Archives. Gather and compress Campus-Booster ID : **XXXXX. Copyright SUPINFO. All rights reserved
|
|
|
- Bruce Rogers
- 5 years ago
- Views:
Transcription
1 Archives Gather and compress Campus-Booster ID : **XXXXX Copyright SUPINFO. All rights reserved
2 Archives Your trainer Presenter s Name Title: **Enter title or job role. Accomplishments: **What makes the presenter qualified to present this course. Education: **List degrees if important. Publications: **Writings by the presenter on the subject of the course or presentation. Contact: **Campus-Booster ID: presenter@supinfo.com
3 Archives Course objectives By completing this course, you will: n Archive vs Compress. Know to explain the difference. n Use tarballs and cpio archives. Create and work with them. n (Un)Compress files. Using gzip and bzip2.
4 Archives Course topics Course s plan: n Archives and compression. What s the difference? n Working with archives. Tarballs and friends. n Standalone compression. Compress single files. n Related tools. Using zless, zcat, and bzip2 counterparts.
5 Archives Archives and Compression What s the difference?
6 Archives and Compression Archives Two files, one archive n File format n Metadata on content n Gather multiple files in one n Not necessary compressed n Backup tapes/disks n Multi-volumes
7 Archives and Compression Compression Reducing size n Mathematical algorithms n Non-destructive n Same amount of information n Less space n Reversible: Consume CPU time n Destructive n Removes irrelevant data
8 Archives and Compression Compressed archives Putting it all together. n Applying compression on n Whole archive n Individual portions (files) within archive n Most common form of archives n *.zip n *.rar n *.tar.bz2 n *.tar.gz
9 Archives and Compression Part 1 Stop-and-think Do you have any questions?
10 Archives Working with tar And tarballs
11 Working with tar What s tar Know your tools. n Seasoned archiver n Widely used n De facto standard n Received many improvements n User friendly n Can handle files by itself n Can chain-up to a compression tool n
12 Working with tar Listing n To list a gzip ed archive content: [user@linux ~]$ tar -tvzf archive.tar.gz n Short form: [user@linux ~]$ tar -tf archive.tar.gz n Options : n -v: verbose mode n -z: to compress or decompress *.gz n -j: to compress or decompress *.bz2 n -f: specify the archive to work on
13 Working with tar Extracting n To extract a bzip ed archive in the current directory: [user@linux ~]$ tar -xvjf archive.tar.bz2 n Short form: [user@linux ~]$ tar -xf archive.tar.bz2 n Options : n -x: extract mode n -C: Extract to a specified directory
14 Working with tar Creating n To a archive a directory: [user@linux ~]$ tar -cvzf archive.tar.gz directory n To archive several elements: [user@linux ~]$ tar -cvzf archive.tar.gz d1 d2 f1 f2 n Options : n -v: verbose mode n -c: to create an archive
15 Working with tar Part 2 Stop-and-think Do you have any questions?
16 Working with tar Part 2 Stop-and-think Tar switches: Who s doing what? -c -x -f -C -t Archive file Create mode Extract mode Listing mode Extract to
17 Working with tar Part 2 Stop-and-think Tar switches: Who s who? -c -x -f -C -t Archive file Create mode Extract mode Listing mode Extract to
18 Archives Working with cpio Good ol times
19 Working with cpio What s cpio Know your tools. n Very old tool n One of the first archive tool n Superseded by tar n Still used for specific tasks n Very Unixish n Doesn t directly read archives n Need to be fed in n Standard streams
20 Working with cpio Listing n To list a cpio archive content: [user@linux ~]$ cpio it < archive.cpio n Or: [user@linux ~]$ cat archive.cpio cpio -it n Options : n -i: input mode (cpio expects archive data on STDIN) n -t: listing mode
21 Working with cpio Extracting n To extract a cpio archive: [user@linux ~]$ cpio id < archive.cpio n Or: [user@linux ~]$ cat archive.cpio cpio -id n Options : n -d: extracting mode
22 Working with cpio Creating n To archive the current directory content: [user@linux ~]$ find cpio ov > archive.cpio n To archive /home: [user@linux ~]$ find /home cpio ov > archive.cpio n Options : n -o: Ouput mode (cpio expects filenames on STDIN and writes archive data on STDOUT) n -v: Verbose mode
