Intermediate Information Structures
|
|
- Owen Jenkins
- 6 years ago
- Views:
Transcription
1 CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC Todd Trengen UMD upd
2 Preprocessing Strings We will look t Suffix Tries Suffix Trees Suffix Arrys Borrows-Wheeler trnsform Typicl setting: A long, known, nd fixed text string (like genome) nd mny unknown, chnging query strings. Allowed to preprocess the text string once in nticiption of the future unknown queries. Dt structures will e useful in other settings s well.
3 Preprocessing Strings For exmple, text T might e genomic sequences nd the queries might e short words over n lphet,c,g,t descriing trnscription fctor inding sites.
4 Suffix Tries A trie, pronounced try, is tree tht exploits some structure in the keys - e.g. if the keys re strings, inry serch tree would compre the entire strings, ut trie would look t their individul chrcters - Suffix trie re spce-efficient dt structure to store string tht llows mny kinds of queries to e nswered quickly. - Suffix trees re hugely importnt for serching lrge sequences like genomes. The sis for tool clled MUMMer (developed y UMD fculty).
5 Suffix Tries Let the string e y nd the trie S(y). All leves of S(y) re leled y the suffixes of y. Edges of S(y) re leled y letters of the lphet used for S(y) with n dded sentinel chrcter, sy, which is not prt of the lphet. Internl nodes re rnching nodes if they hve t lest two children. Edges outgoing from rnching nodes re leled y different letters.
6 Suffix Tries The role of suffixes nd the sentinel Consider the text c over the lphet,,c. It hs the following suffixes: c, c, c, nd. The sentinel : In the following, we wnt to ensure tht no suffix is prefix of ny other. To do so, we ppend specil chrcter not in the lphet to the end of the text. Now, consider the text c. It hs the following suffixes: c, c, c,, nd nd now is not prefix of c.
7 Suffix Tries Queries re prefixes of suffixes: To determine whether given query q is contined in the text, we could simply check whether q is the prefix of one of the suffixes.
8 Founding Editor-in- Chief of The IEEE/ ACM Trnsctions of Computtionl Biology nd Bioinformtics 8
9 Suffixes of chrcter string s = s is the string over the lphet (,) with termintion symol lso known s sentinel,. The suffixes of s re: i.e. the trivil suffix i.e. the sentinel suffix.
10 s = Suffix Tries SufTrie(s) = suffix trie representing string s. Edges of the suffix trie re leled with letters from the lphet (sy {,}). Every pth from the root to solid node represents suffix of s. Every suffix of s is represented y some pth from the root to solid node. Why re ll the solid nodes leves? How mny leves will there e?
11 Processing Strings Using Suffix Tries Given suffix trie T, nd string q, how cn we: determine whether q is sustring of T? check whether q is suffix of T? count how mny times q ppers in T? find the longest repet in T? find the longest common sustring of T nd q? Min ide: every sustring of s is prefix of some suffix of s.
12 s = Serching Suffix Tries Is sustring of s? Follow the pth given y the query string. After we ve uilt the suffix trees, queries cn e nswered in time: O( query ) regrdless of the text size.
13 Suffix Links in Suffix Trie To understnd suffix links first recll tht there re three kinds of nodes in suffix tree: The root -- Internl nodes -- Lef nodes In the grph elow, which is the suffix tree for ABABABC, the yellow circle is the root, the grey, lue nd green ones re internl nodes, nd the smll lck ones re leves.
14 Suffix Links in Suffix Trie There re two importnt things to notice: Internl nodes hve either one or more thn one outgoing edges. Tht is, internl nodes with more thn one outgoing edges mrk those prts of the tree where rnching occurs. Brnching occurs wherever repeted string is involved, nd only there. For ny internl node X, the string leding from the root to X must hve occurred in the input string t lest s mny times s there re outgoing edges from X. Exmple: The string leding to the lue node is ABAB. Indeed, this string ppers twice in the input string: At level 0 nd t level 2. And tht is why the lue node exists.
