Bioinformatics in next generation sequencing projects

Size: px
Start display at page:

Download "Bioinformatics in next generation sequencing projects"

Transcription

1 Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011

2 Once sequenced the problem becomes computational Computational analyses is the bottleneck Rapid improvement in sequencing Still need for customized analysis for most projects

3 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping (Assembly) Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses

4 Preliminary Analyses Sequences and Real Time Analysis Quality scores Raw Image (TB) Text File (GB) Platform-specific analysis using the vendors programs

5 Sequenced reads Fasta file: >EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC Read identifier Fastq file: - EAS269:1:120:1786:18#0/1 GAACTCTGCCTTTTTCAGTGATGAGGAAAGGAGTTCTCTCTGGTCCCCAG +HWI - EAS269:1:120:1786:18#0/1 aaab^_u_aa [ U [ _Z ] a `WU_^X `GT^_ \ TM^ ^ \ \ Z \ YQVVXUBBBB Quality scores csfasta file >1_39_146_F3 T >1_39_194_F3 T SOLiD, QV file >1_39_146_F >1_39_194_F

6 Phred Quality Score, Q Each base call has an estimate of the probability of being wrong (error probability, p) Q = -10 * log 10 (p) Phred Quality Score Probability of incorrect base call Base call accuracy 10 1 in % 20 1 in % 30 1 in % 40 1 in % 50 1 in %

7 FastQ encodings Sanger FastQ: Phred score from 0-93 using the ASCII characters Solexa (+1.3 pipeline): Phred score from 0-62 using the ASCII characters 0-62 Solexa (older pipelines): Solexa score using ASCII characters -5 to 62 }~ S - Sanger Phred+33, 41 values (0, 40) I - Illumina 1.3 Phred+64, 41 values (0, 40) X - Solexa Solexa+64, 68 values (-5, 62)

8 Fastq quality control (FastQC) Video tutorial:

9 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping Assembly Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses

10 Short Read Assembly Velvet and SOAPdenovo de novo genomic assembler specially designed for short read sequencing technologies Nature 2009

11 Human Genome Assembly UCSC Genome Browser

12 Mapping of reads Task: Map millions of short sequences ( nt) onto a genome (3 000 Mbp ) or transcriptome Computationally feasible Mismatches (sequencing errors and SNPs) Unique / Repetitive matches Indels (Normal variation, CNVs) Large rearrangements (translocations) BLAST, BLAT tools not designed for these tasks

13 MAQ bowtie

14 Commonly used programs Program Approach Comments Bowtie Burrow-Wheeler Transformation (BWT) Illumina, (SOLiD), fast MAQ Spaced Seed Indexing Illumina, (SOLiD), SNPs BWA Novoalign Burrow-Wheeler Transformation (BWT) Needleman-Wunch Alignment Illumina, (SOLiD), indels Illumina, indels, slower, free (single proc mode) ZOOM Designed spaced seeds Illumina, fast, indels, not free Mappers from Illumina (ELAND) and SOLiD (bioscope/mapreads)

15 Paired reads mapping can be more accurate 2 mismatches Exact match Bowtie reports the best alignment it comes across, but this isn t always the right one. To do a better job, we want paired end reads

16 Storing mapped Alignments Formats for storing alignments should include: genomic coordinates mismatches, insertion, deletions etc. quality information

17 Samtools Sequence Alignment Map (SAM) Generic Alignment format Supports long and short reads Human readable, flexible and compact Emerging standard Li H.*, Handsaker B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. BioinformaScs, 25, [PMID: ] h"p://samtools.sourceforge.net/

18 SAM Example Bit field, where 16 means reverse strand Alignment structure. Here: 22 aligned bases, then 731 bases intron, then 28 aligned bases Start position HWI - EAS269:1:114:1242:1582#0 16 chr Y M731N28M * 0 0 ATTTCGACCATGATCATCGAACCTTCCCCTGGATCCACTTCCACGATCAC #9 ;; -7 +2@4 : 2=20-14= : ><?< ;; : BB? : 4<BB?ABBBBABCBBBBC=BB NM: i : 0 XS: A:-

19 CIGAR Format M, match/ mismatch I, insertion D, deletion S, softclip Ref: GCATTCAGATGCAGTACGC Read: cctcag--gcagtagtg Pos: 5 CIGAR: 2S4M3D6M3S...

