Practical 02. Bash & shell scripting

Size: px
Start display at page:

Download "Practical 02. Bash & shell scripting"

Transcription

1 Practical 02 Bash & shell scripting 1

2 imac lab login: maclab password: 10khem 1.use the Finder to visually browse the file system (single click opens) 2.find the /Applications folder 3.open the Utilities folder 4.open the Terminal application 2

3 Notes on homework assignments add name to text file at top make sure you don t get weird HTML characters eg & should really be & >> should be >> subject: include PHY598: assignment 02 reverse BAG BAG="towel teacup guide babelfish" BAG2="" for item in $BAG do BAG2="${item} ${BAG2}" done echo ${BAG2} babelfish guide teacup towel 3

4 Notes as PDF Blackboard /SimBioNano/02/... almost complete. 4

5 Input/Ouput redirection >, >>, < cat < FILE cat FILE1 FILE1 > FILE3 cat FILE1 FILE2 >> FILE3 What happens with cd p01 cat 1AKE.pdb 1AKE.pdb > tmp/new.pdb cat 1AKE.pdb 1AKE.pdb >> tmp/new.pdb cat 1AKE.pdb 1AKE.pdb > tmp/new.pdb Use ls -l... 5

6 Counting file contents: wc wc [options] FILE wc < FILE wc -l FILE $ wc 1AKE.pdb AKE.pdb lines words characters Count the lines in 1AKE.pdb and tmp/new.pdb $ wc -l 1AKE.pdb AKE.pdb $ wc -l tmp/new.pdb 8848 tmp/new.pdb 6

7 Downloading with curl Instead of using a web browser, use curl -O URL curl -O pages/courses/2013/simbionano/01/1ake.pdb cat URL Note: type the URL on a single line! curl URL > name curl URL wc -l creates a pipeline between commands; see later slides. 7

8 Variables BASEURL=" pages/courses/2013/simbionano/" PRACTICAL=01 FILE=1AKE.pdb echo "Practical ${PRACTICAL}: " echo "downloading file ${FILE}" URL="${BASEURL}/${PRACTICAL}/${FILE}" curl -O "${URL}" 8

9 Editing files vi editor ( vim ) vi hello.sh 9

10 A simple shell script #!/bin/bash # usage: hello.sh NAME # Greets NAME. NAME="$1" echo "Hello ${NAME}!" Run the script: bash./hello.sh your_name 10

11 Executable scripts A script can only be directly executed if the executable flag is set: chmod a+x./hello.sh Check with ls -la./hello.sh: -rwxr-xr-x 1 oliver staff 91 Jan 14 14:15 hello.sh Run the script:./hello.sh your_name 11

12 Argument processing white space splits arguments:./hello.sh your name./hello.sh your name individual positional arguments can be accessed as $1, $2, $3,..., ${10},... all arguments: $* optional arguments (-h, -f FILE,...): use the getopts (shell builtin) getopt (GNU, not always available) functions (advanced) 12

13 Write your own course downloader cdl Should work like this: cdl.sh 01 vim_basics.txt downloads the file pages/courses/2013/simbionano/01/vim_basics.txt Start your script with a standard header #!/bin/bash # usage: cdl.sh PRACTICAL FILENAME # downloads FILENAME for PRACTICAL # example: # cdl.sh 01 vim_basics.txt 13

14 Course DownLoad script cdl $ vi cdl.sh #!/bin/bash # usage: cdl.sh PRACTICAL FILENAME # downloads FILENAME for PRACTICAL BASEURL=" pages/courses/2013/simbionano" PRACTICAL="$1" FILE="$2" echo "Practical ${PRACTICAL}: " echo "downloading file ${FILE}" URL="${BASEURL}/${PRACTICAL}/${FILE}" curl -O "${URL}" Note: The URL should be on a single line! 14