15 Suffix Links in Suffix Trie If the string s leding up to some internl node X is longer thn 1 chrcter, the sme string minus the first chrcter (cll this s-1) must e in the tree, too (it's suffix tree, fter ll, so the suffix of ny of its strings must e in the tree, too). Exmple: Let s=abab, the string leding to the lue node. Then fter removing the first chrcter, s-1 is BAB. And indeed tht string is found in the tree, too. It leds to green node (lelled This node ). This node
16 Suffix Links in Suffix Trie If some string s leds to n internl node, its shortened version s-1 must led to n internl node (cll it X-1) s well. Why? Becuse s must pper t lest twice in the input string, so s-1 must pper t lest s mny times (ecuse it is prt of s: wherever s ppers, s-1 must pper, too). But if s-1 ppers multiple times in the input string, then there must e n internl node for it. In ny such sitution, specil link connecting X to X-1 is suffix link. This node
17 Suffix Links in Suffix Trie Every internl node X with more thn 1 outlinks must hve suffix link to exctly one other internl node. This is the sme suffix tree s efore; the dotted lines indicte the suffix links. If you strt t the lue node nd follow the suffix links from there (from lue, to green, to first pink, to second pink), nd look t the strings leding from the root to ech node, you will see this: ABAB -> BAB -> AB -> B (lue) (green) (pink1) (pink2) This is why they re clled suffix links (the entire sequence is clled suffix chin).
18 s = Serching Suffix Tries Is sustring of s? Follow the pth given y the query string. After we ve uilt the suffix trees, queries cn e nswered in time: O( query ) regrdless of the text size.
19 Check whether q is sustring of T: Applictions of Suffix Tries (1) Check whether q is suffix of T: Count # of occurrences of q in T: Find the longest repet in T: Find the lexicogrphiclly (lpheticlly) first suffix:
20 Applictions of Suffix Tries (1) Check whether q is sustring of T: Follow the pth for q strting from the root. If you exhust the query string, then q is in T. Check whether q is suffix of T: Count # of occurrences of q in T: Find the longest repet in T: Find the lexicogrphiclly (lpheticlly) first suffix:
21 Applictions of Suffix Tries (1) Check whether q is sustring of T: Follow the pth for q strting from the root. If you exhust the query string, then q is in T. Check whether q is suffix of T: Follow the pth for q strting from the root. If you end t lef t the end of q, then q is suffix of T Count # of occurrences of q in T: Find the longest repet in T: Find the lexicogrphiclly (lpheticlly) first suffix:
22 Applictions of Suffix Tries (1) Check whether q is sustring of T: Follow the pth for q strting from the root. If you exhust the query string, then q is in T. Check whether q is suffix of T: Follow the pth for q strting from the root. If you end t lef t the end of q, then q is suffix of T Count # of occurrences of q in T: Follow the pth for q strting from the root. The numer of leves under the node you end up in is the numer of occurrences of q. Find the longest repet in T: Find the lexicogrphiclly (lpheticlly) first suffix:
23 Applictions of Suffix Tries (1) Check whether q is sustring of T: Follow the pth for q strting from the root. If you exhust the query string, then q is in T. Check whether q is suffix of T: Follow the pth for q strting from the root. If you end t lef t the end of q, then q is suffix of T Count # of occurrences of q in T: Follow the pth for q strting from the root. The numer of leves under the node you end up in is the numer of occurrences of q. Find the longest repet in T: Find the deepest node tht hs t lest 2 leves under it. Find the lexicogrphiclly (lpheticlly) first suffix:
24 Applictions of Suffix Tries (1) Check whether q is sustring of T: Follow the pth for q strting from the root. If you exhust the query string, then q is in T. Check whether q is suffix of T: Follow the pth for q strting from the root. If you end t lef t the end of q, then q is suffix of T Count # of occurrences of q in T: Follow the pth for q strting from the root. The numer of leves under the node you end up in is the numer of occurrences of q. Find the longest repet in T: Find the deepest node tht hs t lest 2 leves under it. Find the lexicogrphiclly (lpheticlly) first suffix: Strt t the root, nd follow the edge leled with the lexicogrphiclly (lpheticlly) smllest letter.