20 Samtools for SAM/BAM files Library and software package (C, Java) Creating, sorting, indexing SAM & BAM Visualizing alignments in command SNP calling Short indel detection BAM (Binary representation of SAM) ~25% file size reduction

21 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping Assembly Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses

22 Visualization Integrated Genome Viewer (Broad Inst.) Custom tracks at UCSC Genome Browser

23 Visualization

24 Integrated Genome Viewer Imports many mentioned formats (SAM, BAM, BED etc) Excellent for visualization of RNA-Sequencing or ChIP-sequencing data Can also download/visualize data from public or private servers

25 UCSC Genome Browser Recently introduced new formats for efficient viewing of large data sets: - BedGraph - BigWig Add as custom tracks (slower)

26 Peak characteristics differ with signal

27 Peak characteristics differ with signal H3K4me3: Sharp promoter peaks H3K36me3: Broad transcription elongation signal

28 Important file formats Sequences: FastQ Aligned reads: SAM/BAM Genome annotations: Bed, Gff Coverage: Wig, (Tdf)

29 BED format chrom - The name of the chromosome (e.g. chr3, chry, chr2_random) or scaffold (e.g. scaffold10671). chromstart - The starsng posison of the feature in the chromosome or scaffold. The first base in a chromosome is numbered 0. chromend - The ending posison of the feature in the chromosome or scaffold. The chromend base is not included in the display of the feature. For example, the first 100 bases of a chromosome are defined as chromstart=0, chromend=100, and span the bases numbered track name=pairedreads description="clone Paired Reads" usescore=1 chr

30 BED continued track name=pairedreads description="clone Paired Reads" usescore=1 chr cloneb ,399, 0,3601 strand - Defines the strand - either '+' or '-'. thickstart - The starting position at which the feature is drawn thickly (for example, the start codon in gene displays). thickend - The ending position at which the feature is drawn thickly (for example, the stop codon in gene displays). itemrgb - An RGB value of the form R,G,B (e.g. 255,0,0). If the track line itemrgb attribute is set to "On", this RBG value will determine the display color of the data contained in this BED line. NOTE: It is recommended that a simple color scheme (eight colors or less) be used with this attribute to avoid overwhelming the color resources of the Genome Browser and your Internet browser. blockcount - The number of blocks (exons) in the BED line. blocksizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockcount. blockstarts - A comma-separated list of block starts. All of the blockstart positions should be calculated relative to chromstart. The number of items in this list should correspond to blockcount.

31 WIG format Wiggle format (WIG) allows the display of continuous-valued data in a track format Variable step variablestep chrom=chr is equivalent to: variablestep chrom=chr2 span= Fixed step fixedstep chrom=chr3 start= step=

32 Data Repositories Short Read Archive (fastq) [discontinued!] European Nucleotide Archive Gene Expression Omnibus (bed, wig, fastq)

33 SEQAnswers, an active forum for discussions on next-generation sequencing methods and bioinformatics

34

35 Visual inspection is critical

36 RNA-Seq analysis

Advanced UCSC Browser Functions

Advanced UCSC Browser Functions Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Genome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14

Genome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14 2014 - BMMB 852D: Applied Bioinforma;cs Week 12, Lecture 24 István Albert Biochemistry and Molecular Biology and Bioinforma;cs Consul;ng Center Penn State Genome representa;on concepts At the simplest

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

A short Introduction to UCSC Genome Browser

A short Introduction to UCSC Genome Browser A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems. Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Genetics 211 Genomics Winter 2014 Problem Set 4

Genetics 211 Genomics Winter 2014 Problem Set 4 Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Easy visualization of the read coverage using the CoverageView package

Easy visualization of the read coverage using the CoverageView package Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This

More information

From the Schnable Lab:

From the Schnable Lab: From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

The UCSC Gene Sorter, Table Browser & Custom Tracks

The UCSC Gene Sorter, Table Browser & Custom Tracks The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Identiyfing splice junctions from RNA-Seq data

Identiyfing splice junctions from RNA-Seq data Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Genomic Analysis with Genome Browsers.

