Overview. Unix/Regex Lab. 1. Setup & Unix review. 2. Count words in a text. 3. Sort a list of words in various ways. 4.

Size: px
Start display at page:

Download "Overview. Unix/Regex Lab. 1. Setup & Unix review. 2. Count words in a text. 3. Sort a list of words in various ways. 4."

Transcription

1 Overview Unix/Regex Lab CS 341: Natural Language Processing Heather Pon-Barry 1. Setup & Unix review 2. Count words in a text 3. Sort a list of words in various ways 4. Search with grep Based on Unix For Poets (by Ken Church) 5. Two-minute response

2 Setting Up 1. Setup & Unix Review In your home directory, make a cs341 folder Make a directory called unixforpoets for today s lab activity

3 Unix Tools pwd ls cd <dirname> cd../ less <filename> head <filename> tail <filename> man <command> piping > < CTRL-C grep: search for a pattern (regular expression) sort uniq c (count duplicates) tr (translate characters) wc (word or line count) cat (send file(s) in stream) sed (edit string -- replacement)

4 Counting lines, words, characters 2. Count words in a text wc alice.txt alice.txt

5 tr command NAME tr - translate or delete characters SYNOPSIS tr [OPTION]... SET1 [SET2] DESCRIPTION Translate, squeeze, and/or delete characters from standard input, writing to standard output. -c complement of SET1 -s, if SET2 is specified, squeezes repeated SET2 characters to a single character --help display this help and exit Counting Words Input: mini-alice.txt; alice.txt Output: list of words with freq counts Algorithm 1. Create a file with one token per line (tr -sc ) 2. Sort (sort) 3. Count duplicates (uniq c) Practice using tr, sort, and uniq incrementally on mini-alice.txt Once you understand each step, run your command on alice.txt

6 Output head and tail 632 a 1 abide 1 able 94 about 3 above 1 absence 2 absurd 1 acceptance 2 accident 1 accidentally... Solution: tr -sc A-Za-z \n < alice.txt sort (hidden) uniq -c head gives you the first n lines (n=10 by default; can specify n with flag - n) tr -sc A-Za-z \n < alice.txt sort uniq -c head n a 1 abide 1 able 94 about 3 above what do you think tail does?

7 Most Frequent Words Exercise 3. Sort a list of words in various ways Find the 50 most common words in alice.txt Hint: Use sort a second time, then head

8 grep 4. Search with grep Grep finds patterns specified as regular expressions globally search for regular expression and print

9 grep Try this: grep cheshire alice.txt it s a cheshire cat said the duchess and that s why pig she said the last word with such sudden violence that alice quite jumped but she saw in another moment that it was addressed to the baby and not to her so she took courage and went on again i didn t know that cheshire cats always grinned in fact i didn t know that cats could grin Next, try grepping other phrases grep Make an intermediary words file: tr -sc A-Za-z \n < alice.txt > alice.words Finding words ending in ing: grep 'ing$' alice.words sort uniq c

10 grep Take-home Message grep is a filter you keep only some lines of the input Try these on alice.words grep gh keep lines containing gh grep ˆcon keep lines beginning with con grep ing$ keep lines ending with ing grep v gh keep lines NOT containing gh Piping commands together can be simple yet powerful in Unix grep i [aeiou].*[aeiou] keep lines with two or more vowels grep i ˆ[ˆaeiou]*[aeiou][ˆaeiou]*$ keep lines with exactly one vowel

11 5. Two-minute response

12 Two-minute Response In Piazza, post a Note to Instructor only: 1. What is one thing you understand better after today s activity? Extra Exercises 2. What is something that s still unclear on/a question you have?

13 Sorting exercises Exercises on grep & wc In alice.txt Find the words in alice.txt that end in ling using sorting (and not using grep) Hint: what does this do? tr -sc 'A-Za-z' '\n' < alice.txt sort uniq head rev How many 4-letter words? How many different words are there with no vowels What subtypes do they belong to? How many 1 syllable words are there That is, ones with exactly one vowel Answer these with respect to word types, not word tokens

14 grep We used the following to keep lines with exactly one vowel grep i ˆ[ˆaeiou]*[aeiou][ˆaeiou]* $ What would happen if we instead used the command? In what contexts is this important? grep i [ˆaeiou]*[aeiou][ˆaeiou]*

