Development of a pipeline for SNPs detection
|
|
|
- Christina Merritt
- 5 years ago
- Views:
Transcription
1 Development of a pipeline for SNPs detection : Détection, Gestion et Analyse du Polymorphisme Des Génomes Végétaux 9, 10 et 11 Juin
2 I. Background and objectives of the pipeline Setting up a pipeline of SNPs detection to meet the needs of various projects.
3 II. Rated software BWA: software of Mapping, particularly suitable for alignment of Short Reads against one sequence of reference (Burrows - Wheeler Alignment tool). open source!!! SAM tools: toolkit for working on the output file of BWA. VarScan: software used to filter SNPs and indels from a BAM file, obtained from SAM tools. predict SNPs / Indels / Seq. Cns. Tablet: software used to view differents file formats (GFF3, ACE, AFG, MAQ, SOAP, SAM et BAM). GenomeView: software used to view differents file formats (BAM, GFF, FASTA et annotation file).
4 II. Software selected Format : Pileup vs VarScan Pileup C10HBa0111D09_LR T 24,,,,.,,.,,,,,,,.,,,,,,^],^], ZZZZTZZZXZZZZZZZZZZVXVUV C10HBa0111D09_LR G 24,$,,,.,,.,,,,,,,.,,,,,,,, ZZZZZZZZZZZZZZZZZTTZVVVX C10HBa0111D09_LR C 24,,,.,$,.,,,,,,,.,,,,,,,,^]. ZZZZZZZZZZZYLXZSQWZTQSQZ C10HBa0111D09_LR C 23,,,.,.,,,,,,,.,,,,,,,,. ZZZZZZZYZZRZWZWJJROQUKZ C10HBa0111D09_LR T 24,$,,.,.,,,,,,,.,,,,,,,,.^], ZZZQZZZZZZZZZZZZZZVVVVZU C10HBa0111D09_LR T 27,,.,.,,,,,,,.,,,,,,,,.,^],^],^],^], ZZTZZZZZZZZZZZZZZZZVTZXVUVV C10HBa0111D09_LR A 28,$,$.,.,,,,,,,.,,,,,,,,.,,,,,^F, ZZKZTZZZZZZZZZZZZZZZZZXVUNXU C10HBa0111D09_LR A 28 T,.,,,,,,,.,,,,,,,,.,,,,,,^],^], AZZZZZZZZZZZZZZZZZZZXVZXXVTT Reference Seq. Name Base In this Position Informations For All Short Reads Base Quality Position In Ref. Number Of Short Reads In this Position
5 II. Software selected Format : Pileup vs VarScan VarScan Chrom Position Ref Var Reads1 Reads2 VarFreq Strands1 Strands2 Qual1 Qual2 Pvalue scaffold_ C T ,86% scaffold_ T G ,33% scaffold_ G A % scaffold_ A G ,33% scaffold_ T C ,33% scaffold_ A C ,67% scaffold_ A C ,33% scaffold_ T C ,29% Min coverage: 8 Min reads2: 2 Min var freq: 0.01 Min avg qual: 15 P-value thresh: 0.99 Reading input from STDIN bases in pileup file met minimum coverage of 8x SNPs predicted Different Filters Choose your values!
6 II. Software selected Tablet: SNPs view
7 II. Software selected Tablet: SNPs view
8 II. Software selected GenomeView: SNPs view
9 Return to homepage Tools III. Integration of tools in Galaxy Managment of Galaxy History Link to URGI website
10 URGI public site
11 III.1. How to provide your data to Galaxy? a. Tools Get Data Upload File b. Choice of file format c. Browse your files d. Execute Help