Genomic Analysis with Genome Browsers. Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

From genomic regions to biology

From genomic regions to biology Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

Bioinformatics for High-throughput Sequencing

Bioinformatics for High-throughput Sequencing Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput

More information

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Mapping reads to a reference genome

Mapping reads to a reference genome Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture

More information

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

The BEDTools manual. Aaron R. Quinlan and Ira M. Hall University of Virginia. Contact:

The BEDTools manual. Aaron R. Quinlan and Ira M. Hall University of Virginia. Contact: The BEDTools manual Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 6 1.1 BACKGROUND...6 1.2 SUMMARY OF AVAILABLE TOOLS...7 1.3 FUNDAMENTAL CONCEPTS

More information

The BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia

The BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia The BEDTools manual Last updated: 21-September-2010 Current as of BEDTools version 2.10.0 Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 7 1.1 BACKGROUND...7

More information

RCAC. Job files Example: Running seqyclean (a module)

RCAC. Job files Example: Running seqyclean (a module) RCAC Job files Why? When you log into an RCAC server you are using a special server designed for multiple users. This is called a frontend node ( or sometimes a head node). There are (I think) three front

More information

Read Naming Format Specification

Read Naming Format Specification Read Naming Format Specification Karel Břinda Valentina Boeva Gregory Kucherov Version 0.1.3 (4 August 2015) Abstract This document provides a standard for naming simulated Next-Generation Sequencing (Ngs)

More information

seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA

seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA David Mosen-Ansorena 1 October 30, 2017 Contents 1 Genome Analysis Platform CIC biogune and CIBERehd dmosen.gn@cicbiogune.es

More information

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

BIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data

BIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data BIOINFORMATICS Vol. 00 no. 00 2010 Pages 1 6 Savant: Genome Browser for High Throughput Sequencing Data Marc Fiume 1,, Vanessa Williams 1, and Michael Brudno 1,2 1 Department of Computer Science, University

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1

More information

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular

More information

User's guide to ChIP-Seq applications: command-line usage and option summary

User's guide to ChIP-Seq applications: command-line usage and option summary User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

Tiling Assembly for Annotation-independent Novel Gene Discovery

Tiling Assembly for Annotation-independent Novel Gene Discovery Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics

More information

Using Pipeline Output Data for Whole Genome Alignment

Using Pipeline Output Data for Whole Genome Alignment Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Tutorial 1: Exploring the UCSC Genome Browser

Tutorial 1: Exploring the UCSC Genome Browser Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.

More information

Scalable RNA Sequencing on Clusters of Multicore Processors

Scalable RNA Sequencing on Clusters of Multicore Processors JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA

More information

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

Genome Browsers - The UCSC Genome Browser

Genome Browsers - The UCSC Genome Browser Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Analysis of high-throughput sequencing data. Simon Anders EBI

Analysis of high-throughput sequencing data. Simon Anders EBI Analysis of high-throughput sequencing data Simon Anders EBI Outline Overview on high-throughput sequencing (HTS) technologies, focusing on Solexa's GenomAnalyzer as example Software requirements to works

More information

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

v0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting

v0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.

More information

RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual

RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual July 02, 2015 1 Index 1. System requirement and how to download RASER source code...3 2. Installation...3 3. Making index files...3

More information

Long Read RNA-seq Mapper

Long Read RNA-seq Mapper UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...

More information

merantk Version 1.1.1a

merantk Version 1.1.1a DIVISION OF BIOINFORMATICS - INNSBRUCK MEDICAL UNIVERSITY merantk Version 1.1.1a User manual Dietmar Rieder 1/12/2016 Page 1 Contents 1. Introduction... 3 1.1. Purpose of this document... 3 1.2. System

More information

Documentation of S MART

Documentation of S MART Documentation of S MART Matthias Zytnicki March 14, 2012 Contents 1 Introduction 3 2 Installation and requirements 3 2.1 For Windows............................. 3 2.2 For Mac................................

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

RNASeq2017 Course Salerno, September 27-29, 2017

RNASeq2017 Course Salerno, September 27-29, 2017 RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials

More information

Accessible, Transparent and Reproducible Analysis with Galaxy

Accessible, Transparent and Reproducible Analysis with Galaxy Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,

More information

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP) Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload

More information

- 1 - Web page:

- 1 - Web page: J-Circos Manual 2014-11-10 J-Circos: A Java Graphic User Interface for Circos Plot Jiyuan An 1, John Lai 1, Atul Sajjanhar 2, Jyotsna Batra 1,Chenwei Wang 1 and Colleen C Nelson 1 1 Australian Prostate

More information