Information Retrieval and Organisation

Size: px
Start display at page:

Download "Information Retrieval and Organisation"

Transcription

1 Informtion Retrievl nd Orgnistion Suffix Trees dpted from Dell Zhng Birkeck, University of London

2 Trie A tree representing set of strings { } eef d fe fg c f e e c d f e c g

3 Trie Assume no string is prefix of nother 1) Ech edge is leled y letter. c 2) No two edges outgoing from the sme node re leled the sme. 3) Ech string corresponds to lef. f e e d f e g

4 Compressed Trie Compress unry nodes, lel edges y strings c c e e d f eef d f f e g e g

5 Suffix Tree Given string s, suffix tree of s is compressed trie of ll suffixes of s. To mke these suffixes prefix-free we dd specil chrcter, sy, t the end of s.

6 Suffix Tree For exmple, let s =, suffix tree of s is compressed trie of ll suffixes of. { } Note tht suffix tree hs O(n) nodes n = s. Why?

7 Suffix Tree Construction The trivil lgorithm Put the lrgest suffix in

8 Put the suffix in

9 Put the suffix in

10 Put the suffix in

11 Put the suffix in

12 We will lso lel ech lef with the strting point of the corresponding suffix

13 Suffix Tree Construction The trivil lgorithm tkes O(n 2 ) time. It is possile to uild suffix tree in O(n) time using Ukkonen s lgorithm. But, how come? Does it tke O(n) spce? To use only O(n) spce, encode the edge-lels s (eginning-position, end-position).

14 Consider the string

15 Consider the string (6,12)

16 Consider the string (0,0) (6,12) (1,1) (6,12) (2,2) (6,12) (3,3) (6,12) (4,4) (6,12) (5,12) (12,12) (6,6) (12,12) (7,7) (12,12) (8,8) (12,12) (9,9) (12,12) (10,10) (12,12) (11,12)

17 Suffix Tree Applictions Wht Cn We Do with It? Exct String Mtching Exct Set Mtching The Sustring Prolem for Dtse of Ptterns Longest Common Sustring of Two Strings Recognising DNA Contmintion Common Sustring of More Thn Two Strings

18 Exct String Mtching Given text T ( T = n), pre-process it such tht when pttern P ( P = m) rrives you cn quickly decide when it occurs in T. We my lso wnt to find ll occurrences of P in T.

19 Exct String Mtching In pre-processing, we just uild suffix tree in O(n) time

20 Exct String Mtching Given pttern P = we trverse the tree ccording to the pttern. If we do not get stuck trversing the pttern then the pttern occurs in the text, otherwise it does not. Ech lef in the sutree elow the node we rech corresponds to n occurrence. By trversing this sutree we get ll k occurrences in O(n+k) time.

21 Exct String Mtching How to mtch pttern (query) ginst dtse of strings (documents)?

22 Generlized Suffix Tree Given set of strings S, the generlized suffix tree of S is compressed trie of ll suffixes of ech s S. To mke these suffixes prefix-free we dd specil chr, sy, t the end of s. To ssocite ech suffix with unique string in S, dd different specil chr to ech s. Ech lef node needs to e lelled y the document id together with the suffix position.

23 Generlized Suffix Tree For exmple, Let s 1 = nd s 2 =, here is generlized suffix tree for s 1 nd s 2. { } # # # # 2 # 1 # 0 1 # 3 #

24 Longest Common Sustring Given two strings s 1 nd s 2, we uild their generlized suffix tree. Every node with lef descendnt from string s 1 nd lef descendnt from string s 2 represents mximl common sustring nd vice vers. Find such node with lrgest string depth.

25 Lowest Common Ancestor A lot more cn e gined from the suffix tree, if we pre-process it so tht we cn nswer LCA queries on it in constnt time.

26 Lowest Common Ancestor Why? The LCA of two leves represents the longest common prefix (LCP) of these 2 suffixes # # 1 # 0 1 # 3 2 0

27 Finding Mximl Plindromes A plindrome: cc, cc, To find ll plindromes in string s (of length m), we uild generlized suffix tree for the string s nd the reversed string s r. The plindrome with centre etween i-1 nd i is the LCP of the suffix t position i of s nd the suffix t position m-i of s r.

28 Finding Mximl Plindromes For exmple, consider the string c. Prepre generlized suffix tree for s = c nd s r = c# For every i find the LCA of the suffix i of s nd the suffix m-i of s r. All plindromes cn e identified in liner time.

29 Let s = c then s r = c# 5 c #

30 Suffix Tree Drwcks It is O(n) ut the constnt is quite ig. It consume lot of spce. Notice tht if we indeed wnt to trverse n edge in O(1) time then we need n rry (of pointers) of size Σ in ech node, where Σ is the lphet.

31 Suffix Arry It is much simpler nd esier to implement. Compred with suffix trees, we lose some functionlity, ut we sve spce.

32 Suffix Arry For exmple, let s = Sort the suffixes lexicogrphiclly:,,, The suffix rry gives the indices of the suffixes in sorted order

33 Suffix Arry Construction The trivil lgorithm Quicksort The liner time lgorithm Build suffix tree in O(n) time first, nd then trverse the tree in in-order, lexicogrphiclly picking edges outgoing from ech node, nd fill the suffix rry. It cn lso e uilt in O(n) time directly.

34 Exct String Mtching How do we serch for pttern P in the text T, using the suffix rry of T? If P occurs in T, then ll its occurrences re consecutive in the suffix rry. So we cn do two inry serches on the suffix rry: the first serch loctes the strting position of the intervl, nd the second one determines the end position. It tkes O(m log(n)) time, s single suffix comprison needs to compre up to m chrcters.