23 Working with cpio Part 3 Stop-and-think Do you have any questions?
24 Working with cpio Part 3 Stop-and-think About cpio: In copy-in mode (-i), cpio does: Pick correct answers: Read filenames on STDIN Write archive data on STDOUT Reads archive data on STDIN Write information on STDOUT
25 Working with cpio Part 3 Stop-and-think About cpio: In copy-in mode (-i), cpio does: Pick correct answers: Read filenames on STDIN Write archive data on STDOUT Reads archive data on STDIN Write information on STDOUT
26 Working with cpio Part 3 Stop-and-think About cpio: In copy-out mode (-o), cpio does: Pick correct answers: Read filenames on STDIN Write archive data on STDOUT Reads archive data on STDIN Write information on STDOUT
27 Working with cpio Part 3 Stop-and-think About cpio: In copy-in mode (-i), cpio does: Pick correct answers: Read filenames on STDIN Write archive data on STDOUT Reads archive data on STDIN Write information on STDOUT
28 Archives Standalone Compression Compress single files
29 Standalone comression Bzip and bzip2 Know your tools. n Both n Pay attention to file extensions n Delete original when compressing/ uncompressing n Gzip vs bzip2 n Bz2 better but significantly slower n Go for size with bz2 n Go for speed with gz
30 Standalone compression (Un)Compress with gzip n To compress a file: [user@linux ~]$ gzip file n Options: n -# 1..9: Compression level n 1 faster, 9 best. Default 6 n To uncompress a file: [user@linux ~]$ gzip -d file.gz [user@linux ~]$ gunzip file.gz
31 Standalone compression (Un)Compress with bzip2 n To compress a file: [user@linux ~]$ bzip2 file n Options: n -# 1..9: Compression level n 1 faster, 9 best. Default 6 n To uncompress a file: [user@linux ~]$ bzip2 -d file.bz2 [user@linux ~]$ bunzip2 file.bz2
32 Standalone compression Part 4 Stop-and-think Do you have any questions?
33 Archives Related tools Dodgin the extension filter
34 Related tools Toolbox Implicit uncompress. n Very handy n Bypass extension filter n Keep source intact n Gz and bz2 versions n Automated scripts n (bz z)cat n (bz z)less n Use redirections
35 Standalone compression (bz z)cat n To cat a file: n To STDOUT [user@linux ~]$ zcat /proc/config.gz n Or to a file [user@linux ~]$ zcat /proc/config.gz > kconfig n With a bzip ed file that doesn t have the proper ext. [user@linux ~]$ bzcat file
36 Standalone compression (bz z)less n To see a file: n Without explicit uncompress [user@linux ~]$ zless /proc/config.gz n Keeping the original (compressed) safe : [user@linux ~]$ zless my-text-file.gz n With a bzip ed file that doesn t have the proper ext. [user@linux ~]$ bzless bziped-text-file