25 s = Suffix Links Suffix links connect node representing xα to node representing α. Most importnt suffix links re the ones connecting suffixes of the full string (shown t right). But every node hs suffix link. Why? How do we know node representing α exists for every node representing xα?
26 s = Suffix Tries A node represents the prefix of some suffix: s The node s suffix link should link to the prefix of the suffix s tht is 1 chrcter shorter. Since the suffix trie contins ll suffixes, it contins pth representing s, nd therefore contins node representing every prefix of s.
27 s = Suffix Tries A node represents the prefix of some suffix: s The node s suffix link should link to the prefix of the suffix s tht is 1 chrcter shorter. Since the suffix trie contins ll suffixes, it contins pth representing s, nd therefore contins node representing every prefix of s.
28 Applictions of Suffix Tries (II) Find the longest common sustring of T nd q: T = q =
29 Applictions of Suffix Tries (II) Find the longest common sustring of T nd q: Wlk down the tree following q. If you hit ded end, sve the current depth, nd follow the suffix link from the current node. When you exhust q, return the longest sustring found. T = q =
30 Constructing Suffix Tries
31 Suppose we wnt to uild suffix trie for string: s = c We will wlk down the string from left to right: c uilding suffix tries for s[0], s[0..1], s[0..2],..., s[0..n] To uild suffix trie for s[0..i], we will use the suffix trie for s[0..i-1] uilt in previous step To convert SufTrie(S[0..i-1]) SufTrie(s[0..i]), dd chrcter s[i] to ll the suffixes: c i=4 Need to dd nodes for the suffixes: c c c c c Purple re suffixes tht will exist in SufTrie(s[0..i-1]) Why? How cn we find these suffixes quickly?
32 Suppose we wnt to uild suffix trie for string: s = c We will wlk down the string from left to right: c uilding suffix tries for s[0], s[0..1], s[0..2],..., s[0..n] To uild suffix trie for s[0..i], we will use the suffix trie for s[0..i-1] uilt in previous step To convert SufTrie(S[0..i-1]) SufTrie(s[0..i]), dd chrcter s[i] to ll the suffixes: c i=4 Need to dd nodes for the suffixes: c c c c c Purple re suffixes tht will exist in SufTrie(s[0..i-1]) Why? How cn we find these suffixes quickly?
33 c i=4 Need to dd nodes for the suffixes: c c c c c Purple re suffixes tht will exist in SufTrie(s[0..i-1]) Why? How cn we find these suffixes quickly? c c c c Where is the new deepest node? (k longest suffix) c SufT rie() SufT rie(c) How do we dd the suffix links for the new nodes?
34 c i=4 Need to dd nodes for the suffixes: c c c c c Purple re suffixes tht will exist in SufTrie(s[0..i-1]) Why? How cn we find these suffixes quickly? c c c c Where is the new deepest node? (k longest suffix) c SufT rie() SufT rie(c) How do we dd the suffix links for the new nodes?
35 To uild SufTrie(s[0..i]) from SufTrie(s[0..i-1]): CurrentSuffix = longest (k deepest suffix) until you rech the root or the current node lredy hs n edge leled s[i] leving it. Repet: Add child leled s[i] to CurrentSuffix. Follow suffix link to set CurrentSuffix to next shortest suffix. Becuse if you lredy hve node for suffix αs[i] then you hve node for every smller suffix. Add suffix links connecting nodes you just dded in the order in which you dded them. In prctice, you dd these links s you go long, rther thn t the end.