15 Download script make executable chmod a+x cdl store in your ~/bin directory (and name it just cdl so that you don t have to type.sh all the time... in Unix lazy is good :-) ) mkdir ~/bin cp cdl.sh ~/bin/cdl try it ~/bin/cdl 01 1AKE.pdb ~/bin/cdl 01 vimqrc.pdf 15

16 Environment variables The shell sets a number of variables with special meaning. See all of them with env less The PATH contains a list of directories (separated by : ) where the shell looks for commands ( executables ): echo $PATH.:/usr/local/bin:/usr/bin:/bin:/usr/sbin:/sbin:/usr/ local/bin:/usr/x11/bin 16

17 Environment variables Add your own $HOME/bin directory to the PATH PATH=${PATH}:$HOME/bin export PATH Make this change permanent by adding the line export PATH=${PATH}:$HOME/bin to the end of the shell startup file ~/.bashrc try it: open a new terminal which cdl cdl 01 1AKE.pdb cdl 02b extra.txt instructions for writing a more challenging script 17

18 Pipes: Unix commands can be joined: standard output standard input... command command... cat FILE wc -l cat 1AKE.pdb tmp/new.pdb wc -l 18

19 Filter pipe lines The following commands are very useful to know for processing data in pipelines: grep or egrep (egrep is preferred) sort uniq cut sed awk The next few slides only give you a rough idea what these commands are good for. Read the man pages! (e.g. man sort) sed and awk are pretty complicated but basic use is fairly straightforward 19

20 Filters: grep and egrep egrep == grep -E prints lines matching a pattern ( regular expression ) cat FILE egrep PATTERN cat 1AKE.pdb egrep '^ATOM' egrep '^ATOM.* A *[0-9]+' 1ake.pdb \ > 1ake_A.pdb find all lines starting with ATOM extract chain A from this PDB file (Note: can fail if the chain identifier is not surrounded by white space... do not rely on it.) 20

21 Filters: grep and egrep Count the atoms in 1AKE cat 1AKE.pdb egrep '^ATOM' wc -l Count the residues in 1AKE (each residue contains a single CA atom) cat 1AKE.pdb egrep '^ATOM.*CA' wc -l 21

22 Filters: sort and uniq alphabetical sort cat FILE sort numerical sort cat FILE sort -n select fields for sorting (white space separated) cat FILE sort -n -k2,2 only keep unique entries cat FILE sort uniq count unique entries ( histogram ) cat FILE sort uniq -c 22

23 Filters: cut Cut fields or columns from a FILE or input stream cat FILE cut OPTIONS cut OPTIONS FILE data from columns N-M and X-Y cut -c N-M,X-Y FILE Example: get all residue names from a PDB file: cat 1AKE.pdb egrep ^ATOM \ cut -c data from fields N-M separated by white space cut -f N,M -d ' 23

24 sed and awk sed is a stream editor (similar to some of the commands used in vi) common use is search and replace: cat FILE sed 's/search/replace/g' awk applies a small program to each input line (it is its own programming language) common use: working on separated column data: cat FILE \ awk '/REGEX/ {awk-command; \ awk-command;...}' cat /etc/passwd awk -F ':' '$1 ~ /^[a-z].*/ {print $1}' Finds all usernames that start with a letter. 24

25 Bash functions small piece of code that can be used repeatedly function NAME () { } local a= $1 b= $ return VAL example: function revjoin () { # usage: revjoin a b --> ba local a= $1 b= $2... echo ${b}${a} } revjoin hot dog 25

26 see Introduction to Unix More... p01_unix.html or as PDF file cdl IntroductiontoUNIX.pdf assignment (will be posted on Blackboard) 26

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

CENG 334 Computer Networks. Laboratory I Linux Tutorial

CENG 334 Computer Networks. Laboratory I Linux Tutorial CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction

More information

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version... Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview

More information

5/20/2007. Touring Essential Programs

5/20/2007. Touring Essential Programs Touring Essential Programs Employing fundamental utilities. Managing input and output. Using special characters in the command-line. Managing user environment. Surveying elements of a functioning system.