37 Standalone compression Stop-and-think Do you have any questions?
38 Archives Course summary Standalone compression Archive vs Compression Related tools Tar archives Cpio archives
39 Archives For more If you want to go into these subjects more deeply, Publications Courses Linux Technologies: Edge Computing Linux in a nutshell Web sites Conferences FOSDEM RMLL Solutions Linux
40 Congratulations You have successfully completed the SUPINFO course module n 04 Archives
41 Archives The end n Don t bother with z or j: tar is smart enough to guess n Go bzip2 for size and gzip for speed
Your daily cup of CLI
Your daily cup of CLI Powerful Unix tools Campus-Booster ID : **XXXXX www.supinfo.com Copyright SUPINFO. All rights reserved Your daily cup of CLI Your trainer Presenter s Name Title: **Enter title or
Filesystem and common commands
Filesystem and common commands Unix computing basics Campus-Booster ID : **XXXXX www.supinfo.com Copyright SUPINFO. All rights reserved Filesystem and common commands Your trainer Presenter s Name Title:
Access Control Lists. Beyond POSIX permissions Campus-Booster ID : **XXXXX. Copyright SUPINFO. All rights reserved
Access Control Lists Beyond POSIX permissions Campus-Booster ID : **XXXXX www.supinfo.com Copyright SUPINFO. All rights reserved Access Control Lists Your trainer Presenter s Name Title: **Enter title
Processes. System tasks Campus-Booster ID : **XXXXX. Copyright SUPINFO. All rights reserved
Processes System tasks Campus-Booster ID : **XXXXX www.supinfo.com Copyright SUPINFO. All rights reserved Processes Your trainer Presenter s Name Title: **Enter title or job role. Accomplishments: **What
Sudo: Switch User Do. Administrative Privileges Delegation Campus-Booster ID : **XXXXX. Copyright SUPINFO. All rights reserved
Sudo: Switch User Do Administrative Privileges Delegation Campus-Booster ID : **XXXXX www.supinfo.com Copyright SUPINFO. All rights reserved Sudo: Switch User Do Your trainer Presenter s Name Title: **Enter
CS 307: UNIX PROGRAMMING ENVIRONMENT WORKING WITH FILES AND COLLECTIONS OF FILES
CS 307: UNIX PROGRAMMING ENVIRONMENT WORKING WITH FILES AND COLLECTIONS OF FILES Prof. Michael J. Reale Fall 2014 Credit Where Credit Is Due Prof. Nick Merante s notes: http://web.cs.sunyit.edu/~merantn/cs307/
7. Archiving and compressing 7.1 Introduction
7. Archiving and compressing 7.1 Introduction In this chapter, we discuss how to manage archive files at the command line. File archiving is used when one or more files need to be transmitted or stored
CS Unix Tools. Fall 2010 Lecture 8. Hussam Abu-Libdeh based on slides by David Slater. September 24, 2010
Fall 2010 Lecture 8 Hussam Abu-Libdeh based on slides by David Slater September 24, 2010 Compression & Archiving zip / unzip Compress and archive (bundle) files into a single file. A new compressed.zip
Utilities. September 8, 2015
Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow
Ubuntu unzip tar file
Ubuntu unzip tar file Search I received a huge.tar.gz file from a client that contains. What command do I need to unzip/extract a.tar.gz file?. Unable to unzip a file with the ubuntu. 16-11-2017 How to
Unzip command in unix
Unzip command in unix Search 24-4-2015 Howto Extract Zip Files in a Linux and. You need to use the unzip command on a Linux or Unix like system. The nixcraft takes a lot of my time and. 16-4-2010 Howto:
Lab #1 Installing a System Due Friday, September 6, 2002
Lab #1 Installing a System Due Friday, September 6, 2002 Name: Lab Time: Grade: /10 The Steps of Installing a System Today you will install a software package. Implementing a software system is only part
Read the relevant material in Sobell! If you want to follow along with the examples that follow, and you do, open a Linux terminal.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
Unix unzip zip compress uncompress zip zip zip zip Extracting zip Unzip ZIP Unix Unix zip extracting ZIP zip zip unzip zip unzip zip Unix zipped
Unix unzip zip Jan 28, 2011. Typically one uses tar to create an uncompressed archive and either gzip or bzip2 to compress that archive. The corresponding gunzip and bunzip2 commands can be used to uncompress
CS Unix Tools & Scripting
Cornell University, Spring 2014 1 January 29, 2014 1 Slides evolved from previous versions by Hussam Abu-Libdeh and David Slater Vim: Tip of the day! Search and Replace Search for search term: /search
Introduction to the shell Part II
Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility
First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
Fall Lecture 5. Operating Systems: Configuration & Use CIS345. The Linux Utilities. Mostafa Z. Ali.
