SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

Size: px
Start display at page:

Download "SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016"

Transcription

1 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

2 File Format: SAM / BAM / CRAM! NEW - deprecated! - SAMtools 1.0 and up Li H.*, Handsaker B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25, [PMID: ] SAM specification (currently v1, renumbered 1 is after old v1.4) samtools man page example workflow(s) mailing list!

3 File Format: SAM

4 File Format: SAM SAM Format Specification v1.4-r985 7,8 - formerly MRNM, MPOS (mate reference name, mate position) 9 - formerly ISIZE ("insert" size)

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20 File Format: SAM google "Heng Li slides" - Challenges and Solutions in the Analysis of Next Generation Sequencing Data (2010)

21 File Format: BAM BAMs are compressed SAMs (so, binary, not human-readable text don't look directly at them!). They can be indexed to allow rapid extraction of information, so alignment viewers do not need to uncompress the whole BAM file in order to look at information for a particular read or coordinate range, somewhere in the file. Indexing your BAM file, mycoolbamfile.bam, will create an index file, mycoolbamfile.bam.bai, which is needed (in addition to the BAM file) by viewers and other downstream tools. An occasional downstream tool will require an index called mycoolbamfile.bai (notice that the.bai replaces the.bam, instead of being appended after it).

22 File Format: CRAM Available as of SAMtools 1.0, and is a binary format like BAM. Uses data-specific compression tools (i.e. compressing letters is different than compressing numbers), specifically reference-based compression (e.g. for aligned reads, only mis-matching bases need to be stored). Also can employ lossy compression of base qualities, which appears to have a negligible effect on, say, variant calling (see Illumina white paper). Indexing your CRAM file, mycoolbamfile.cram, will create an index file, mycoolbamfile.cram.crai, which is needed (in addition to the CRAM file) by viewers and other downstream tools. This is a very recent development, so it may be a while before tools are CRAM-capable.

23 Alignment Viewers IGV (Integrated Genomics Viewer) BAMview, tview (in SAMtools), IGB, GenomeView, SAMscope... UCSC Genome Browser, GBrowse

24 IGV red box indicates region of reference in view below coverage track: read coverage depth plot read alignments: (various view styles - squished shown here) read positions, orientations, pairing, sequence that disagrees with reference highlighted, improper pairs highlighted, etc. annotation tracks (GTF, BED, etc.)

25 IGV colored bases where they disagree with reference (substitution, indel, etc.) improper pairs (mate aligns far away, in wrong orientation, or on another chromosome) reference sequence, reading frames, etc.

26

27 Variant Calling - VCF format One main application of read alignment. A.k.a. "resequencing", SNP / indel discovery. VCF (variant call format) is now the standard format for variant reporting. VCF poster

28 Variant Call Format ##fileformat=vcfv4.1 ##filedate= ##source=freebayes v gfbf46fc-dirty ##reference=../results/8/8.fa ##phasing=none ##commandline="../tools/freebayes/bin/freebayes -f../results/8/8.fa --min-alternate-fraction minmapping-quality 20 --min-base-quality 20 --ploidy 1 --pooled-continuous --use-best-n-alleles 4 --usemapping-quality --min-alternate-fraction min-alternate-count 1../results/8/8.bam" ##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count, with partial observations recorded fractionally"> ##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally"> ##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex."> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype"> ##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count"> ##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations"> ##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count"> ##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 8 8_PB1 26. TGTTACGCG GCTTTTGC,TGTTTCTAC AO=1,2;RO=0;TYPE=complex, complex GT:DP:RO:QR:AO:QA:GL 2:3:0:0:1,2:31,70:-4.46,-1.65,0 8_PB1 38. TCA ACG,TA,AGA AO=1,1,1;RO=3;TYPE=complex,del,mnp GT:DP:RO:QR:AO:QA:GL 2:6:3:101:1,1,1:31,37,34:0,-4.556,-4.004, _PB1 42. G A e-14. AO=8;RO=128;TYPE=snp GT:DP:RO:QR:AO:QA: GL