36 Python Code to Build Suffix Trie def uild_suffix_trie(s): """Construct suffix trie.""" ssert len(s) > 0 clss SuffixNode: def init (self, suffix_link = None): self.children = {} if suffix_link is not self.suffix_link = else: self.suffix_link = None: suffix_link # explicitly uild the two-node suffix tree Root = SuffixNode() # the root node Longest = SuffixNode(suffix_link = Root) Root.dd_link(s[0], Longest) s[0] self # for every chrcter left in the string def dd_link(self, c, v): """link this node to node self.children[c] = v v vi string c""" for c in s[1:]: Current = Longest; Previous = None while c not in Current.children: # crete new node r1 with trnsition Current -c->r1 r1 = SuffixNode() Current.dd_link(c, r1) # if we cme from some previous node, mke # node's suffix link point here if Previous is not None: Previous.suffix_link = r1 tht # wlk down the suffix links Previous = r1 Current = Current.suffix_link # mke the lst suffix link if Current is Root: Previous.suffix_link = Root else: Previous.suffix_link = Current.children[c] # move to the newly dded child of the longest # (which is the new longest pth) Longest = Longest.children[c] return Root pth
37 current current s[i] s[i] longest s[i] s[i] s[i] s[i] u longest s[i] s[i] u s[i] Prev Prev current s[i] oundry pth s[i] s[i] s[i] s[i] Prev longest
38
39
40 Note: there's lredy pth for suffix "", so we don't chnge it (we just dd suffix link to it)
41 Note: there's lredy pth for suffix "", so we don't chnge it (we just dd suffix link to it)
42 Note: there's lredy pth for suffix "", so we don't chnge it (we just dd suffix link to it)
43 How mny nodes cn suffix trie hve? s = s = n n will hve 1 root node n nodes in pth of s n pths of n+1 nodes Totl = n(n+1)+n+1 = O(n 2 ) nodes. This is not very efficient. How could you mke it smller?
44 So... we hve to trie gin... Spce-Efficient Suffix Trees
45 A More Compct Representtion s = s = :6 5:6 7:7 5:6 7:7 4:7 7:7 4:7 7:7 4:7 Compress pths where there re no choices. Represent sequence long the pth using rnge [i,j] tht refers to the input string s.
46 Spce usge: In the compressed representtion: # leves = O(n) [one lef for ech position in the string] Every internl node is t lest inry split. Ech edge uses O(1) spce. Therefore, # numer of internl nodes is out equl to the numer of leves. And # of edges numer of leves, nd spce per edge is O(1). Hence, liner spce.
47 Trivil lgorithm to uild Suffix tree Put the lrgest suffix in Put the suffix in
48 Put the suffix in
49 Put the suffix in
50 Put the suffix in
51 We will lso lel ech lef with the strting point of the corres. suffix
52 Anlysis Tkes O(n 2 ) time to uild. We will see how to do it in O(n) time
53 Constructing Suffix Trees - Ukkonen s Algorithm The sme ide s with the suffix trie lgorithm. Min difference: not every trie node is explicitly s = u represented in the tree. Solution: represent trie nodes s pirs (u, α), where u is rel node in the tree nd α is some string leving it. v suffix_link[v] = (u, ) Some dditionl tricks to get to O(n) time.
54 Storing more thn one string with Generlized Suffix Trees
55 Constructing Generlized Suffix Tre Gol. Represent set of strings P = {s 1, s 2, s 3,..., s m }. Exmple. tt, tg, gt Simple solution: (1) uild suffix tree for string t# 1 tg# 2 gt# 3
56 Gol. Represent set of strings P = {s 1, s 2, s 3,..., s m }. Exmple. tt, tg, gt Simple solution: Constructing Generlized Suffix Tre (1) uild suffix tree for string t# 1 tg# 2 gt# 3 (2) For every lef node, remove ny text fter the first # symol. #3 g #1tg#2gt#3 #2gt#3 #3 g #2 #1 t t #3 g#2gt#3 #1tg#2gt#3 #3 g#2gt#3 t t#3 t#1tg#2gt#3 #2gt#3 #3 g#2 # 1 # 3 g# 2 t t# 1 t#3 #2 #1tg#2gt#3 #3 #1 #3
57 Applictions of Generlized Suffix Trees Longest common sustring of S nd T: Determine the strings in dtse {S 1, S 2, S 3,..., S m } tht contin query string q:
58 Applictions of Generlized Suffix Trees Longest common sustring of S nd T: Build generlized suffix tree for {S,T} Find the deepest node tht hs hs descendnts from oth strings (contining oth # 1 nd # 2 ) Determine the strings in dtse {S 1, S 2, S 3,..., S m } tht contin query string q: Build generlized suffix tree for {S 1, S 2, S 3,..., S m } Follow the pth for q in the suffix tree. Suppose you end t node u: trverse the tree elow u, nd output i if you find string contining # i.