Fall 2009 Lecture 5 Operating Systems: Configuration & Use CIS345 The Linux Utilities Mostafa Z. Ali mzali@just.edu.jo 1 1 The Linux Utilities Linux did not have a GUI. It ran on character based terminals
Unix - Basics Course on Unix and Genomic Data Prague, January 2017
Unix - Basics Course on Unix and Genomic Data Prague, January 2017 Libor Mořkovský, Václav Janoušek, Anastassiya Zidkova, Anna Přistoupilová, Filip Sedlák http://ngs-course.readthedocs.org/en/praha-january-2017/
Essential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across
Practical Unix exercise MBV INFX410
Practical Unix exercise MBV INFX410 We will in this exercise work with a practical task that, it turns out, can easily be solved by using basic Unix. Let us pretend that an engineer in your group has spent
Practical Knowledge Transfering, moving and exporting files Martin Dahlö
Practical Knowledge Transfering, moving and exporting files 160318 Martin Dahlö martin.dahlo@scilifelab.uu.se UPPMAX Moving files to and from UPPMAX Moving files within UPPMAX Compressing files Web export
Linux unzip multiple zip files
Linux unzip multiple zip files How to unzip a multipart (spanned) ZIP on Linux?. This answer gives a complete list of commands to split, merge and unzip a large file on unix. Zip many files into several
Handling Ordinary Files
Handling Ordinary Files Unit 2 Sahaj Computer Solutions visit : projectsatsahaj.com 1 cat: Displaying and Creating Files cat is one of the most frequently used commands on Unix-like operating systems.
Unzip linux tgz. Search
Unzip linux tgz Search 本文介绍了 linux 下的压缩程式 tar gzip gunzip bzip2 bunzip2 compress uncompress zip unzip rar unrar 等程式, 以及如何使用它们. Excelente, nunca está de mas. Yo también guardo post/notas jajaja, saludos!
User Commands GZIP ( 1 )
NAME gzip, gunzip, gzcat compress or expand files SYNOPSIS gzip [ acdfhllnnrtvv19 ] [ S suffix] [ name... ] gunzip [ acfhllnnrtvv ] [ S suffix] [ name... ] gzcat [ fhlv ] [ name... ] DESCRIPTION Gzip reduces
Session: Shell Programming Topic: Additional Commands
Lecture Session: Shell Programming Topic: Additional Commands Daniel Chang diff [-b][-i][-w] filename1 filename2 diff [-b][-i][-w] filename1 directory1 diff [-b][-i][-w][-r] directory1 directory2 Description:
Opera Web Browser Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server ftp.opera.com Description Opera Web Browser Archive Country United States Scan Date 04/Nov/2015 Total Dirs 1,557 Total Files 2,211 Total Data 43.83 GB Top 20 Directories Sorted
Lecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
The KBackup Handbook. Martin Koller
Martin Koller 2 Contents 1 Introduction 5 2 Using KBackup 6 2.1 Using profiles........................................ 6 2.2 Archive slices........................................ 7 2.3 Incremental Backup.....................................
Archive Assistant. (AppleScript) [Manual updated: ]
![Archive Assistant. (AppleScript) [Manual updated: ]](/thumbs/93/111202452.jpg "Archive Assistant. (AppleScript) [Manual updated: ]")
Archive Assistant (AppleScript) [Manual updated: 2017-04-23] Installation 1 What the Script does and how it works 1 Step by step 2 Explained 4 Add to Existing Archive 4 Run in Terminal vs normal mode 4
First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings Linux Commands 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material
Package Management System
Package Management System The name "package" is used in Linux for an application with all of its Supported files. A package management system is a collection of tools to automate the process of installing,
Introduction to Linux Organizing Files
Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing
Using the Device File Systems, Directories, and Files
Using the Device File Systems, Directories, and Files This chapter describes how to use your device file systems, directories, and files. Finding Feature Information, on page 1 Licensing Requirements for
Computer Systems and Architecture
Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,
backupchecker Documentation
backupchecker Documentation Release 1.9 Carl Chenet Apr 13, 2017 Contents 1 Guide 3 1.1 How to install Backup Checker..................................... 3 1.2 Configuration