29 Variant Call Format ##fileformat=vcfv4.1 ##filedate= ##source=freebayes v gfbf46fc-dirty ##reference=../results/8/8.fa ##phasing=none ##commandline="../tools/freebayes/bin/freebayes -f../results/8/8.fa --min-alternate-fraction minmapping-quality 20 --min-base-quality 20 --ploidy 1 --pooled-continuous --use-best-n-alleles 4 --usemapping-quality --min-alternate-fraction min-alternate-count 1../results/8/8.bam" ##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count, with partial observations recorded fractionally"> ##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally"> ##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex."> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype"> ##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count"> ##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations"> ##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count"> ##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 8 8_PB1 26. TGTTACGCG GCTTTTGC,TGTTTCTAC AO=1,2;RO=0;TYPE=complex, complex GT:DP:RO:QR:AO:QA:GL 2:3:0:0:1,2:31,70:-4.46,-1.65,0 8_PB1 38. TCA ACG,TA,AGA AO=1,1,1;RO=3;TYPE=complex,del,mnp GT:DP:RO:QR:AO:QA:GL 2:6:3:101:1,1,1:31,37,34:0,-4.556,-4.004, _PB1 42. G A e-14. AO=8;RO=128;TYPE=snp GT:DP:RO:QR:AO:QA: GL

30 Variant Call Format #CHROM POS ID REF 8_PB A 170:21:788:149:5579:-5,0 CHROM = 8_PB2 POS = 407 ID =. REF = A ALT = G QUAL = ALT G QUAL FILTER INFO FORMAT 8 AO=149;RO=21;TYPE=snp GT:DP:RO:QR:AO:QA:GL 1: FILTER =. INFO = AO=149;RO=21;TYPE=snp FORMAT = GT:DP:RO:QR:AO:QA:GL 8 = 1:170:21:788:149:5579:-5,0

31 Variant Call Format

32 Variant Call Format

33 Variant Call Format

34 Variant Call Format #CHROM POS ID REF 8_PB A 170:21:788:149:5579:-5,0 CHROM = 8_PB2 POS = 407 ID =. REF = A ALT = G QUAL = ALT G QUAL FILTER INFO FORMAT 8 AO=149;RO=21;TYPE=snp GT:DP:RO:QR:AO:QA:GL 1: ##FORMAT=<ID=DP,Number=1,Type=Integer, Description="Read Depth"> FILTER =. INFO = AO=149;RO=21;TYPE=snp FORMAT = GT:DP:RO:QR:AO:QA:GL 8 = 1:170:21:788:149:5579:-5,0

35 Variant Call Format ##INFO=<ID=RO,Number=1,Type=Integer,Description=" Reference allele observation count, with partial observations recorded fractionally"> ##INFO=<ID=AO,Number=A,Type=Integer,Description=" Alternate allele observations, with partial observations recorded fractionally"> ##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">

36 Variant Call Format ##FORMAT=<ID=GT,Number=1,Type=String,Description=" Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Float,Description=" Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype"> ##FORMAT=<ID=GL,Number=G,Type=Float,Description=" Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description=" Read Depth">

37 Variant Call Format ##FORMAT=<ID=RO,Number=1,Type=Integer,Description=" Reference allele observation count"> ##FORMAT=<ID=QR,Number=1,Type=Integer,Description=" Sum of quality of the reference observations"> ##FORMAT=<ID=AO,Number=A,Type=Integer,Description=" Alternate allele observation count"> ##FORMAT=<ID=QA,Number=A,Type=Integer,Description=" Sum of quality of the alternate observations">

38 Variant Effect Prediction snpeff Variant Effect Predictor (EMBL) SIFT

39 VCF after Effect Prediction #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 8 8_PB A G AO=149;RO=21;TYPE=snp;EFF=SYNONYMOUS_CODING (LOW SILENT gaa/gag E PB2 CODING Tr_PB2 1 1) GT:DP:RO:QR:AO:QA:GL 1:170:21:788:149:5579:-5,0 CHROM = 8_PB2 POS = 407 ID =. REF = A ALT = G QUAL = FILTER =. INFO = AO=149;RO=21;TYPE=snp;EFF=SYNONYMOUS_CODING (LOW SILENT gaa/gag E PB2 CODING Tr_PB2 1 1) FORMAT = GT:DP:RO:QR:AO:QA:GL 8 = 1:170:21:788:149:5579:-5,0

