BIOS 546 Midterm March 26, Write the line of code that all Perl programs on biolinx must start with so they can be executed.
|
|
- Molly Webb
- 6 years ago
- Views:
Transcription
1 1. What values are false in Perl? BIOS 546 Midterm March 26, Write the line of code that all Perl programs on biolinx must start with so they can be executed. 3. How do you make a comment in Perl? How do you make a comment in HTML? 4. If you are in the /home/bio546 directory, what happens when you give the Unix command "cd.."? 5. What is the difference between "cd /junk" and "cd junk"? 6. What is the internal (biolinx) address of the directory you use to display pages on the internet? What is the external address of this directory (that you would type into the browser)? 7. a. What will: print "The number is $num\n"; give, assuming that $num = 7. b. What will: print 'The number is $num\n'; give, assuming that $num = 7. 8.What is meant by the prefixes: and % in Perl?
2 9. To test whether two scalar variable are equal you can use either "==" or "eq". Under what circumstances would you use one or the other? 10. What does the "chomp" function do? 11. Write statements that will print every item in the on a separate line. 12. Write a statement that will insert the values 2, 4, 6, 8, 10 into an array. Then, write a statement that will remove the first element of the array and put it into $var1. Then write another statement that will remove the last element of the array and put it into $var2. Note: the array should have only 3 elements after all this. 13. If has the values 1,3,5,7 in it, what will the value of $abc be after the statement: $abc
3 14. Write statements that will print all the keys to the hash %hash, sorted in alphabetical order. Also, have your code remove the key-value pair from the hash if the value is less than Write a short program that will prompt the user for a color, then print "YES" if STDIN has a color that is used as a key in the hash %stoplight (i.e. red, yellow, or green), and "NO" if STDIN has some other value. Note that I want you to first create the hash, then test the hash for the presence of those keys 16. Write a regular expression that will match the comment line of a fasta-formatted sequence file: the first character is a ">".
4 17. Modify your expression in 16 above to capture all characters up to the first space, not including the >. Then print out what you have captured Write some code that will find every instance of the word "and" in string $str and replaces it with "or". 19. Write a complete HTML page that contains the following: a. the title "HMTL Page" b. Print a large, centered headline "HEADLINE" c. A short paragraph of text. d A link to e. The picture file "cup.jpg" f. An unordered list consisting of "cat", "dog", "bird" g. A table with 2 rows and 2 columns, with "one" and "two" in the first row, and "three" and "four" in the second row.
5 20. You have 2 = ("dog", "cat", "bird", "fish") = (7, 12, 34, 1) Sort them by age, with oldest first, then print out each pet and its age on a separate line. 21. Write some code that will open $infile and $outfile, then read every line of $infile and print it into $outfile. 22. You have 3 variables: $first = "The", $second = "dog", $third = "runs". Concatenate these into a single variable $fourth that contains "The dog runs". Don't forget the spaces! 23. How would you write the number 1,000,000,000 so it would be readable by the Perl compiler? 24. What does this code do: while (<STDIN>) { print; }
6 25. Create a form that has a text box for entering your name, and a check box (or radio buttons) that convert it to upper case if checked. Also a submit button. The form should send the input to "greet.cgi" in the bios546 sub-directory in the cgi-bin on biolinx. 26 Create the "greet.cgi" program, taking the inputs from 22 above and returning an HTML page that issues a greeting to the person whose name was in the text box, in lower case as the default or in upper case if the checkbox was checked.
7 27. Write a subroutine that takes 2 numbers as input and returns both their sum and their product. Also write a statement that invokes this subroutine and then captures the results. 28. Write a regular expression that will match any character that is NOT a, c, or e, followed by 2 numbers, followed by a *. Remember that * is a metacharacter! 29. On the command line a program is invoked with: "prog2.pl yes 45 fred". How can you get the program to read the second argument (the "45") into the variable $num? 30. Write some statements that will produce the reverse complement of the DNA sequence in $seq.
They grow as needed, and may be made to shrink. Officially, a Perl array is a variable whose value is a list.
Arrays Perl arrays store lists of scalar values, which may be of different types. They grow as needed, and may be made to shrink. Officially, a Perl array is a variable whose value is a list. A list literal
More informationCOMS 3101 Programming Languages: Perl. Lecture 2
COMS 3101 Programming Languages: Perl Lecture 2 Fall 2013 Instructor: Ilia Vovsha http://www.cs.columbia.edu/~vovsha/coms3101/perl Lecture Outline Control Flow (continued) Input / Output Subroutines Concepts:
More informationPERL Scripting - Course Contents
PERL Scripting - Course Contents Day - 1 Introduction to PERL Comments Reading from Standard Input Writing to Standard Output Scalar Variables Numbers and Strings Use of Single Quotes and Double Quotes
More informationA control expression must evaluate to a value that can be interpreted as true or false.