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up

More information

5/8/2012. Exploring Utilities Chapter 5

5/8/2012. Exploring Utilities Chapter 5 Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.

More information

DAVE LIDDAMENT INTRODUCTION TO BASH

DAVE LIDDAMENT INTRODUCTION TO BASH DAVE LIDDAMENT INTRODUCTION TO BASH @daveliddament FORMAT Short lectures Practical exercises (help each other) Write scripts LEARNING OBJECTIVES What is Bash When should you use Bash Basic concepts of

More information

Introduction of Linux

Introduction of Linux Introduction of Linux 阳 oslab2018_class1@163.com 寅 oslab2018_class2@163.com PART I Brief Introduction Basic Conceptions & Environment Install & Configure a Virtual Machine Basic Commands PART II Shell

More information

Using bash. Administrative Shell Scripting COMP2101 Fall 2017

Using bash. Administrative Shell Scripting COMP2101 Fall 2017 Using bash Administrative Shell Scripting COMP2101 Fall 2017 Bash Background Bash was written to replace the Bourne shell The Bourne shell (sh) was not a good candidate for rewrite, so bash was a completely

More information

Open up a terminal, make sure you are in your home directory, and run the command.

Open up a terminal, make sure you are in your home directory, and run the command. More Linux Commands 0.1 wc The Linux command for acquiring size statistics on a file is wc. This command can provide information from line count, to bytes in a file. Open up a terminal, make sure you are

More information

Perl and R Scripting for Biologists

Perl and R Scripting for Biologists Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications

More information

Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades Q2

Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades Q2 Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades 2017-2018 Q2 Facultat d Informàtica de Barcelona This first lab session is focused on getting experience in working

More information

Lecture 4. Log into Linux Reminder: Homework 1 due today, 4:30pm Homework 2 out, due next Tuesday Project 1 out, due next Thursday Questions?

Lecture 4. Log into Linux Reminder: Homework 1 due today, 4:30pm Homework 2 out, due next Tuesday Project 1 out, due next Thursday Questions? Lecture 4 Log into Linux Reminder: Homework 1 due today, 4:30pm Homework 2 out, due next Tuesday Project 1 out, due next Thursday Questions? Tuesday, September 7 CS 375 UNIX System Programming - Lecture

More information

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )

More information

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words More Linux Commands 1 wc The Linux command for acquiring size statistics on a file is wc. This command provides the line count, word count and number of bytes in a file. Open up a terminal, make sure you

More information

Unix as a Platform Exercises. Course Code: OS-01-UNXPLAT

Unix as a Platform Exercises. Course Code: OS-01-UNXPLAT Unix as a Platform Exercises Course Code: OS-01-UNXPLAT Working with Unix 1. Use the on-line manual page to determine the option for cat, which causes nonprintable characters to be displayed. Run the command

More information

LAB 8 (Aug 4/5) Unix Utilities

LAB 8 (Aug 4/5) Unix Utilities Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).

More information

A Brief Introduction to Unix

A Brief Introduction to Unix A Brief Introduction to Unix Sean Barag Drexel University March 30, 2011 Sean Barag (Drexel University) CS 265 - A Brief Introduction to Unix March 30, 2011 1 / 17 Outline 1 Directories

More information

The Unix Shell. Pipes and Filters

The Unix Shell. Pipes and Filters The Unix Shell Copyright Software Carpentry 2010 This work is licensed under the Creative Commons Attribution License See http://software-carpentry.org/license.html for more information. shell shell pwd

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Introduction to Linux. Roman Cheplyaka

Introduction to Linux. Roman Cheplyaka Introduction to Linux Roman Cheplyaka Generic commands, files, directories What am I running? ngsuser@ubuntu:~$ cat /etc/lsb-release DISTRIB_ID=Ubuntu DISTRIB_RELEASE=16.04 DISTRIB_CODENAME=xenial DISTRIB_DESCRIPTION="Ubuntu