CS 124/LINGUIST 180 From Languages to Information. Unix for Poets Dan Jurafsky

CS 124/LINGUIST 180 From Languages to Information. Unix for Poets Dan Jurafsky CS 124/LINGUIST 180 From Languages to Information Unix for Poets Dan Jurafsky (original by Ken Church, modifications by me and Chris Manning) Stanford University Unix for Poets Text is everywhere The Web

More information

CS 124/LINGUIST 180 From Languages to Information

CS 124/LINGUIST 180 From Languages to Information CS 124/LINGUIST 180 From Languages to Information Unix for Poets Dan Jurafsky (original by Ken Church, modifications by Chris Manning) Stanford University Unix for Poets (based on Ken Church s presentation)

More information

Unix for Poets (in 2016) Christopher Manning Stanford University Linguistics 278

Unix for Poets (in 2016) Christopher Manning Stanford University Linguistics 278 Unix for Poets (in 2016) Christopher Manning Stanford University Linguistics 278 Operating systems The operating system wraps the hardware, running the show and providing abstractions Abstractions of processes

More information

COL100 Lab 2. I semester Week 2, Open the web-browser and visit the page and visit the COL100 course page.

COL100 Lab 2. I semester Week 2, Open the web-browser and visit the page   and visit the COL100 course page. COL100 Lab 2 I semester 2017-18 Week 2, 2017 Objective More familiarisation with Linux and its standard commands Part 1 1. Login to your system and open a terminal window. 2. Open the web-browser and visit

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

538 Text processing basics

538 Text processing basics 538 Text processing basics Jianguo Lu, University of Windsor September 12, 2018 Lu September 12, 2018 1 / 26 Table of contents 1 Unix commands grep command join command Lu September 12, 2018 2 / 26 View

More information

5/8/2012. Exploring Utilities Chapter 5

5/8/2012. Exploring Utilities Chapter 5 Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.

More information

commands exercises Linux System Administration and IP Services AfNOG 2015 Linux Commands # Notes

commands exercises Linux System Administration and IP Services AfNOG 2015 Linux Commands # Notes Linux System Administration and IP Services AfNOG 2015 Linux Commands # Notes * Commands preceded with "$" imply that you should execute the command as a general user not as root. * Commands preceded with

More information

IB047. Unix Text Tools. Pavel Rychlý Mar 3.

IB047. Unix Text Tools. Pavel Rychlý Mar 3. Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):

More information

Unix L555. Dept. of Linguistics, Indiana University Fall Unix. Unix. Directories. Files. Useful Commands. Permissions. tar.

Unix L555. Dept. of Linguistics, Indiana University Fall Unix. Unix. Directories. Files. Useful Commands. Permissions. tar. L555 Dept. of Linguistics, Indiana University Fall 2010 1 / 21 What is? is an operating system, like DOS or Windows developed in 1969 by Bell Labs works well for single computers as well as for servers

More information

Introduction To Linux. Rob Thomas - ACRC

Introduction To Linux. Rob Thomas - ACRC Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free

More information

CENG 334 Computer Networks. Laboratory I Linux Tutorial

CENG 334 Computer Networks. Laboratory I Linux Tutorial CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction

More information

Introduction to Linux

Introduction to Linux Introduction to Linux University of Bristol - Advance Computing Research Centre 1 / 47 Operating Systems Program running all the time Interfaces between other programs and hardware Provides abstractions

More information

Practical Session 0 Introduction to Linux

Practical Session 0 Introduction to Linux School of Computer Science and Software Engineering Clayton Campus, Monash University CSE2303 and CSE2304 Semester I, 2001 Practical Session 0 Introduction to Linux Novell accounts. Every Monash student

More information

Laboratory 1 Semester 1 11/12

Laboratory 1 Semester 1 11/12 CS2106 National University of Singapore School of Computing Laboratory 1 Semester 1 11/12 MATRICULATION NUMBER: In this lab exercise, you will get familiarize with some basic UNIX commands, editing and

More information

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up

More information

The Unix Shell. Pipes and Filters

The Unix Shell. Pipes and Filters The Unix Shell Copyright Software Carpentry 2010 This work is licensed under the Creative Commons Attribution License See http://software-carpentry.org/license.html for more information. shell shell pwd

More information

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview

More information

Lab #2 Physics 91SI Spring 2013

Lab #2 Physics 91SI Spring 2013 Lab #2 Physics 91SI Spring 2013 Objective: Some more experience with advanced UNIX concepts, such as redirecting and piping. You will also explore the usefulness of Mercurial version control and how to

More information

Lab Working with Linux Command Line

Lab Working with Linux Command Line Introduction In this lab, you will use the Linux command line to manage files and folders and perform some basic administrative tasks. Recommended Equipment A computer with a Linux OS, either installed

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

UNIX files searching, and other interrogation techniques

UNIX files searching, and other interrogation techniques UNIX files searching, and other interrogation techniques Ways to examine the contents of files. How to find files when you don't know how their exact location. Ways of searching files for text patterns.