Control Statements Control Expressions A control expression must evaluate to a value that can be interpreted as true or false. How a control statement behaves depends on the value of its control expression.
More informationExamples of Using the ARGV Array. Loop Control Operators. Next Operator. Last Operator. Perl has three loop control operators.
Examples of Using the ARGV Array # mimics the Unix echo utility foreach (@ARGV) { print $_ ; print \n ; # count the number of command line arguments $i = 0; foreach (@ARGV) { $i++; print The number of
More informationWriting Perl Programs using Control Structures Worked Examples
Writing Perl Programs using Control Structures Worked Examples Louise Dennis October 27, 2004 These notes describe my attempts to do some Perl programming exercises using control structures and HTML Forms.
More informationPERL Bioinformatics. Nicholas E. Navin, Ph.D. Department of Genetics Department of Bioinformatics. TA: Dr. Yong Wang
PERL Bioinformatics Nicholas E. Navin, Ph.D. Department of Genetics Department of Bioinformatics TA: Dr. Yong Wang UNIX Background and History PERL Practical Extraction and Reporting Language Developed
More informationBeginning Perl for Bioinformatics. Steven Nevers Bioinformatics Research Group Brigham Young University
Beginning Perl for Bioinformatics Steven Nevers Bioinformatics Research Group Brigham Young University Why Use Perl? Interpreted language (quick to program) Easy to learn compared to most languages Designed
More informationProgramming Perls* Objective: To introduce students to the perl language.
Programming Perls* Objective: To introduce students to the perl language. Perl is a language for getting your job done. Making Easy Things Easy & Hard Things Possible Perl is a language for easily manipulating
More informationHands-On Perl Scripting and CGI Programming
Hands-On Course Description This hands on Perl programming course provides a thorough introduction to the Perl programming language, teaching attendees how to develop and maintain portable scripts useful
More informationCSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80
CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure
More informationScripting Languages. Diana Trandabăț
Scripting Languages Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture What is Perl? How to install Perl? How to write Perl progams? How to run a Perl program? perl
More informationIndian Institute of Technology Kharagpur. PERL Part II. Prof. Indranil Sen Gupta Dept. of Computer Science & Engg. I.I.T.
Indian Institute of Technology Kharagpur PERL Part II Prof. Indranil Sen Gupta Dept. of Computer Science & Engg. I.I.T. Kharagpur, INDIA Lecture 22: PERL Part II On completion, the student will be able
More informationBioinformatics. Computational Methods II: Sequence Analysis with Perl. George Bell WIBR Biocomputing Group
Bioinformatics Computational Methods II: Sequence Analysis with Perl George Bell WIBR Biocomputing Group Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures Arrays
More informationCommand Interpreters. command-line (e.g. Unix shell) On Unix/Linux, bash has become defacto standard shell.
Command Interpreters A command interpreter is a program that executes other programs. Aim: allow users to execute the commands provided on a computer system. Command interpreters come in two flavours:
More informationCSCI 161: Introduction to Programming I Lab 1b: Hello, World (Eclipse, Java)
Goals - to learn how to compile and execute a Java program - to modify a program to enhance it Overview This activity will introduce you to the Java programming language. You will type in the Java program
More informationPerl. Many of these conflict with design principles of languages for teaching.
Perl Perl = Practical Extraction and Report Language Developed by Larry Wall (late 80 s) as a replacement for awk. Has grown to become a replacement for awk, sed, grep, other filters, shell scripts, C
More informationPerl. Perl. Perl. Which Perl
Perl Perl Perl = Practical Extraction and Report Language Developed by Larry Wall (late 80 s) as a replacement for awk. Has grown to become a replacement for awk, sed, grep, other filters, shell scripts,
More information(Refer Slide Time: 01:12)
Internet Technology Prof. Indranil Sengupta Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur Lecture No #22 PERL Part II We continue with our discussion on the Perl
More informationMore Scripting and Regular Expressions. Todd Kelley CST8207 Todd Kelley 1
More Scripting and Regular Expressions Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 Regular Expression Summary Regular Expression Examples Shell Scripting 2 Do not confuse filename globbing
More informationSubroutines in Perl. Jon-Michael Deldin. Dept. of Computer Science University of Montana September 12, 2011
Subroutines in Perl Jon-Michael Deldin Dept. of Computer Science University of Montana jon-michael.deldin@mso.umt.edu September 12, 2011 Jon-Michael Deldin (UM) Subroutines in Perl September 12, 2011 1
More informationMore Perl. CS174 Chris Pollett Oct 25, 2006.