1 Introduction Creating tar archives Extracting tar archives Creating tarballs Extracting tarballs...
Department of Computer Science COS132 Lecture Notes: Archives January 2014 Copyright c 2014 by Vreda Pieterse. All rights reserved. Contents 1 Introduction................................. 2 2 Creating
CSE 390a Lecture 6. bash scripting continued; remote X windows; unix tidbits
1 CSE 390a Lecture 6 bash scripting continued; remote X windows; unix tidbits slides created by Marty Stepp, modified by Jessica Miller and Ruth Anderson http://www.cs.washington.edu/390a/ Lecture summary
Tux Paint Project Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Tux Paint Project Archive - FTP Site Statistics Property Value FTP Server ftp.tuxpaint.org Description Tux Paint Project Archive Country United States Scan Date 03/Sep/2015 Total Dirs 328 Total Files 1,692
Aventail Advanced Reporting Installation Instructions
Aventail Advanced Reporting Installation Instructions 1996-2006 Aventail Corporation. All rights reserved. Aventail, Aventail Cache Control, Aventail Connect, Aventail Connect Mobile, Aventail Connect
Linux command line basics II: downloading data and controlling files. Yanbin Yin
Linux command line basics II: downloading data and controlling files Yanbin Yin 1 Things you should know about programming Learning programming has to go through the hands-on practice, a lot of practice
Linux Software Management. Linux System Administration COMP2018 Summer 2017
Linux Software Management Linux System Administration COMP2018 Summer 2017 OSS Distribution And Installation Open Source Software at its simplest is just source code distributed by any of several means
User Manual. version Copyright 2006 Paloş & Sons LTD. Copyright 2006 Paloş & Sons LTD. All rights reserved! Page 1/26
User Manual Copyright 2006 Paloş & Sons LTD. version 0.1.2 Copyright 2006 Paloş & Sons LTD. All rights reserved! Page 1/26 Table of Contents 1) Introduction 2) Features and requirements 3) Installing psarchive
Running Programs in UNIX 1 / 30
Running Programs in UNIX 1 / 30 Outline Cmdline Running Programs in UNIX Capturing Output Using Pipes in UNIX to pass Input/Output 2 / 30 cmdline options in BASH ^ means "Control key" cancel a running
Introduction to Unix. University of Massachusetts Medical School. October, 2014
.. Introduction to Unix University of Massachusetts Medical School October, 2014 . DISCLAIMER For the sake of clarity, the concepts mentioned in these slides have been simplified significantly. Most of
FREEENGINEER.ORG. 1 of 6 11/5/15 8:31 PM. Learn UNIX in 10 minutes. Version 1.3. Preface
FREEENGINEER.ORG Learn UNIX in 10 minutes. Version 1.3 Preface This is something that I had given out to students (CAD user training) in years past. The purpose was to have on one page the basics commands
MUC Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
MUC Archive - FTP Site Statistics Property Value FTP Server ftp.muc.de Description MUC Archive Country Germany Scan Date 16/Nov/2015 Total Dirs 237 Total Files 1,033 Total Data 839.68 MB Top 20 Directories
client X11 Linux workstation
LPIC1 LPIC Linux: System Administrator LPIC 1 LPI command line LPIC-1 Linux LPIC-1 client X11 Linux workstation Unix GNU Linux Fundamentals Unix and its Design Principles FSF and GNU GPL - General Public
HugeServer Networks Software Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server mirror.lax.hugeserver.com Description HugeServer Networks Software Archive Country United States Scan Date 28/Dec/2015 Total Dirs 3,510 Total Files 162,243 Total Data 365.86 GB
Binary Analysis Tool
Binary Analysis Tool Quick Start Guide This tool was developed by: Sponsored by Version 4 Table of Contents Getting and installing the tool...3 Technical requirements...3 Get the tool...3 Confirm it is
Introduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
1Z Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions
1Z0-409 Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions Table of Contents Introduction to 1Z0-409 Exam on Oracle Linux Fundamentals (Oracle Partner Network)... 2 Oracle
02. At the command prompt, type usermod -l bozo bozo2 and press Enter to change the login name for the user bozo2 back to bozo. => steps 03.