More information

The Shell. EOAS Software Carpentry Workshop. September 20th, 2016

The Shell. EOAS Software Carpentry Workshop. September 20th, 2016 The Shell EOAS Software Carpentry Workshop September 20th, 2016 Getting Started You need to download some files to follow this lesson. These files are found on the shell lesson website (see etherpad) 1.

More information

Introduction to Unix

Introduction to Unix Introduction to Unix Part 1: Navigating directories First we download the directory called "Fisher" from Carmen. This directory contains a sample from the Fisher corpus. The Fisher corpus is a collection

More information

Perl and R Scripting for Biologists

Perl and R Scripting for Biologists Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications

More information

Introduction. File System. Note. Achtung!

Introduction. File System. Note. Achtung! 3 Unix Shell 1: Introduction Lab Objective: Explore the basics of the Unix Shell. Understand how to navigate and manipulate file directories. Introduce the Vim text editor for easy writing and editing

More information

CS 460 Linux Tutorial

CS 460 Linux Tutorial CS 460 Linux Tutorial http://ryanstutorials.net/linuxtutorial/cheatsheet.php # Change directory to your home directory. # Remember, ~ means your home directory cd ~ # Check to see your current working

More information

Scripting Languages Course 1. Diana Trandabăț

Scripting Languages Course 1. Diana Trandabăț Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language

More information

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP Unix Guide Meher Krishna Patel Created on : Octorber, 2017 Last updated : December, 2017 More documents are freely available at PythonDSP Table of contents Table of contents i 1 Unix commands 1 1.1 Unix

More information

ITST Searching, Extracting & Archiving Data

ITST Searching, Extracting & Archiving Data ITST 1136 - Searching, Extracting & Archiving Data Name: Step 1 Sign into a Pi UN = pi PW = raspberry Step 2 - Grep - One of the most useful and versatile commands in a Linux terminal environment is the

More information

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking

More information

Lab 1 Introduction to UNIX and C

Lab 1 Introduction to UNIX and C Name: Lab 1 Introduction to UNIX and C This first lab is meant to be an introduction to computer environments we will be using this term. You must have a Pitt username to complete this lab. NOTE: Text

More information

Introduction to Unix

Introduction to Unix Part 2: Looking into a file Introduction to Unix Now we want to see how the files are structured. Let's look into one. more $ more fe_03_06596.txt 0.59 1.92 A-f: hello 1.96 2.97 B-m: (( hello )) 2.95 3.98

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Parts of this tutorial has been adapted from M. Stonebank s UNIX Tutorial for Beginners (http://www.ee.surrey.ac.uk/teaching/unix/).

Parts of this tutorial has been adapted from M. Stonebank s UNIX Tutorial for Beginners (http://www.ee.surrey.ac.uk/teaching/unix/). Ubuntu tutorial Parts of this tutorial has been adapted from M. Stonebank s UNIX Tutorial for Beginners (http://www.ee.surrey.ac.uk/teaching/unix/). 1 Installing Ubuntu About Ubuntu For our lab sessions

More information

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt

More information

Introduction to UNIX command-line

Introduction to UNIX command-line Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions

More information

CS214-AdvancedUNIX. Lecture 2 Basic commands and regular expressions. Ymir Vigfusson. CS214 p.1

CS214-AdvancedUNIX. Lecture 2 Basic commands and regular expressions. Ymir Vigfusson. CS214 p.1 CS214-AdvancedUNIX Lecture 2 Basic commands and regular expressions Ymir Vigfusson CS214 p.1 Shellexpansions Let us first consider regular expressions that arise when using the shell (shell expansions).