More information

LAB 8 (Aug 4/5) Unix Utilities

LAB 8 (Aug 4/5) Unix Utilities Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

The Unix Shell & Shell Scripts

The Unix Shell & Shell Scripts The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises

More information

Shell. SSE2034: System Software Experiment 3, Fall 2018, Jinkyu Jeong

Shell. SSE2034: System Software Experiment 3, Fall 2018, Jinkyu Jeong Shell Prof. Jinkyu Jeong (Jinkyu@skku.edu) TA -- Minwoo Ahn (minwoo.ahn@csl.skku.edu) TA -- Donghyun Kim (donghyun.kim@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu

More information

Useful Unix Commands Cheat Sheet

Useful Unix Commands Cheat Sheet Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List

More information

bash Scripting Introduction COMP2101 Winter 2019

bash Scripting Introduction COMP2101 Winter 2019 bash Scripting Introduction COMP2101 Winter 2019 Command Lists A command list is a list of one or more commands on a single command line in bash Putting more than one command on a line requires placement

More information

Files and Directories

Files and Directories CSCI 2132: Software Development Files and Directories Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Files and Directories Much of the operation of Unix and programs running on

More information

Introduction To Linux. Rob Thomas - ACRC

Introduction To Linux. Rob Thomas - ACRC Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free

More information

Introduction to Linux

Introduction to Linux Introduction to Linux January 2011 Don Bahls User Consultant (Group Leader) bahls@arsc.edu (907) 450-8674 Overview The shell Common Commands File System Organization Permissions Environment Variables I/O

More information

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking

More information

The Shell. EOAS Software Carpentry Workshop. September 20th, 2016

The Shell. EOAS Software Carpentry Workshop. September 20th, 2016 The Shell EOAS Software Carpentry Workshop September 20th, 2016 Getting Started You need to download some files to follow this lesson. These files are found on the shell lesson website (see etherpad) 1.

More information

About this course 1 Recommended chapters... 1 A note about solutions... 2

About this course 1 Recommended chapters... 1 A note about solutions... 2 Contents About this course 1 Recommended chapters.............................................. 1 A note about solutions............................................... 2 Exercises 2 Your first script (recommended).........................................

More information

Shells & Shell Programming (Part B)

Shells & Shell Programming (Part B) Shells & Shell Programming (Part B) Software Tools EECS2031 Winter 2018 Manos Papagelis Thanks to Karen Reid and Alan J Rosenthal for material in these slides CONTROL STATEMENTS 2 Control Statements Conditional

More information

Exercise 1: Basic Tools

Exercise 1: Basic Tools Exercise 1: Basic Tools This exercise is created so everybody can learn the basic tools we will use during this course. It is really more like a tutorial than an exercise and, you are not required to submit

More information

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen Introduction to Unix The Windows User perspective Wes Frisby Kyle Horne Todd Johansen What is Unix? Portable, multi-tasking, and multi-user operating system Software development environment Hardware independent

More information

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University Lecture 8 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control 22-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor:

More information

Essentials for Scientific Computing: Bash Shell Scripting Day 3

Essentials for Scientific Computing: Bash Shell Scripting Day 3 Essentials for Scientific Computing: Bash Shell Scripting Day 3 Ershaad Ahamed TUE-CMS, JNCASR May 2012 1 Introduction In the previous sessions, you have been using basic commands in the shell. The bash

More information

IB047. Unix Text Tools. Pavel Rychlý Mar 3.

IB047. Unix Text Tools. Pavel Rychlý Mar 3. Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):

More information

Shell scripting and system variables. HORT Lecture 5 Instructor: Kranthi Varala

Shell scripting and system variables. HORT Lecture 5 Instructor: Kranthi Varala Shell scripting and system variables HORT 59000 Lecture 5 Instructor: Kranthi Varala Text editors Programs built to assist creation and manipulation of text files, typically scripts. nano : easy-to-learn,

More information

Introduction: What is Unix?

