Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
|
|
- Cornelius Glenn
- 6 years ago
- Views:
Transcription
1 Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits
2 Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the Illumina Experiment Manager software, specify 2 index reads for the run. In the CSV file, specify the MID index and the sample index sequences. Samples will be demultiplexed based only on their sample index. Using a custom script, join MIDs to their respective fastq read headers, align these fastq, and analyze the reads with a common genomic coordinate. The following slides contain instructions for the MiSeq instrument, but these can also apply to HiSeq and NextSeq instruments as well.
3 The Swift MID Adapter Sequence Below is the sequence of the standard LT P7 adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG Below is the sequence of the Swift MID P5 adapter, where 9 random N bases (instead of the standard Index 2, 8 bp D index sequence) is inserted: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNACACTCTTTCCCTACACGACG CTCTTCCGATCT Oligonucleotide sequences 2016 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited.
4 Pre-Run Instrument Set-Up Modify the config file to allow generation of an index fastq file during data analysis: 1. Stop the MiSeq Reporter process (if it is running). 2. Locate the MiSeq Reporter.exe.config file located in C:/Illumina/MiSeq Reporter. 3. Open config file and search for a line that reads: <add key= CreateFastqForIndexReads value= 0 />. If this line is present, change the value from 0 to 1. If this line is not present, add the line to the config file using the add keys function under the app Settings tab. 4. Restart the MiSeq reporter process. 5. Re-queue the run for data analysis (if required).
5 Instrument Set-Up and Sample Sheet Preparation Experimental set-up on Illumina Experiment Manager software Select MiSeq On the MiSeq Application Selection page, select Other --> FASTQ Only Enter Reagent Cartridge Barcode, choose TruSeq HT, choose 2" for Index Reads,... Read Type: Paired End, enter desired number of cycles for each read, and uncheck all the boxes on the right (including adapter trimming) - By selecting HT, we can alter the index sequences read in the sample sheet - 2 Index reads ensures P7 index (Index 1) is read, as well as the P5 MID located in place of the P5 index (Index 2)
6 Instrument Set-Up and Sample Sheet Preparation On the next step, enter your index sequence if using high throughput indices If using low throughput indices, select a random index sequence until sample sheet status is valid - We will specify the low throughput sequence in the sample sheet For I5 Sequence, enter a random index number on the pull down menu - We will specify the MID (NNNNNNNNN) in the sample sheet - Click Finish to generate the CSV file
7 Instrument Set-Up and Sample Sheet Preparation Alter your sample sheet to represent the real index sequences - When using a low throughput index, include the index and the next 2 bases» For example with I2: Enter CGATGTAT. Bold represents the index whereas the underlined bases represent the next two bases on the adapter - For Index 2, enter the mid sequence: NNNNNNNNN - During the MiSeq run, the samples will be separated based only on their Index 1 indexes, since any Index 2 reads will be valid
8 Instrument Set-Up and Sample Sheet Preparation After the run, all reads will be separated based on Index 1 reads Non-Identified (Undetermined) reads are due to either poor quality or reads containing absent index sequences.
9 Options for Retrieving Index Sequence Files Instrument bcl2fastq MiSeq reporter BaseSpace MiniSeq MiSeq NextSeq 500 HiSeq 2500 HiSeq 4000 If for any reason the data is not extracted correctly by the Sample Sheet setup, bcl2fastq Conversion Software can be used to correctly extract the data.
10 Logic for Bioinformatic Analysis of ChIP-Seq and cfdna After the sequencing run, all reads will be separated based on Index 1 only. Non-identified (or undetermined) reads are either due to poor quality or reads missing index sequences. Using a custom script, join the MIDs to the respective fastq read headers. Align these fastq using BWA. Using another custom script, analyze the reads with a common genomic coordinate. If the reads have unique MID sequences, they represent fragment duplicates and should be retained as unique reads If the reads have identical MID sequences, they represent PCR duplicates. Mark all reads except one as duplicates based on mapping and base quality.
11 Logic for Bioinformatic Analysis of Low Frequency Variants After the sequencing run, all reads will be separated based on Index 1 only. Non-identified (or undetermined) reads are either due to poor quality or reads missing index sequences. Using a custom script, join the MIDs to the respective Fastq read headers. Align these Fastq using BWA. Use Picard Tools or Samtools to collect metrics like % duplication, reads on target, etc. Using another custom script, group fragments with at least 3 PCR duplicate reads per MID for variant calling (also considering Flag and Cigar values). Within the group, determine a consensus sequence for each fragment which eliminates sequencing and PCR errors present at less than 50%. The following publication contains some details concerning this kind of analysis, and may be a useful reference: S.R. Kennedy, et al. Nat Protoc November; 9(11):
12 Fulcrum Genomics Analysis Tools To perform this analysis, we recommend using UMI tools from the fgbio package ( It enables you to tag your bam file with the MIDs from your Index 2 fastq (AnnotateBamWithUmis) Use the Picard MarkDuplicate with BARCODE_TAG=RX option to get duplicate rate based on MIDs. Use GroupReadsByUmi to group reads with the same MID. Use CallMolecularConsensusReads to enrich for MID reads for variant calling.