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

CS160A EXERCISES-FILTERS2 Boyd

CS160A EXERCISES-FILTERS2 Boyd Exercises-Filters2 In this exercise we will practice with the Unix filters cut, and tr. We will also practice using paste, even though, strictly speaking, it is not a filter. In addition, we will expand

More information

Recap From Last Time:

Recap From Last Time: Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

BGGN 213 Working with UNIX Barry Grant

BGGN 213 Working with UNIX Barry Grant BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80 CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure

More information

Getting Started With UNIX Lab Exercises

Getting Started With UNIX Lab Exercises Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.

More information

CSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection

CSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection 1 CSE 390a Lecture 2 Exploring Shell Commands, Streams, and Redirection slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 2 Lecture summary Unix

More information

Unix Tutorial Haverford Astronomy 2014/2015

Unix Tutorial Haverford Astronomy 2014/2015 Unix Tutorial Haverford Astronomy 2014/2015 Overview of Haverford astronomy computing resources This tutorial is intended for use on computers running the Linux operating system, including those in the

More information

Digital Humanities. Tutorial Regular Expressions. March 10, 2014

Digital Humanities. Tutorial Regular Expressions. March 10, 2014 Digital Humanities Tutorial Regular Expressions March 10, 2014 1 Introduction In this tutorial we will look at a powerful technique, called regular expressions, to search for specific patterns in corpora.

More information

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking

More information

Chapter 4. Unix Tutorial. Unix Shell

Chapter 4. Unix Tutorial. Unix Shell Chapter 4 Unix Tutorial Users and applications interact with hardware through an operating system (OS). Unix is a very basic operating system in that it has just the essentials. Many operating systems,

More information

The Directory Structure

The Directory Structure The Directory Structure All the files are grouped together in the directory structure. The file-system is arranged in a hierarchical structure, like an inverted tree. The top of the hierarchy is traditionally

More information

1. Open VirtualBox and start your linux VM. Boot the machine and log in with the user account you created in Lab #1. Open the Terminal application.

1. Open VirtualBox and start your linux VM. Boot the machine and log in with the user account you created in Lab #1. Open the Terminal application. CIT 210L Name: Lab #2 1. Open VirtualBox and start your linux VM. Boot the machine and log in with the user account you created in Lab #1. Open the Terminal application. 2. Listing installed packages -

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Introduction to Biocomputing http://bioboot.github.io/web-2016/ Monday Tuesday Wednesday Thursday Friday Introduction to UNIX* Introduction

More information

Unix Tools / Command Line

Unix Tools / Command Line Unix Tools / Command Line An Intro 1 Basic Commands / Utilities I expect you already know most of these: ls list directories common options: -l, -F, -a mkdir, rmdir make or remove a directory mv move/rename

More information

- c list The list specifies character positions.

- c list The list specifies character positions. CUT(1) BSD General Commands Manual CUT(1)... 1 PASTE(1) BSD General Commands Manual PASTE(1)... 3 UNIQ(1) BSD General Commands Manual UNIQ(1)... 5 HEAD(1) BSD General Commands Manual HEAD(1)... 7 TAIL(1)

More information

Unix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois

Unix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No

More information

COSC UNIX. Textbook. Grading Scheme

COSC UNIX. Textbook. Grading Scheme COSC 2306 - UNIX Education has failed in a very serious way to convey the most important lesson science can teach: skepticism. - David Suzuki Fall 2008 Aaron Langille Textbook Linux for Programmers and

More information

CSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes

CSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes CSE 390a Lecture 2 Exploring Shell Commands, Streams, Redirection, and Processes slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture

More information

This lab exercise is to be submitted at the end of the lab session! passwd [That is the command to change your current password to a new one]

This lab exercise is to be submitted at the end of the lab session! passwd [That is the command to change your current password to a new one] Data and Computer Security (CMPD414) Lab II Topics: secure login, moving into HOME-directory, navigation on Unix, basic commands for vi, Message Digest This lab exercise is to be submitted at the end of

More information

Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades Q2

Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades Q2 Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades 2017-2018 Q2 Facultat d Informàtica de Barcelona This first lab session is focused on getting experience in working

More information

CSC209H Lecture 1. Dan Zingaro. January 7, 2015

CSC209H Lecture 1. Dan Zingaro. January 7, 2015 CSC209H Lecture 1 Dan Zingaro January 7, 2015 Welcome! Welcome to CSC209 Comments or questions during class? Let me know! Topics: shell and Unix, pipes and filters, C programming, processes, system calls,