Introduction: What is Unix? Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix

More information

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80 CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure

More information

The UNIX Shells. Computer Center, CS, NCTU. How shell works. Unix shells. Fetch command Analyze Execute

The UNIX Shells. Computer Center, CS, NCTU. How shell works. Unix shells. Fetch command Analyze Execute Shells The UNIX Shells How shell works Fetch command Analyze Execute Unix shells Shell Originator System Name Prompt Bourne Shell S. R. Bourne /bin/sh $ Csh Bill Joy /bin/csh % Tcsh Ken Greer /bin/tcsh

More information

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2 CSE Linux VM For Microsoft Windows Based on opensuse Leap 42.2 Dr. K. M. Flurchick February 2, 2017 Contents 1 Introduction 1 2 Requirements 1 3 Procedure 1 4 Usage 3 4.1 Start/Stop.................................................

More information

Introduction to Linux

Introduction to Linux Introduction to Linux University of Bristol - Advance Computing Research Centre 1 / 47 Operating Systems Program running all the time Interfaces between other programs and hardware Provides abstractions

More information

CS 307: UNIX PROGRAMMING ENVIRONMENT KATAS FOR EXAM 2

CS 307: UNIX PROGRAMMING ENVIRONMENT KATAS FOR EXAM 2 CS 307: UNIX PROGRAMMING ENVIRONMENT KATAS FOR EXAM 2 Prof. Michael J. Reale Fall 2014 COMMAND KATA 7: VARIABLES Command Kata 7: Preparation First, go to ~/cs307 cd ~/cs307 Make directory dkata7 and go

More information

Review of Fundamentals. Todd Kelley CST8207 Todd Kelley 1

Review of Fundamentals. Todd Kelley CST8207 Todd Kelley 1 Review of Fundamentals Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 GPL the shell SSH (secure shell) the Course Linux Server RTFM vi general shell review 2 These notes are available on

More information

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010 Principles of Bioinformatics BIO540/STA569/CSI660 Fall 2010 Lecture Five Practical Computing Skills Emphasis This time it s concrete, not abstract. Fall 2010 BIO540/STA569/CSI660 3 Administrivia Monday

More information

UNIX System Programming Lecture 3: BASH Programming

UNIX System Programming Lecture 3: BASH Programming UNIX System Programming Outline Filesystems Redirection Shell Programming Reference BLP: Chapter 2 BFAQ: Bash FAQ BMAN: Bash man page BPRI: Bash Programming Introduction BABS: Advanced Bash Scripting Guide

More information

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical

More information

UNIX files searching, and other interrogation techniques

UNIX files searching, and other interrogation techniques UNIX files searching, and other interrogation techniques Ways to examine the contents of files. How to find files when you don't know how their exact location. Ways of searching files for text patterns.

More information

Introduction to the shell Part II

Introduction to the shell Part II Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility

More information

Review of Fundamentals

Review of Fundamentals Review of Fundamentals 1 The shell vi General shell review 2 http://teaching.idallen.com/cst8207/14f/notes/120_shell_basics.html The shell is a program that is executed for us automatically when we log

More information

Unix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois

Unix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No

More information

CSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209

CSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209 CSC209 Software Tools and Systems Programming https://mcs.utm.utoronto.ca/~209 What is this Course About? Software Tools Using them Building them Systems Programming Quirks of C The file system System

More information

Linux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015

Linux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015 Linux command line basics III: piping commands for text processing Yanbin Yin Fall 2015 1 h.p://korflab.ucdavis.edu/unix_and_perl/unix_and_perl_v3.1.1.pdf 2 The beauty of Unix for bioinformagcs sort, cut,

More information

Practical Session 0 Introduction to Linux

Practical Session 0 Introduction to Linux School of Computer Science and Software Engineering Clayton Campus, Monash University CSE2303 and CSE2304 Semester I, 2001 Practical Session 0 Introduction to Linux Novell accounts. Every Monash student

More information

Scripting Languages Course 1. Diana Trandabăț

Scripting Languages Course 1. Diana Trandabăț Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language