12 III.1. How to provide your data to Galaxy? Waiting Ongoing Finished Error Finished OK
13 III.2. How to use a tool on Galaxy? a. Choose a tool from the list b. Set options and parameters c. Execute Help
14 III.2. How to use a tool on Galaxy? Output Input
15 III.3. How to integrate a tool in Galaxy? We can easily integrate a new tool!!!
16 III.4. Our worklow for SNPs detection. Input Reference Input Short Reads VarScan Tablet GenomeView Header Fasta Filter BWA VarScan Filter: - allele frequency - pvalue - base quality -... ou Sam to Bam SAM tools Bam to Pileup
17 III.5. How to do this workflow with Galaxy? Click here!
18 III.5. How to do this workflow with Galaxy? Input Dataset
19 III.5. How to do this workflow with Galaxy? Bwa Parameters, Help,
20 III.5. How to do this workflow with Galaxy? Link the two tools
21 III.5. How to do this workflow with Galaxy? Sam to Bam
22 III.5. How to do this workflow with Galaxy? Bam to Pileup
23 III.5. How to do this workflow with Galaxy? Tablet
24 III.5. How to do this workflow with Galaxy? Tablet
25 III.6. How to launch the workflow with Galaxy? a. Choose the workflow from the list b. Set options and parameters c. Execute
26 III.6. How to launch the workflow with Galaxy? All steps appear in the history! All generated files are available...
27 III.7. Results in Tablet
28 III.7. Results in Tablet
29 IV. Validation Process 1. Tests on public data (NCBI A. thaliana and V. vinifera). 2. Tests on data from Tomato (pair ends, 36 bps) and Poplar (pair ends, 70 bps) with comparison of EPGV and GAFL results (project PlanteReseq INRA). 3. Validation / modification of pipeline steps with the help of users. 4. Implementation and final validation of the pipeline with the ANR projects (GrapeReseq and Muscares).
30 V. Outlook Try other tools for mapping / SNPs calling (according to validation). Insert data into our databases: SNPs and Indels in GnpSNP - GnpGenome Contigs and Clusters in GnpSeq Put the pipeline on our website! BWA Parallelization on our clusters. Visualization of results in Gbrowse.
31 V. Outlook
32 V. Outlook beyond SNP detection Interoperability with the BioMart GnpIS URGI server. Extension of the system with other tools and pipelines (IBISA ). Link to Galaxy
33 Acknowledgement URGV URGV Anne-Francoise ADAM Patricia FAIVRE RAMPANT URGI Nathalie CHOISNE EPGV Dominique BRUNEL URGI Sebastien REBOUX EPGV Marie-Christine LE PASLIER URGI Olivier INIZAN EPGV Stéphane SCHLUB URGI Nacer MOHELLIBI URGI Delphine STEINBACH GAFL Stéphane MUNOS URGI Hadi QUESNEVILLE GAFL Jean-Paul BOUCHET
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
Seminar Plant Genomics rd-4th-5th April 2012 Pont Royal en Provence
GnpInteGr Genomique végétale Edi5on 2007 01 Jan 2008-30 Sept 2009 Coord. Delphine Steinbach, INRA URGI Versailles Total cost: 265 keuros Total grant: 74 keuros Seminar Plant Genomics 2012 3rd-4th-5th April
INTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
NGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
NGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT
Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
Sequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
Under the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
Helpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
Analyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
Dindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
Handling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
AgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
Data Walkthrough: Background
Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will
Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
Variation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
Practical exercises Day 2. Variant Calling
Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant
RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
Using Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
Sequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
Variant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis
Variant Calling and Filtering for SNPs
Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp
v0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
Welcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /
From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1
Tablet Documentation. Release Information Computational Sciences, The James Hutton Institute
Tablet Documentation Release 1.17.08.17 Information Computational Sciences, The James Hutton Institute Sep 11, 2017 Getting started 1 Quickstart 3 1.1 Opening assemblies...........................................