13 THANK YOU , Swift Biosciences, Inc. The Swift logo is a trademark and Accel-NGS is a registered trademark of Swift Biosciences. Illumina, TruSeq, MiSeq, HiSeq, and NextSeq are registered trademarks of Illumina, Inc , 10/16
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
More informationMolecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
More informationIllumina Experiment Manager: Narration Transcript
1 Illumina Experiment Manager: Transcript... 1 Illumina Experiment Manager: Transcript Welcome Course Navigation Course Objectives Overview Downloading the Software Sample Sheets and Sample Plates Terms
More informationSequencing set-up guidelines for NGS libraries prepped with Agilent NGS kits
Sequencing set-up guidelines for NGS libraries prepped with Agilent NGS kits I. Illumina Instruments (SureSelect XT /XT2/QXT, SurSelect RNA-Seq and HaloPlex/HaloPlex HS ) 1. HiSeq1000/2000 and HiSeq1500/2500
More informationIllumina Experiment Manager User Guide
Illumina Experiment Manager User Guide For Research Use Only. Not for use in diagnostic procedures. What is Illumina Experiment Manager? 3 Getting Started 4 Creating a Sample Plate 7 Creating a Sample
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationBaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationMiseq spec, process and turnaround times
Miseq spec, process and turnaround s One Single lane & library pool / flow cell (on board clusterisation) 1 Flow cell / run Instrument used to sequence small libraries such as targeted sequencing or bacterial
More informationmtdna Variant Processor v1.0 BaseSpace App Guide
mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters
More informationIndexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
More informationHiSeq Instrument Software Release Notes
HiSeq Instrument Software Release Notes HCS v2.0.12 RTA v1.17.21.3 Recipe Fragments v1.3.61 Illumina BaseSpace Broker v2.0.13022.1628 SAV v1.8.20 For HiSeq 2000 and HiSeq 1000 Systems FOR RESEARCH USE
More informationIndexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
More informationumicount Documentation
umicount Documentation Release 1.0 Mickael June 30, 2015 Contents 1 Introduction 3 2 Recommendations 5 3 Install 7 4 How to use umicount 9 4.1 Working with a single bed file......................................
More informationSequence Preprocessing: A perspective
Sequence Preprocessing: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Why Preprocess reads We have found that aggressively cleaning and processing
More informationImage Analysis and Base Calling Sarah Reid FAS
Image Analysis and Base Calling Sarah Reid FAS For Research Use Only. Not for use in diagnostic procedures. 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse,
More informationCORE Year 1 Whole Genome Sequencing Final Data Format Requirements
CORE Year 1 Whole Genome Sequencing Final Data Format Requirements To all incumbent contractors of CORE year 1 WGS contracts, the following acts as the agreed to sample parameters issued by NHLBI for data
More informationDemultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
More informationREADME _EPGV_DataTransfer_Illumina Sequencing
README _EPGV_DataTransfer_Illumina Sequencing I. Delivered files / Paired-ends (PE) sequences... 2 II. Flowcell (FC) Nomenclature... 2 III. Quality Control Process and EPGV Cleaning Version 1.7... 4 A.