More information

CISC 220 fall 2011, set 1: Linux basics

CISC 220 fall 2011, set 1: Linux basics CISC 220: System-Level Programming instructor: Margaret Lamb e-mail: malamb@cs.queensu.ca office: Goodwin 554 office phone: 533-6059 (internal extension 36059) office hours: Tues/Wed/Thurs 2-3 (this week

More information

Lab 2: Linux/Unix shell

Lab 2: Linux/Unix shell Lab 2: Linux/Unix shell Comp Sci 1585 Data Structures Lab: Tools for Computer Scientists Outline 1 2 3 4 5 6 7 What is a shell? What is a shell? login is a program that logs users in to a computer. When

More information

Unix Basics. Benjamin S. Skrainka University College London. July 17, 2010

Unix Basics. Benjamin S. Skrainka University College London. July 17, 2010 Unix Basics Benjamin S. Skrainka University College London July 17, 2010 Overview We cover basic Unix survival skills: Why you need some Unix in your life How to get some Unix in your life Basic commands

More information

EECS 470 Lab 5. Linux Shell Scripting. Friday, 1 st February, 2018

EECS 470 Lab 5. Linux Shell Scripting. Friday, 1 st February, 2018 EECS 470 Lab 5 Linux Shell Scripting Department of Electrical Engineering and Computer Science College of Engineering University of Michigan Friday, 1 st February, 2018 (University of Michigan) Lab 5:

More information

Introduction to UNIX Command Line

Introduction to UNIX Command Line Introduction to UNIX Command Line Files and directories Some useful commands (echo, cat, grep, find, diff, tar) Redirection Pipes Variables Background processes Remote connections (e.g. ssh, curl) Scripts

More information

Recap From Last Time:

Recap From Last Time: Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

BGGN 213 Working with UNIX Barry Grant

BGGN 213 Working with UNIX Barry Grant BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Linux shell & shell scripting - II

Linux shell & shell scripting - II IBS 574 - Computational Biology & Bioinformatics Spring 2018, Tuesday (02/01), 2:00-4:00PM Linux shell & shell scripting - II Ashok R. Dinasarapu Ph.D Scientist, Bioinformatics Dept. of Human Genetics,

More information

Linux Shell Scripting. Linux System Administration COMP2018 Summer 2017

Linux Shell Scripting. Linux System Administration COMP2018 Summer 2017 Linux Shell Scripting Linux System Administration COMP2018 Summer 2017 What is Scripting? Commands can be given to a computer by entering them into a command interpreter program, commonly called a shell

More information

Shell Programming Systems Skills in C and Unix

Shell Programming Systems Skills in C and Unix Shell Programming 15-123 Systems Skills in C and Unix The Shell A command line interpreter that provides the interface to Unix OS. What Shell are we on? echo $SHELL Most unix systems have Bourne shell

More information

Introduction to Linux Part 1. Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017

Introduction to Linux Part 1. Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017 Introduction to Linux Part 1 Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system kp001 kp002. kpxxx FastX

More information

LING 408/508: Computational Techniques for Linguists. Lecture 5

LING 408/508: Computational Techniques for Linguists. Lecture 5 LING 408/508: Computational Techniques for Linguists Lecture 5 Last Time Installing Ubuntu 18.04 LTS on top of VirtualBox Your Homework 2: did everyone succeed? Ubuntu VirtualBox Host OS: MacOS or Windows

More information

QUESTION BANK ON UNIX & SHELL PROGRAMMING-502 (CORE PAPER-2)

QUESTION BANK ON UNIX & SHELL PROGRAMMING-502 (CORE PAPER-2) BANK ON & SHELL PROGRAMMING-502 (CORE PAPER-2) TOPIC 1: VI-EDITOR MARKS YEAR 1. Explain set command of vi editor 2 2011oct 2. Explain the modes of vi editor. 7 2013mar/ 2013 oct 3. Explain vi editor 5