40 VCF after Effect Prediction ##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex."> ##INFO=<ID=EFF,Number=.,Type=String,Description="Predicted effects for this variant.format: 'Effect ( Effect_Impact Functional_Class Codon_Change Amino_Acid_change Amino_Acid_length Gene_Name Transcript_BioType Gene_Coding Transcript_ID Exon GenotypeNum [ ERRORS WARNINGS ] )' "> INFO = AO=149;RO=21;TYPE=snp; EFF=SYNONYMOUS_CODING (LOW SILENT gaa/gag E PB2 CODING Tr_PB2 1 1)

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja / From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Practical exercises Day 2. Variant Calling

Practical exercises Day 2. Variant Calling Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA

seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA David Mosen-Ansorena 1 October 30, 2017 Contents 1 Genome Analysis Platform CIC biogune and CIBERehd dmosen.gn@cicbiogune.es

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

From the Schnable Lab:

From the Schnable Lab: From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015 freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:

More information

Isaac Enrichment v2.0 App

Isaac Enrichment v2.0 App Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December

More information

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Manual Reference Pages samtools (1)

Manual Reference Pages samtools (1) Manual Reference Pages samtools (1) NAME CONTENTS SYNOPSIS samtools Utilities for the Sequence Alignment/Map (SAM) format bcftools Utilities for the Binary Call Format (BCF) and VCF Synopsis Description

More information

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!

More information

Data Walkthrough: Background

Data Walkthrough: Background Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis

More information

MiSeq Reporter Amplicon DS Workflow Guide

MiSeq Reporter Amplicon DS Workflow Guide MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

GenomeStudio Software Release Notes

GenomeStudio Software Release Notes GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation

More information

Read Mapping and Variant Calling

Read Mapping and Variant Calling Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within

More information

Assignment 7: Single-cell genomics. Bio /02/2018

Assignment 7: Single-cell genomics. Bio /02/2018 Assignment 7: Single-cell genomics Bio5488 03/02/2018 Assignment 7: Single-cell genomics Input Genotypes called from several exome-sequencing datasets derived from either bulk or small pools of cells (VCF

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013) Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using

More information

MiSeq Reporter TruSight Tumor 15 Workflow Guide

MiSeq Reporter TruSight Tumor 15 Workflow Guide MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest

More information

TCGA Variant Call Format (VCF) 1.0 Specification

TCGA Variant Call Format (VCF) 1.0 Specification TCGA Variant Call Format (VCF) 1.0 Specification Document Information Specification for TCGA Variant Call Format (VCF) Version 1.0 1 About TCGA VCF specification 2 TCGA-specific customizations 3 File format

More information

RVD2.7 command line program (CLI) instructions

RVD2.7 command line program (CLI) instructions RVD2.7 command line program (CLI) instructions Contents I. The overall Flowchart of RVD2 program... 1 II. The overall Flow chart of Test s... 2 III. RVD2 CLI syntax... 3 IV. RVD2 CLI demo... 5 I. The overall

More information

Variant Calling and Filtering for SNPs

Variant Calling and Filtering for SNPs Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation

More information

Click on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:

Click on + button Select your VCF data files (see #Input Formats->1 above) Remove file from files list: CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic

More information

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so

More information

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1 Open Your Favorite Note Taking Program TextEdit.app WordPad Connect to Your Personal Bioinformatics Server Start VirtualBox Start PG2014 Minimize window Connect via SSH using Terminal.app or PuTTY View

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

Peak Finder Meta Server (PFMS) User Manual. Computational & Systems Biology, ICM Uppsala University

Peak Finder Meta Server (PFMS) User Manual. Computational & Systems Biology, ICM Uppsala University Peak Finder Meta Server (PFMS) 1.1 Overview User Manual Computational & Systems Biology, ICM Uppsala University http://www.icm.uu.se/ PFMS is a free software application which identifies genome wide transcription

More information

Local Run Manager Resequencing Analysis Module Workflow Guide

Local Run Manager Resequencing Analysis Module Workflow Guide Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis

More information

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing

More information

Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor

Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor Sean Davis National Cancer Institute, National Institutes of Health Bethesda, MD, USA sdavis2@mail.nih.gov November

More information

RNA Sequencing with TopHat and Cufflinks

RNA Sequencing with TopHat and Cufflinks RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962

More information

mageri Documentation Release Mikhail Shugay

mageri Documentation Release Mikhail Shugay mageri Documentation Release 1.0.0 Mikhail Shugay May 08, 2017 Contents 1 Terminology 3 2 Table of contents 5 2.1 Installation and running......................................... 5 2.2 Input...................................................