Laboratory Exercises: ===================== Complete the following laboratory exercises. All steps are numbered but not every step includes a question. You only need to record answers for those steps that
XEmacs Project Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server ftp.ie.xemacs.org Description XEmacs Project Archive Country Ireland Scan Date 31/Oct/2014 Total Dirs 677 Total Files 4,166 Total Data 4.40 GB Top 20 Directories Sorted by Disk
z/os Hybrid Batch Processing
An Introduction To Hybrid Batch Processing Steve Goetze Kirk Wolf steve@dovetail.com kirk@dovetail.com Copyright 2012 Dovetailed Technologies, LLC 1 Trademarks Co:Z is a registered trademark of Dovetailed
UoW HPC Quick Start. Information Technology Services University of Wollongong. ( Last updated on October 10, 2011)
UoW HPC Quick Start Information Technology Services University of Wollongong ( Last updated on October 10, 2011) 1 Contents 1 Logging into the HPC Cluster 3 1.1 From within the UoW campus.......................
OVERVIEW... 1 WHAT IS A BAG?... 1 BAGGING...
Bagger OVERVIEW... 1 WHAT IS A BAG?... 1 BAGGING... 3 WHICH WAY IS BETTER?... 3 BAG A COPY... 4 BAG IN PLACE... 12 VALIDATING... 14 APPENDIX A: INSTALLING & RUNNING BAGGER... 16 INSTALLING THE APPLICATION...
Critical Analysis and last hour guide for RHCSA/RHCE Enterprise 7
Critical Analysis and last hour guide for RHCSA/RHCE Enterprise 7 Disclaimer: I haven t gone through RHCSA/RHCE EL 7. I am preparing for upgrade of my RHCE certificate from RHCE EL4 to RHCE EL7. I don
Computer Systems and Architecture
Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,
CSC UNIX System, Spring 2015
CSC 352 - UNIX System, Spring 2015 Study guide for the CSC352 midterm exam (20% of grade). Dr. Dale E. Parson, http://faculty.kutztown.edu/parson We will have a midterm on March 19 on material we have
Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/
Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux
File: PLT File Format Libraries
File: PLT File Format Libraries Version 4.0 June 11, 2008 1 Contents 1 gzip Compression and File Creation 3 2 gzip Decompression 4 3 zip File Creation 6 4 tar File Creation 7 5 MD5 Message Digest 8 6 GIF
Indiana University - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server spout.ussg.indiana.edu Description Indiana University Country United States Scan Date 19/Sep/2015 Total Dirs 307,997 Total Files 7,483,851 Total Data 7.55 TB Top 20 Directories
Prerequisites: General computing knowledge and experience. No prior knowledge with Linux is required. Supported Distributions:
This course prepares students to take the 101 exam of the LPI level 1 certification. The Linux Professional Institute (LPI) is the go to certification body for vendor independent Linux certifications.