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationBaseSpace User Guide. Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY
BaseSpace User Guide Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY Introduction 3 How Do I Start 8 BaseSpace User Interface 13 How To Use BaseSpace 25 Workflow Reference
More informationLocal Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationTECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves
More informationGuidelines for sequencing SCC libraries All libraries made after are V3 libraries
2018-2-28 Guidelines for sequencing SCC libraries All libraries made after 1-1-2017 are V3 libraries Upon receiving your libraries: When your libraries are delivered you will be given the library concentration
More informationBaseSpace Onsite v2.1 HT System Guide
BaseSpace Onsite v2.1 HT System Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 6 Introduction 7 Getting Started 12 BaseSpace Onsite User Interface 17 How To Use BaseSpace
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationQIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
More informationEpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationSequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationPacBio SMRT Analysis 3.0 preview
PacBio SMRT Analysis 3.0 preview David Alexander, Ph.D. Pacific Biosciences, Inc. FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright 2015 by Pacific Biosciences
More informationIsaac Enrichment v2.0 App
Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December
More informationSMRT Link Release Notes (v6.0.0)
SMRT Link Release Notes (v6.0.0) SMRT Link Server Installation SMRT Link server software is supported on English-language CentOS 6.x; 7.x and Ubuntu 14.04; 16.04 64-bit Linux distributions. (This also
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationUser Guide: Illumina sequencing technologies Sequence-ready libraries
DECEMBER 17, 2018 MASSIVELY PARALLEL SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre User Guide: Illumina sequencing technologies Sequence-ready libraries Version 6.0 Copyright
More informationBaseSpace User Guide FOR RESEARCH USE ONLY
BaseSpace User Guide FOR RESEARCH USE ONLY Introduction 3 How Do I Start 7 BaseSpace User Interface 11 How To Use BaseSpace 21 Workflow Reference 44 Data Reference 50 Technical Assistance ILLUMINA PROPRIETARY
More informationData Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationMiSeq Reporter Amplicon DS Workflow Guide
MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis
More informationMar. EDICO GENOME CORP North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Mar 2017 DRAGEN TM User Guide www.edicogenome.com EDICO GENOME CORP. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice The information disclosed in this User Guide and associated software
More informationSequence Genotyper Reference Guide
Sequence Genotyper Reference Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Installation 4 Dashboard Overview 5 Projects 6 Targets 7 Samples 9 Reports 12 Revision History
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationSequencing Analysis Viewer Software User Guide
Sequencing Analysis Viewer Software User Guide FOR RESEARCH USE ONLY Revision History 3 Introduction 4 Setting Up Sequencing Analysis Viewer Software 5 Data Availability 8 Loading Data 9 Analysis Tab 10
More informationQuality assessment of NGS data
Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationNGI-RNAseq. Processing RNA-seq data at the National Genomics Infrastructure. NGI stockholm
NGI-RNAseq Processing RNA-seq data at the National Genomics Infrastructure Phil Ewels phil.ewels@scilifelab.se NBIS RNA-seq tutorial 2017-11-09 SciLifeLab NGI Our mission is to offer a state-of-the-art
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationMiSeq Reporter Software Reference Guide for IVD Assays
MiSeq Reporter Software Reference Guide for IVD Assays FOR IN VITRO DIAGNOSTIC USE ILLUMINA PROPRIETARY Document # 15038356 Rev. 02 September 2017 This document and its contents are proprietary to Illumina,
More informationChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationLessons Learned during Illumina s Secure DevOps Transition Kenneth G. Hartman Associate Director Cloud Products Security
Lessons Learned during Illumina s Secure DevOps Transition Kenneth G. Hartman Associate Director Cloud Products Security 2018 Illumina, Inc. All rights reserved. QB Document #6608 At a Glance 2 https://www.illumina.com/company/news-center/feature-articles/illumina-at-a-glance.html
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationNevada Genomics Center
Nevada Genomics Center These are general instructions on how to use dnatools to submit next generation sequencing samples to be run on either the Ion Torrent Proton or the Illumina NextSeq500. We here
More informationAssembly of the Ariolimax dolicophallus genome with Discovar de novo. Chris Eisenhart, Robert Calef, Natasha Dudek, Gepoliano Chaves
Assembly of the Ariolimax dolicophallus genome with Discovar de novo Chris Eisenhart, Robert Calef, Natasha Dudek, Gepoliano Chaves Overview -Introduction -Pair correction and filling -Assembly theory
More informationQIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL
QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted RNAscan Panel Analysis 0.5.2 beta 1 Windows, Mac OS X and Linux February 5, 2018 This software is for research
More informationReads Alignment and Variant Calling
Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationPerforming a resequencing assembly
BioNumerics Tutorial: Performing a resequencing assembly 1 Aim In this tutorial, we will discuss the different options to obtain statistics about the sequence read set data and assess the quality, and
More informationChIP-Seq data analysis workshop
ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationTutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017
Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationBioinformatics Framework
Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest
More informationELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018
ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 USA SAN FRANCISCO USA ORLANDO BELGIUM - HQ LEUVEN THE NETHERLANDS EINDHOVEN
More informationTutorial. Small RNA Analysis using Illumina Data. Sample to Insight. October 5, 2016
Small RNA Analysis using Illumina Data October 5, 2016 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationEcoStudy Software User Guide
EcoStudy Software User Guide FOR RESEARCH USE ONLY What is EcoStudy? 3 Setting Up a Study 4 Specifying Analysis Settings for your Study 6 Reviewing the Data in your Study 8 Exporting Study Data to a Report
More informationData Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis
Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More information1. Download the data from ENA and QC it:
GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationSmall RNA Analysis using Illumina Data
Small RNA Analysis using Illumina Data September 7, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
More informationFalcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
More informationIntroduction. Library quantification and rebalancing. Prepare Library Sequence Analyze Data. Library rebalancing with the iseq 100 System
Sequencing Library QC with the iseq System The iseq 100 System enables measurement of pooled library quality before a large-scale sequencing study on the NovaSeq 6000 System. Introduction This application
More informationMiSeq System User Guide
MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. A August 2011 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More information