More information

Tools for Text. Unix Pipe Fitting for Data Analysis. David A. Smith

Tools for Text. Unix Pipe Fitting for Data Analysis. David A. Smith Tools for Text Unix Pipe Fitting for Data Analysis David A. Smith 1 Tools 2 3 4 Data 5 6 6 6 Data Structures nobody:*:-2: nogroup:*:-1: wheel:*:0:root daemon:*:1:root kmem:*:2:root sys:*:3:root tty:*:4:root

More information

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater)

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) 28 January 2013 Jason Yosinski Original slides available under Creative Commons Attribution-ShareAlike 3.0

More information

Practical 02. Bash & shell scripting

Practical 02. Bash & shell scripting Practical 02 Bash & shell scripting 1 imac lab login: maclab password: 10khem 1.use the Finder to visually browse the file system (single click opens) 2.find the /Applications folder 3.open the Utilities

More information

Unix basics exercise MBV-INFX410

Unix basics exercise MBV-INFX410 Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.

More information

Lab 2: Linux/Unix shell

Lab 2: Linux/Unix shell Lab 2: Linux/Unix shell Comp Sci 1585 Data Structures Lab: Tools for Computer Scientists Outline 1 2 3 4 5 6 7 What is a shell? What is a shell? login is a program that logs users in to a computer. When

More information

bash Scripting Introduction COMP2101 Winter 2019

bash Scripting Introduction COMP2101 Winter 2019 bash Scripting Introduction COMP2101 Winter 2019 Command Lists A command list is a list of one or more commands on a single command line in bash Putting more than one command on a line requires placement

More information

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )

More information

6.033 Computer System Engineering

6.033 Computer System Engineering MIT OpenCourseWare http://ocw.mit.edu 6.033 Computer System Engineering Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. M.I.T. DEPARTMENT

More information

CS Unix Tools. Fall 2010 Lecture 5. Hussam Abu-Libdeh based on slides by David Slater. September 17, 2010

CS Unix Tools. Fall 2010 Lecture 5. Hussam Abu-Libdeh based on slides by David Slater. September 17, 2010 Fall 2010 Lecture 5 Hussam Abu-Libdeh based on slides by David Slater September 17, 2010 Reasons to use Unix Reason #42 to use Unix: Wizardry Mastery of Unix makes you a wizard need proof? here is the

More information

Chapter-3. Introduction to Unix: Fundamental Commands

Chapter-3. Introduction to Unix: Fundamental Commands Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system

More information

Introduction to Unix: Fundamental Commands

Introduction to Unix: Fundamental Commands Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University Lecture 8 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control 22-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor:

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

Introduction to Linux

Introduction to Linux Introduction to Linux M Tech CS I 2015-16 Arijit Bishnu Debapriyo Majumdar Sourav Sengupta Mandar Mitra Login, Logout, Change password $ ssh, ssh X secure shell $ ssh www.isical.ac.in $ ssh 192.168 $ logout,

More information

History. Terminology. Opening a Terminal. Introduction to the Unix command line GNOME

History. Terminology. Opening a Terminal. Introduction to the Unix command line GNOME Introduction to the Unix command line History Many contemporary computer operating systems, like Microsoft Windows and Mac OS X, offer primarily (but not exclusively) graphical user interfaces. The user

More information

CSCI 4061: Pipes and FIFOs

CSCI 4061: Pipes and FIFOs 1 CSCI 4061: Pipes and FIFOs Chris Kauffman Last Updated: Thu Oct 26 12:44:54 CDT 2017 2 Logistics Reading Robbins and Robbins Ch 6.1-6.5 OR Stevens/Rago Ch 15.1-5 Goals Sending Signals in C Signal Handlers

More information

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010 Principles of Bioinformatics BIO540/STA569/CSI660 Fall 2010 Lecture Five Practical Computing Skills Emphasis This time it s concrete, not abstract. Fall 2010 BIO540/STA569/CSI660 3 Administrivia Monday

More information

A Brief Introduction to Unix

A Brief Introduction to Unix A Brief Introduction to Unix Sean Barag Drexel University March 30, 2011 Sean Barag (Drexel University) CS 265 - A Brief Introduction to Unix March 30, 2011 1 / 17 Outline 1 Directories

More information

University of Windsor : System Programming Winter Midterm 01-1h20mn. Instructor: Dr. A. Habed

University of Windsor : System Programming Winter Midterm 01-1h20mn. Instructor: Dr. A. Habed University of Windsor 0360-256: System Programming Winter 2007 - Midterm 01-1h20mn. Instructor: Dr. A. Habed Solution Last name: First name: Student #: NONE NONE NONE Read this first Make sure your paper

More information

Introduction: What is Unix?