More information

CSCI 2132: Software Development. Norbert Zeh. Faculty of Computer Science Dalhousie University. Shell Scripting. Winter 2019

CSCI 2132: Software Development. Norbert Zeh. Faculty of Computer Science Dalhousie University. Shell Scripting. Winter 2019 CSCI 2132: Software Development Shell Scripting Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Reading Glass and Ables, Chapter 8: bash Your Shell vs Your File Manager File manager

More information

Chapter 9. Shell and Kernel

Chapter 9. Shell and Kernel Chapter 9 Linux Shell 1 Shell and Kernel Shell and desktop enviroment provide user interface 2 1 Shell Shell is a Unix term for the interactive user interface with an operating system A shell usually implies

More information

Exploring UNIX: Session 3

Exploring UNIX: Session 3 Exploring UNIX: Session 3 UNIX file system permissions UNIX is a multi user operating system. This means several users can be logged in simultaneously. For obvious reasons UNIX makes sure users cannot

More information

CS246 Spring14 Programming Paradigm Notes on Linux

CS246 Spring14 Programming Paradigm Notes on Linux 1 Unix History 1965: Researchers from Bell Labs and other organizations begin work on Multics, a state-of-the-art interactive, multi-user operating system. 1969: Bell Labs researchers, losing hope for

More information

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the

More information

More Scripting and Regular Expressions. Todd Kelley CST8207 Todd Kelley 1

More Scripting and Regular Expressions. Todd Kelley CST8207 Todd Kelley 1 More Scripting and Regular Expressions Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 Regular Expression Summary Regular Expression Examples Shell Scripting 2 Do not confuse filename globbing

More information

CS CS Tutorial 2 2 Winter 2018

CS CS Tutorial 2 2 Winter 2018 CS CS 230 - Tutorial 2 2 Winter 2018 Sections 1. Unix Basics and connecting to CS environment 2. MIPS Introduction & CS230 Interface 3. Connecting Remotely If you haven t set up a CS environment password,

More information

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26,

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26, Part III Shell Config Compact Course @ Max-Planck, February 16-26, 2015 33 Special Directories. current directory.. parent directory ~ own home directory ~user home directory of user ~- previous directory

More information

Log into Linux Reminders: Homework 1 due today; Homework 2 due on Thursday Questions?

Log into Linux Reminders: Homework 1 due today; Homework 2 due on Thursday Questions? Lecture 4 Log into Linux Reminders: Homework 1 due today; Homework 2 due on Thursday Questions? Tuesday, September 8 CS 375 UNIX System Programming - Lecture 4 1 Outline Exercise from last lecture More

More information

Introduction to Supercomputing

Introduction to Supercomputing Introduction to Supercomputing TMA4280 Introduction to UNIX environment and tools 0.1 Getting started with the environment and the bash shell interpreter Desktop computers are usually operated from a graphical

More information

Chapter-3. Introduction to Unix: Fundamental Commands

Chapter-3. Introduction to Unix: Fundamental Commands Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system

More information

CSE 390a Lecture 3. bash shell continued: processes; multi-user systems; remote login; editors

CSE 390a Lecture 3. bash shell continued: processes; multi-user systems; remote login; editors CSE 390a Lecture 3 bash shell continued: processes; multi-user systems; remote login; editors slides created by Marty Stepp, modified by Jessica Miller and Ruth Anderson http://www.cs.washington.edu/390a/

More information

STATS Data Analysis using Python. Lecture 15: Advanced Command Line

STATS Data Analysis using Python. Lecture 15: Advanced Command Line STATS 700-002 Data Analysis using Python Lecture 15: Advanced Command Line Why UNIX/Linux? As a data scientist, you will spend most of your time dealing with data Data sets never arrive ready to analyze

More information

Advanced training. Linux components Command shell. LiLux a.s.b.l.

