing 44

45 Intermediate Perl Sorting Multiple key sorting sorting first by one thing, then another, for instance first by age, then by weight Use (or) to separate tests, the second is applied only if the first is equal %age = ( albert => 18, annette => 27, armand => 21, alice => 18, anwar => 42 ); %wgt = ( albert => 185, annette => 275, armand => 121, alice => 108, anwar => 108 ); first test: age alice albert armand annette anwar second test: weight foreach $name (sort { $age{$a <=> $age{$b $wgt{$a <=> $wgt{$b keys %age ) { print "$name $age{$name $wgt{$name\n"; Biol Practical Biocomputing 45

46 Intermediate Perl Sorting Multiple keys using a sort function %age = ( albert => 18, annette => 27, armand => 21, alice => 18, anwar => 42 ); %wgt = ( albert => 185, annette => 275, armand => 121, alice => 108, anwar => 108 ); alice albert armand annette anwar sub byageandwgt { $age{$a <=> $age{$b $wgt{$a <=> $wgt{$b foreach $name (sort byageandwgt keys %age ) { print "$name $age{$name $wgt{$name\n"; Biol Practical Biocomputing 46

47 Intermediate Perl Sorting Rolling your own sort function Function must return -1 if $a < $b 0 if $a == $b 1 if $a > $b # uses hash from previous example as data # sort function: sorts annette to the first position, other # names alphabetically sub annettefirst { if ( $a eq 'annette' ) {return -1; elsif ( $b eq 'annette' ) { return 1; else { return $a cmp $b; foreach $name (sort annettefirst keys %age ) { annette albert alice anwar armand print "$name $age{$name $wgt{$name\n"; Biol Practical Biocomputing 47

48 Intermediate Perl Sorting Rolling your own sort function # uses hash from previous example as data # sort function: sorts by name backwards sub backwards { my $a_backwards = reverse( $a ); my $b_backwards = reverse( $b ); return $a_backwards cmp $b_backwards armand alice annette anwar albert foreach $name (sort backwards keys %age ) { print "$name $age{$name $wgt{$name\n"; Biol Practical Biocomputing 48

49 Intermediate Perl Sorting Example Sort the following sequences by length and %GC aay ACGATGAGCTAGCATTCGATGCTACATTGTGTCCA caa TATATATATATATTATTTTTTATTATATTAGCGCGTTTTT dbd TTAGCGTACTGCTTGACTGACTGTATTGTACATG eef TGTATTCGCGCCATATCCGATTGCGACTAGCTACCC rpo CACATCATCGAGGGGCTATCGATGGCTGATGCGCA 5 sequences converted to hash form Length and % GC calculated for 5 sequences gene length % GC dbd TTAGCGTACTGCTTGACTGACTGTATTGTACATG aay ACGATGAGCTAGCATTCGATGCTACATTGTGTCCA rpo CACATCATCGAGGGGCTATCGATGGCTGATGCGCA eef TGTATTCGCGCCATATCCGATTGCGACTAGCTACCC caa TATATATATATATTATTTTTTATTATATTAGCGCGTTTTT Biol Practical Biocomputing 49