Introduction: What is Unix? Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix

More information

CSCI 2132 Software Development. Lecture 4: Files and Directories

CSCI 2132 Software Development. Lecture 4: Files and Directories CSCI 2132 Software Development Lecture 4: Files and Directories Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 12-Sep-2018 (4) CSCI 2132 1 Previous Lecture Some hardware concepts

More information

CS/CIS 249 SP18 - Intro to Information Security

CS/CIS 249 SP18 - Intro to Information Security Lab assignment CS/CIS 249 SP18 - Intro to Information Security Lab #2 - UNIX/Linux Access Controls, version 1.2 A typed document is required for this assignment. You must type the questions and your responses

More information

Recap From Last Time: Setup Checklist BGGN 213. Todays Menu. Introduction to UNIX.

Recap From Last Time: Setup Checklist   BGGN 213. Todays Menu. Introduction to UNIX. Recap From Last Time: BGGN 213 Introduction to UNIX Barry Grant http://thegrantlab.org/bggn213 Substitution matrices: Where our alignment match and mis-match scores typically come from Comparing methods:

More information

CSCI 2132 Software Development. Lecture 7: Wildcards and Regular Expressions

CSCI 2132 Software Development. Lecture 7: Wildcards and Regular Expressions CSCI 2132 Software Development Lecture 7: Wildcards and Regular Expressions Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 20-Sep-2017 (7) CSCI 2132 1 Previous Lecture Pipes

More information

Unix tutorial. Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based.

Unix tutorial. Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based. Unix tutorial Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based. Terminal windows You will use terminal windows to enter and execute

More information

Mineração de Dados Aplicada

Mineração de Dados Aplicada Simple but Powerful Text-Processing Commands August, 29 th 2018 DCC ICEx UFMG Unix philosophy Unix philosophy Doug McIlroy (inventor of Unix pipes). In A Quarter-Century of Unix (1994): Write programs

More information

Version Control with Git

Version Control with Git Version Control with Git Methods & Tools for Software Engineering (MTSE) Fall 2017 Prof. Arie Gurfinkel based on https://git-scm.com/book What is Version (Revision) Control A system for managing changes

More information

If you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC

If you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC If you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC sample). All examples use your Workshop directory (e.g. /Users/peggy/workshop)

More information

CS CS Tutorial 2 2 Winter 2018

CS CS Tutorial 2 2 Winter 2018 CS CS 230 - Tutorial 2 2 Winter 2018 Sections 1. Unix Basics and connecting to CS environment 2. MIPS Introduction & CS230 Interface 3. Connecting Remotely If you haven t set up a CS environment password,

More information

Intro to Linux. this will open up a new terminal window for you is super convenient on the computers in the lab

Intro to Linux. this will open up a new terminal window for you is super convenient on the computers in the lab Basic Terminal Intro to Linux ssh short for s ecure sh ell usage: ssh [host]@[computer].[otheripstuff] for lab computers: ssh [CSID]@[comp].cs.utexas.edu can get a list of active computers from the UTCS

More information

Shell. SSE2034: System Software Experiment 3, Fall 2018, Jinkyu Jeong

Shell. SSE2034: System Software Experiment 3, Fall 2018, Jinkyu Jeong Shell Prof. Jinkyu Jeong (Jinkyu@skku.edu) TA -- Minwoo Ahn (minwoo.ahn@csl.skku.edu) TA -- Donghyun Kim (donghyun.kim@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu

More information

LAB 8 (Aug 4/5) Unix Utilities

LAB 8 (Aug 4/5) Unix Utilities Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).

More information

Reading and manipulating files

Reading and manipulating files Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort

More information

The input can also be taken from a file and similarly the output can be redirected to another file.

The input can also be taken from a file and similarly the output can be redirected to another file. Filter A filter is defined as a special program, which takes input from standard input device and sends output to standard output device. The input can also be taken from a file and similarly the output

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,

More information

Introduction to Unix CHAPTER 6. File Systems. Permissions

Introduction to Unix CHAPTER 6. File Systems. Permissions CHAPTER 6 Introduction to Unix The Unix operating system is an incredibly powerful and complex system that is ideal for running a distributed system such as ours, particularly since we use computers primarily

More information

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the

More information