Input files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:
Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq
The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
Genome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
NGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis
Importing sequence assemblies from BAM and SAM files
BioNumerics Tutorial: Importing sequence assemblies from BAM and SAM files 1 Aim With the BioNumerics BAM import routine, a sequence assembly in BAM or SAM format can be imported in BioNumerics. A BAM
Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
ChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
DNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
DevOps Ignition to reach Galaxy continuous integration
DevOps Ignition to reach Galaxy continuous integration Olivier Inizan, Mikael Loaec, Jonathan Kreplak and Hadi Quesneville. INRA URGI, RD 10 route de Saint Cyr 78026 Versailles Cedex NOM DE L AUTEUR /
Using Galaxy to provide a NGS Analysis Platform
11/15/11 Using Galaxy to provide a NGS Analysis Platform Friedrich Miescher Institute - part of the Novartis Research Foundation - affiliated institute of Basel University - member of Swiss Institute of
Mapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
MiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux
User's Guide to DNASTAR SeqMan NGen 12.0 For Windows, Macintosh and Linux DNASTAR, Inc. 2014 Contents SeqMan NGen Overview...7 Wizard Navigation...8 Non-English Keyboards...8 Before You Begin...9 The
Exome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
Falcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
Local Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
mtdna Variant Processor v1.0 BaseSpace App Guide
mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters
Using Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan
Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low
ChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
Illumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
Performing whole genome SNP analysis with mapping performed locally
BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation
CNV-seq Manual. Xie Chao. May 26, 2011
CNV-seq Manual Xie Chao May 26, 20 Introduction acgh CNV-seq Test genome X Genomic fragments Reference genome Y Test genome X Genomic fragments Reference genome Y 2 Sampling & sequencing Whole genome microarray
MetaStorm: User Manual
MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To
v0.3.0 May 18, 2016 SNPsplit operates in two stages:
May 18, 2016 v0.3.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
Resequencing and Mapping. Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria
Resequencing and Mapping Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria The Principle of Mapping reads good, ood_, d_mo, morn, orni, ning, ing_, g_be, beau, auti, utif,
Lecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
The BEDTools manual. Aaron R. Quinlan and Ira M. Hall University of Virginia. Contact:
The BEDTools manual Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 6 1.1 BACKGROUND...6 1.2 SUMMARY OF AVAILABLE TOOLS...7 1.3 FUNDAMENTAL CONCEPTS
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS
Copy Number Variations Detection - TD. Using Sequenza under Galaxy
Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES
BioMart: a research data management tool for the biomedical sciences
Yale University From the SelectedWorks of Rolando Garcia-Milian 2014 BioMart: a research data management tool for the biomedical sciences Rolando Garcia-Milian, Yale University Available at: https://works.bepress.com/rolando_garciamilian/2/
Tutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017
Identification of Variants Using GATK November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
WheatIS: Progress report
WheatIS: Progress report WheatIS Annual meeting, San Diego, 9 January 2015 WheatIS data submission DSpace Beta-version to test: http://urgi.versailles.inra.fr/xmlui/ At the moment, available submission
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
Bioinformatics Services for HT Sequencing
Bioinformatics Services for HT Sequencing Tyler Backman, Rebecca Sun, Thomas Girke December 19, 2008 Bioinformatics Services for HT Sequencing Slide 1/18 Introduction People Service Overview and Rates
Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun
Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality
Bioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
Rsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
Sequence mapping and assembly. Alistair Ward - Boston College
Sequence mapping and assembly Alistair Ward - Boston College Sequenced a genome? Fragmented a genome -> DNA library PCR amplification Sequence reads (ends of DNA fragment for mate pairs) We no longer have
Genome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
![NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab](/thumbs/74/70633133.jpg "NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab")
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
Galaxy. Daniel Blankenberg The Galaxy Team
Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing
Creating and Using Genome Assemblies Tutorial
Creating and Using Genome Assemblies Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Create a Genome Assembly for Danio rerio 2 2. Building Annotation Sources 5 A. Creating a Reference
Calling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
Advanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
Rsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab
Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!
Galaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
Practical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential
The BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia
The BEDTools manual Last updated: 21-September-2010 Current as of BEDTools version 2.10.0 Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 7 1.1 BACKGROUND...7