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Local Run Manager Amplicon Analysis Module Workflow Guide

Local Run Manager Amplicon Analysis Module Workflow Guide Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013

More information

Introduction to GDS. Stephanie Gogarten. August 7, 2017

Introduction to GDS. Stephanie Gogarten. August 7, 2017 Introduction to GDS Stephanie Gogarten August 7, 2017 Genomic Data Structure Author: Xiuwen Zheng CoreArray (C++ library) designed for large-scale data management of genome-wide variants data format (GDS)

More information

BaseSpace Variant Interpreter Release Notes

BaseSpace Variant Interpreter Release Notes Document ID: EHAD_RN_010220118_0 Release Notes External v.2.4.1 (KN:v1.2.24) Release Date: Page 1 of 7 BaseSpace Variant Interpreter Release Notes BaseSpace Variant Interpreter v2.4.1 FOR RESEARCH USE

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

SNP Calling. Tuesday 4/21/15

SNP Calling. Tuesday 4/21/15 SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity

More information

svviz Documentation Release Noah Spies

svviz Documentation Release Noah Spies svviz Documentation Release 1.6.2 Noah Spies Aug 17, 2017 Contents 1 Introduction to svviz 1 2 Features 3 3 Installation 5 4 Visual output 9 5 Command line interface 13 6 Summary output 17 7 Batch mode

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

discosnp++ Reference-free detection of SNPs and small indels v2.2.2

discosnp++ Reference-free detection of SNPs and small indels v2.2.2 discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...

More information

Omixon PreciseAlign CLC Genomics Workbench plug-in

Omixon PreciseAlign CLC Genomics Workbench plug-in Omixon PreciseAlign CLC Genomics Workbench plug-in User Manual User manual for Omixon PreciseAlign plug-in CLC Genomics Workbench plug-in (all platforms) CLC Genomics Server plug-in (all platforms) January

More information

Predictive Coding of Aligned Next-Generation Sequencing Data

Predictive Coding of Aligned Next-Generation Sequencing Data Predictive Coding of Aligned Next-Generation Sequencing Data Jan Voges +, Marco Munderloh, Jörn Ostermann Institut für Informationsverarbeitung (TNT) Leibniz Universität Hannover Appelstr. 9A 30167 Hannover,

More information

Development of a pipeline for SNPs detection

Development of a pipeline for SNPs detection Development of a pipeline for SNPs detection : Détection, Gestion et Analyse du Polymorphisme Des Génomes Végétaux 9, 10 et 11 Juin I. Background and objectives of the pipeline Setting up a pipeline of

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

REAPR version Martin Hunt. Feb 23 rd 2015

REAPR version Martin Hunt. Feb 23 rd 2015 REAPR version 1.0.18 Martin Hunt Feb 23 rd 2015 1 Contents 1 Installation 3 1.1 Prerequisites................................... 3 1.2 Install REAPR.................................. 3 2 Brief instructions

More information

CircosVCF workshop, TAU, 9/11/2017

CircosVCF workshop, TAU, 9/11/2017 CircosVCF exercise In this exercise, we will create and design circos plots using CircosVCF. We will use vcf files of a published case "X-linked elliptocytosis with impaired growth is related to mutated

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

v0.3.2 March 29, 2017

v0.3.2 March 29, 2017 March 29, 2017 v0.3.2 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP3.1 positions.

More information

UCSC Genome Browser ASHG 2014 Workshop

UCSC Genome Browser ASHG 2014 Workshop UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,

More information

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1

More information

MPG NGS workshop I: Quality assessment of SNP calls

MPG NGS workshop I: Quality assessment of SNP calls MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information