59 Longest Common Extension Longest common extension:we re given strings S nd T. In the future, mny pirs (i,j) will e provided s queries, nd we wnt to quickly find: the longest sustring of S strting t i tht mtches sustring of T strting t j. S LCE(i,j) T LCE(i,j) i j Build generlized suffix tree for S nd T. Preprocess tree so tht lowest common ncestors (LCA) cn e found in constnt time. LCA(i,j) Crete n rry mpping suffix numers to lef nodes. Given query (i,j): Find the lef nodes for i nd j Return string of LCA for i nd j j i i j
60 Longest Common Extension Longest common extension:we re given strings S nd T. In the future, mny pirs (i,j) will e provided s queries, nd we wnt to quickly find: the longest sustring of S strting t i tht mtches sustring of T strting t j. S LCE(i,j) T LCE(i,j) i j Build generlized suffix tree for S nd T. Preprocess tree so tht lowest common O( S + T ) O( S + T ) ncestors (LCA) cn e found in constnt time. Crete n rry mpping suffix numers to lef LCA(i,j) nodes. O( S + T ) Given query (i,j): Find the lef nodes for i nd j Return string of LCA for i nd j O(1) O(1) j i i j
61 Using LCE to Find Plindromes Mximl even plindrome t position i: the longest string to the left nd right so tht the left hlf is equl to the reverse of the right hlf. S x y x y = the reverse of i plindromes in S. Gol: find ll mximl Sr y x x y n - i Construct S r, the reverse of S. Preprocess S nd S r so tht LCE queries cn e solved in constnt time (previous slide). LCE(i, n-i) is the length of the longest plindrome centered t i. n-i) For every position i: Compute LCE(i,
62 Using LCE to Find Plindromes Mximl even plindrome t position i: the longest string to the left nd right so tht the left hlf is equl to the reverse of the right hlf. S x y x y = the reverse of i plindromes in S. Gol: find ll mximl Sr y x x y Construct S r, the reverse of S. O( S ) n - i Preprocess S nd S r so tht LCE queries cn e solved in constnt time (previous slide). O( S ) LCE(i, n-i) is the length of the longest plindrome centered t i. For every position i: Compute LCE(i, n-i) O( S ) O(1) Totl time = O( S )
63 Recp Suffix tries nturl wy to store string -- serch, count occurrences, nd mny other queries nswerle esily. But they re not spce efficient: O(n 2 ) spce. Suffix trees re spce optiml: O(n), ut require little more sutle lgorithm to construct. Suffix trees cn e constructed in O(n) time using Ukkonen s lgorithm. Similr ides cn e used to store sets of strings.
Information Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationLecture 10: Suffix Trees
Computtionl Genomics Prof. Ron Shmir, Prof. Him Wolfson, Dr. Irit Gt-Viks School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' רון שמיר, פרופ' חיים וולפסון, דר' עירית גת-ויקס ביה"ס למדעי
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationSuffix trees. December Computational Genomics
Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationCSE 549: Suffix Tries & Suffix Trees. All slides in this lecture not marked with * of Ben Langmead.
CSE 549: Suffix Tries & Suffix Trees All slides in this lecture not mrked with * of Ben Lngmed. KMP is gret, ut T = m P = n (note: m,n re opposite from previous lecture) Without preprocessing (KMP) Given
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationThe dictionary model allows several consecutive symbols, called phrases
A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationI/O Efficient Dynamic Data Structures for Longest Prefix Queries
I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationON THE DEHN COMPLEX OF VIRTUAL LINKS
ON THE DEHN COMPLEX OF VIRTUAL LINKS RACHEL BYRD, JENS HARLANDER Astrct. A virtul link comes with vriety of link complements. This rticle is concerned with the Dehn spce, pseudo mnifold with oundry, nd
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationThe Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center
Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationSubtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More information