35 Exct String Mtching It is lso possile to do it in O(m+log(n)) with n dditionl rry of LCP. Mner & Myers (1990)

36 T = mississippi P = iss L M R i ippi issippi ississippi mississippi pi ppi sippi sisippi ssippi ssissippi

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Lecture 10: Suffix Trees

Lecture 10: Suffix Trees Computtionl Genomics Prof. Ron Shmir, Prof. Him Wolfson, Dr. Irit Gt-Viks School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' רון שמיר, פרופ' חיים וולפסון, דר' עירית גת-ויקס ביה"ס למדעי

More information

Suffix trees. December Computational Genomics

Suffix trees. December Computational Genomics Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

Position Heaps: A Simple and Dynamic Text Indexing Data Structure

Position Heaps: A Simple and Dynamic Text Indexing Data Structure Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,

More information

CSE 549: Suffix Tries & Suffix Trees. All slides in this lecture not marked with * of Ben Langmead.

CSE 549: Suffix Tries & Suffix Trees. All slides in this lecture not marked with * of Ben Langmead. CSE 549: Suffix Tries & Suffix Trees All slides in this lecture not mrked with * of Ben Lngmed. KMP is gret, ut T = m P = n (note: m,n re opposite from previous lecture) Without preprocessing (KMP) Given

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

Suffix Tree and Array

Suffix Tree and Array Suffix Tree and rray 1 Things To Study So far we learned how to find approximate matches the alignments. nd they are difficult. Finding exact matches are much easier. Suffix tree and array are two data

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Algorithms in bioinformatics (CSI 5126) 1

Algorithms in bioinformatics (CSI 5126) 1 Algorithms in bioinformtics (CSI 5126) 1 Mrcel Turcotte (turcotte@site.uottw.c) School of Informtion Technology nd Engineering University of Ottw Cnd October 2, 2009 1 Plese don t print these lecture notes

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

I/O Efficient Dynamic Data Structures for Longest Prefix Queries

I/O Efficient Dynamic Data Structures for Longest Prefix Queries I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

Suffix Trees. Martin Farach-Colton Rutgers University & Tokutek, Inc

Suffix Trees. Martin Farach-Colton Rutgers University & Tokutek, Inc Suffix Trees Martin Farach-Colton Rutgers University & Tokutek, Inc What s in this talk? What s a suffix tree? What can you do with them? How do you build them? A challenge problem What s in this talk?

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

The dictionary model allows several consecutive symbols, called phrases

The dictionary model allows several consecutive symbols, called phrases A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion

More information

Shortest Unique Substring Query Revisited

Shortest Unique Substring Query Revisited Shortest Unique Substring Query Revisited Atalay Mert İleri Bilkent University, Turkey M. Oğuzhan Külekci Istanbul Medipol University, Turkey Bojian Xu Eastern Washington University, USA June 18, 2014

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Efficient implementation of lazy suffix trees

Efficient implementation of lazy suffix trees SOFTWARE PRACTICE AND EXPERIENCE Softw. Prct. Exper. 2003; 33:1035 1049 (DOI: 10.1002/spe.535) Efficient implementtion of lzy suffix trees R. Giegerich 1,S.Kurtz 2 nd J. Stoye 1,, 1 Fculty of Technology,

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

Lecture T1: Pattern Matching

Lecture T1: Pattern Matching Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

String Searching. String Search. Applications. Brute Force: Typical Case

String Searching. String Search. Applications. Brute Force: Typical Case String Serch String Serching String serch. Given pttern string p, find first mtch in text t. Model. Cn't fford to preprocess the text. Prmeters. N = length of text, M = length of pttern. typiclly N >>

More information

Indexing: Part IV. Announcements (February 17) Keyword search. CPS 216 Advanced Database Systems

Indexing: Part IV. Announcements (February 17) Keyword search. CPS 216 Advanced Database Systems Indexing: Part IV CPS 216 Advanced Database Systems Announcements (February 17) 2 Homework #2 due in two weeks Reading assignments for this and next week The query processing survey by Graefe Due next

More information

The Fundamental Theorem of Calculus

The Fundamental Theorem of Calculus MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is

More information

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure , Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured

More information

Suffix Arrays on Words

Suffix Arrays on Words Suffix Arrys on Words Polo Ferrgin nd Johnnes Fischer Diprtimento di Informtic, University of Pis ferrgin@di.unipi.it Institut für Informtik, Ludwig-Mximilins-Universität München Johnnes.Fischer@io.ifi.lmu.de

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy /9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

Efficient K-NN Search in Polyphonic Music Databases Using a Lower Bounding Mechanism

Efficient K-NN Search in Polyphonic Music Databases Using a Lower Bounding Mechanism Efficient K-NN Serch in Polyphonic Music Dtses Using Lower Bounding Mechnism Ning-Hn Liu Deprtment of Computer Science Ntionl Tsing Hu University Hsinchu,Tiwn 300, R.O.C 886-3-575679 nhliou@yhoo.com.tw

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org

More information

Indexing Web pages. Web Search: Indexing Web Pages. Indexing the link structure. checkpoint URL s. Connectivity Server: Node table

Indexing Web pages. Web Search: Indexing Web Pages. Indexing the link structure. checkpoint URL s. Connectivity Server: Node table Indexing Web pages Web Search: Indexing Web Pages CPS 296.1 Topics in Database Systems Indexing the link structure AltaVista Connectivity Server case study Bharat et al., The Fast Access to Linkage Information

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

The Complexity of Nonrepetitive Coloring

The Complexity of Nonrepetitive Coloring The Complexity of Nonrepetitive Coloring Dániel Mrx Institut für Informtik Humoldt-Universitt zu Berlin dmrx@informtik.hu-erlin.de Mrcus Schefer Deprtment of Computer Science DePul University mschefer@cs.depul.edu

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information