Heilbronn University - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Heilbronn University - FTP Site Statistics Property Value FTP Server ftp.fh-heilbronn.de Description Heilbronn University Country Germany Scan Date 16/May/2014 Total Dirs 8,120 Total Files 124,014 Total
UNIX Quick Reference
UNIX Quick Reference This card represents a brief summary of some of the more frequently used UNIX commands that all users should be at least somewhat familiar with. Some commands listed have much more
Introduction to Unix/Linux INX_S17, Day 6,
Introduction to Unix/Linux INX_S17, Day 6, 2017-04-17 Installing binaries, uname, hmmer and muscle, public data (wget and sftp) Learning Outcome(s): Install and run software from your home directory. Download
CDNetworks Software Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server centos.mirror.cdnetworks.com Description CDNetworks Software Archive Country United States Scan Date 15/Dec/2015 Total Dirs 14,260 Total Files 474,003 Total Data 344.35 GB Top
GWDG Software Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
GWDG Software Archive - FTP Site Statistics Property Value FTP Server ftp5.gwdg.de Description GWDG Software Archive Country Germany Scan Date 18/Jan/2016 Total Dirs 1,068,408 Total Files 30,248,505 Total
Linux Essentials. Smith, Roderick W. Table of Contents ISBN-13: Introduction xvii. Chapter 1 Selecting an Operating System 1
Linux Essentials Smith, Roderick W. ISBN-13: 9781118106792 Table of Contents Introduction xvii Chapter 1 Selecting an Operating System 1 What Is an OS? 1 What Is a Kernel? 1 What Else Identifies an OS?
Unix Introduction. Part 3
Unix Introduction Part 3 More Unix Commands cat more head tail Working with files Now that you can navigate directories and move files around, you need to be able to work with the files and directories
Prerequisites: Students must be proficient in general computing skills but not necessarily experienced with Linux or Unix. Supported Distributions:
This GL124 course is designed to follow an identical set of topics as the Red Hat RH124 course with the added benefit of very comprehensive lab exercises and detailed lecture material. The Red Hat Enterprise
AVM Networks - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server ftp.avm.de Description AVM Networks Country Germany Scan Date 12/May/2014 Total Dirs 2,056 Total Files 2,698 Total Data 39.66 GB Top 20 Directories Sorted by Disk Space Name Dirs
APPROPRIATE TECHNOLOGY LIBRARY
APPROPRIATE TECHNOLOGY LIBRARY How to set up and access the files on your DVDs. First of all, thank you for purchasing this package from us. We are glad to offer it, and to try to get this information
computer user has lost data at some point, perhaps because of a corrupted file or accidental
CHAPTER 31 Backing Up Data Every computer user knows that backing up data is vital. This is usually because every computer user has lost data at some point, perhaps because of a corrupted file or accidental
Spango Internet - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server mirror1.spango.com Description Spango Internet Country Netherlands Scan Date 03/Jun/2014 Total Dirs 2,707 Total Files 53,097 Total Data 183.64 GB Top 20 Directories Sorted by
Don t be alarmed when you see the MEPIS command-line interface, AKA the
Chapter 27 Dipping a Toe Into the Command-line Waters By Joe Barr Don t be alarmed when you see the MEPIS command-line interface, AKA the CLI. You don't have to go there if you don't want to. 215 Point
7 zip linux gui. Search
7 zip linux gui Search p7zip-gui Ubuntu-Pakete Im Gegensatz zum für Windows verfügbaren 7-Zip verfügen die in den Paketquellen vieler Linux-Distributionen vorhandenen. 8-1-2010 Is there a 7z gui for linux?