Advanced training. Linux components Command shell. LiLux a.s.b.l. Advanced training Linux components Command shell LiLux a.s.b.l. alexw@linux.lu Kernel Interface between devices and hardware Monolithic kernel Micro kernel Supports dynamics loading of modules Support

More information

UNIX, GNU/Linux and simple tools for data manipulation

UNIX, GNU/Linux and simple tools for data manipulation UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka

More information

6.033 Computer System Engineering

6.033 Computer System Engineering MIT OpenCourseWare http://ocw.mit.edu 6.033 Computer System Engineering Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. M.I.T. DEPARTMENT

More information

Practical Linux examples: Exercises

Practical Linux examples: Exercises Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,

More information

Introduction to UNIX. SURF Research Boot Camp April Jeroen Engelberts Consultant Supercomputing

Introduction to UNIX. SURF Research Boot Camp April Jeroen Engelberts Consultant Supercomputing Introduction to UNIX SURF Research Boot Camp April 2018 Jeroen Engelberts jeroen.engelberts@surfsara.nl Consultant Supercomputing Outline Introduction to UNIX What is UNIX? (Short) history of UNIX Cartesius

More information

Introduction to Linux Workshop 1

Introduction to Linux Workshop 1 Introduction to Linux Workshop 1 The George Washington University SEAS Computing Facility Created by Jason Hurlburt, Hadi Mohammadi, Marco Suarez hurlburj@gwu.edu Logging In The lab computers will authenticate

More information

CSC 2500: Unix Lab Fall 2016

CSC 2500: Unix Lab Fall 2016 CSC 2500: Unix Lab Fall 2016 IO Redirection Mohammad Ashiqur Rahman Department of Computer Science College of Engineering Tennessee Tech University Agenda Standard IO IO Redirection Pipe Various File Processing

More information

CSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection

CSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection 1 CSE 390a Lecture 2 Exploring Shell Commands, Streams, and Redirection slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 2 Lecture summary Unix

More information

Basic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018

Basic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018 Basic Shell Scripting Practice HPC User Services LSU HPC & LON sys-help@loni.org March 2018 Quotation Exercise 1. Print out your $LOGNAME 2. Print date 3. Print `who am i` 4. Print your current directory

More information

LOG ON TO LINUX AND LOG OFF

LOG ON TO LINUX AND LOG OFF EXPNO:1A LOG ON TO LINUX AND LOG OFF AIM: To know how to logon to Linux and logoff. PROCEDURE: Logon: To logon to the Linux system, we have to enter the correct username and password details, when asked,

More information

UNIX COMMANDS AND SHELLS. UNIX Programming 2015 Fall by Euiseong Seo

UNIX COMMANDS AND SHELLS. UNIX Programming 2015 Fall by Euiseong Seo UNIX COMMANDS AND SHELLS UNIX Programming 2015 Fall by Euiseong Seo What is a Shell? A system program that allows a user to execute Shell functions (internal commands) Other programs (external commands)

More information

Linux at the Command Line Don Johnson of BU IS&T

Linux at the Command Line Don Johnson of BU IS&T Linux at the Command Line Don Johnson of BU IS&T We ll start with a sign in sheet. We ll end with a class evaluation. We ll cover as much as we can in the time allowed; if we don t cover everything, you

More information

How to Create a NetBeans PHP Project

How to Create a NetBeans PHP Project How to Create a NetBeans PHP Project 1. SET UP PERMISSIONS FOR YOUR PHP WEB SITE... 2 2. CREATE NEW PROJECT ("PHP APPLICATION FROM REMOTE SERVER")... 2 3. SPECIFY PROJECT NAME AND LOCATION... 2 4. SPECIFY

More information

Linux Essentials. Programming and Data Structures Lab M Tech CS First Year, First Semester

Linux Essentials. Programming and Data Structures Lab M Tech CS First Year, First Semester Linux Essentials Programming and Data Structures Lab M Tech CS First Year, First Semester Adapted from PDS Lab 2014 and 2015 Login, Logout, Password $ ssh mtc16xx@192.168.---.--- $ ssh X mtc16xx@192.168.---.---

More information