2 Installing the Software
INSTALLING 19 2 Installing the Software 2.1 Installation Remember the hour or two of slogging through software installation I promised (or warned) you about in the introduction? Well, it s here. Unless
University of Duisburg-Essen - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
University of Duisburg-Essen - FTP Site Statistics Property Value FTP Server ftp.ihg.uni-duisburg.de Description University of Duisburg-Essen Country Germany Scan Date 20/Nov/2015 Total Dirs 3,871 Total
Unix/Linux Operating System. Introduction to Computational Statistics STAT 598G, Fall 2011
Unix/Linux Operating System Introduction to Computational Statistics STAT 598G, Fall 2011 Sergey Kirshner Department of Statistics, Purdue University September 7, 2011 Sergey Kirshner (Purdue University)
Linux Nuts and Bolts
Linux Nuts and Bolts David Morgan At the command line Cursor control type to insert del/ctrl-d to delete home/end for endpoints Filename completion tab after initial characters Command repetition uparrow
Introduction to Linux. Roman Cheplyaka
Introduction to Linux Roman Cheplyaka Generic commands, files, directories What am I running? ngsuser@ubuntu:~$ cat /etc/lsb-release DISTRIB_ID=Ubuntu DISTRIB_RELEASE=16.04 DISTRIB_CODENAME=xenial DISTRIB_DESCRIPTION="Ubuntu
University of the Free State - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
University of the Free State - FTP Site Statistics Property Value FTP Server mirror.ufs.ac.za Description University of the Free State Country South Africa Scan Date 13/Jun/2014 Total Dirs 444,986 Total
UNIX and Linux Essentials Student Guide
UNIX and Linux Essentials Student Guide D76989GC10 Edition 1.0 June 2012 D77816 Authors Uma Sannasi Pardeep Sharma Technical Contributor and Reviewer Harald van Breederode Editors Anwesha Ray Raj Kumar
CSE 390a Lecture 6. bash scripting continued; remote X windows; unix tidbits
CSE 390a Lecture 6 bash scripting continued; remote X windows; unix tidbits slides created by Marty Stepp, modified by Jessica Miller and Ruth Anderson http://www.cs.washington.edu/390a/ 1 Lecture summary
Unit: Making a move (using FTP)
Data Introduction to Unix and HPC (HPC for Wimps) Unit: Making a move (using FTP) Goals: Can login via Secure FTP and see home directory. Can transfer a file from local machine via FTP to home directory.
Linux Fundamentals (L-120)
Linux Fundamentals (L-120) Modality: Virtual Classroom Duration: 5 Days SUBSCRIPTION: Master, Master Plus About this course: This is a challenging course that focuses on the fundamental tools and concepts
File: Racket File Format Libraries
File: Racket File Format Libraries Version 5.0.2 November 6, 2010 1 Contents 1 gzip Compression and File Creation 3 2 gzip Decompression 4 3 zip File Creation 6 4 tar File Creation 7 5 MD5 Message Digest
http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
Introduction to GACRC Storage Environment. Georgia Advanced Computing Resource Center University of Georgia Zhuofei Hou, HPC Trainer
Introduction to GACRC Storage Environment Georgia Advanced Computing Resource Center University of Georgia Zhuofei Hou, HPC Trainer zhuofei@uga.edu Outline What is GACRC? Overview of Linux Commands GACRC
Introduction to Command Line Linux
Eric Nodwell Copyright 2003 Eric Nodwell This document can be freely redistributed according to the terms of the GNU General Public License. Permission is granted to copy, distribute and/or modify this
Introduction to GACRC Storage Environment. Georgia Advanced Computing Resource Center University of Georgia Zhuofei Hou, HPC Trainer
Introduction to GACRC Storage Environment Georgia Advanced Computing Resource Center University of Georgia Zhuofei Hou, HPC Trainer zhuofei@uga.edu 1 Outline What is GACRC? Overview of Linux Commands GACRC
Rzeszow University Of Technology - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server ns2.prz-rzeszow.pl Description Rzeszow University Of Technology Country Poland Scan Date 02/Aug/2014 Total Dirs 1,124 Total Files 13,092 Total Data 48.96 GB Top 20 Directories
LINUX FUNDAMENTALS (5 Day)
www.peaklearningllc.com LINUX FUNDAMENTALS (5 Day) Designed to provide the essential skills needed to be proficient at the Unix or Linux command line. This challenging course focuses on the fundamental
List of Linux Commands in an IPm
List of Linux Commands in an IPm Directory structure for Executables bin: ash cpio false ln mount rm tar zcat busybox date getopt login mv rmdir touch cat dd grep ls perl sed true chgrp df gunzip mkdir
Using Linux as a Virtual Machine
Intro to UNIX Using Linux as a Virtual Machine We will use the VMware Player to run a Virtual Machine which is a way of having more than one Operating System (OS) running at once. Your Virtual OS (Linux)
Backschues Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space
Property Value FTP Server ftp.backschues.net Description Backschues Archive Country Germany Scan Date 13/Apr/2014 Total Dirs 467 Total Files 1,623 Total Data 6.1 Top 20 Directories Sorted by Disk Space