More Perl CS174 Chris Pollett Oct 25, 2006. Outline Loops Arrays Hashes Functions Selection Redux Last day we learned about how if-else works in Perl. Perl does not have a switch statement Like Javascript,
More informationLearning Perl 6. brian d foy, Version 0.6, Nordic Perl Workshop 2007
Learning Perl 6 brian d foy, Version 0.6, Nordic Perl Workshop 2007 for the purposes of this tutorial Perl 5 never existed Don t really do this $ ln -s /usr/local/bin/pugs /usr/bin/perl
More informationClassnote for COMS6100
Classnote for COMS6100 Yiting Wang 3 November, 2016 Today we learn about subroutines, references, anonymous and file I/O in Perl. 1 Subroutines in Perl First of all, we review the subroutines that we had
More informationCommon File System Commands
Common File System Commands ls! List names of all files in current directory ls filenames! List only the named files ls -t! List in time order, most recent first ls -l! Long listing, more information.
More information9.1 Origins and Uses of Perl
9.1 Origins and Uses of Perl - Began in the late 1980s as a more powerful replacement for the capabilities of awk (text file processing) and sh (UNIX system administration) - Now includes sockets for communications
More informationLab 3 : Sort program
Lab : Sort program Introduction Your pointy haired Dilbert manager decided to write a Sort program which you have now inherited. The Sort program intends to emulate the main functionality of the GNU sort
More informationCSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection
1 CSE 390a Lecture 2 Exploring Shell Commands, Streams, and Redirection slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 2 Lecture summary Unix
More informationINSTITUTE OF AERONAUTICAL ENGINEERING
INSTITUTE OF AERONAUTICAL ENGINEERING Dundigal, Hyderabad -500 043 COMPUTER SCIENCE AND ENGINEERING TUTORIAL QUESTION BANK 2016-2017 Course Name : SCRIPTING LANGUAGES Course Code : A80537 Class : IV B.
More informationUnix, Perl and BioPerl
Unix, Perl and BioPerl III: Sequence Analysis with Perl - Modules and BioPerl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence analysis with Perl Modules and BioPerl Regular expressions
More informationShell Programming (Part 2)
i i Systems and Internet Infrastructure Security Institute for Networking and Security Research Department of Computer Science and Engineering Pennsylvania State University, University Park, PA Shell Programming
More informationScripting Languages Course 1. Diana Trandabăț
Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language
More informationBamuengine.com. Chapter 14. Perl The Mater Manipulator
Chapter 14. Perl The Mater Manipulator Introduciton The following sections tell you what Perl is, the variables and operators in perl, the string handling functions. The chapter also discusses file handling
More informationCOMPUTER APPLICATION
Total No. of Printed Pages 16 HS/XII/A.Sc.Com/CAP/14 2 0 1 4 COMPUTER APPLICATION ( Science / Arts / Commerce ) ( Theory ) Full Marks : 70 Time : 3 hours The figures in the margin indicate full marks for
More informationSequence analysis with Perl Modules and BioPerl. Unix, Perl and BioPerl. Regular expressions. Objectives. Some uses of regular expressions
Unix, Perl and BioPerl III: Sequence Analysis with Perl - Modules and BioPerl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence analysis with Perl Modules and BioPerl Regular expressions
More informationLecture 5/6: Scripting and Perl
Lecture 5/6: Scripting and Perl COMP 524 Programming Language Concepts Stephen Olivier January 29, 2009 and February 3, 2009 Based on notes by N. Fisher, F. Hernandez-Campos, and D. Stotts Goal of Lecture
More informationJava Applets, etc. Instructor: Dmitri A. Gusev. Fall Lecture 25, December 5, CS 502: Computers and Communications Technology
Java Applets, etc. Instructor: Dmitri A. Gusev Fall 2007 CS 502: Computers and Communications Technology Lecture 25, December 5, 2007 CGI (Common Gateway Interface) CGI is a standard for handling forms'
More informationScripting Languages Perl Basics. Course: Hebrew University
Scripting Languages Perl Basics Course: 67557 Hebrew University אליוט יפה Jaffe Lecturer: Elliot FMTEYEWTK Far More Than Everything You've Ever Wanted to Know Perl Pathologically Eclectic Rubbish Lister
More informationPHP Reference. To access MySQL manually, run the following command on the machine, called Sources, where MySQL and PhP have been installed:
PHP Reference 1 Preface This tutorial is designed to teach you all the PHP commands and constructs you need to complete your PHP project assignment. It is assumed that you have never programmed in PHP
More informationPerl for Biologists. Object Oriented Programming and BioPERL. Session 10 May 14, Jaroslaw Pillardy
Perl for Biologists Session 10 May 14, 2014 Object Oriented Programming and BioPERL Jaroslaw Pillardy Perl for Biologists 1.1 1 Subroutine can be declared in Perl script as a named block of code: sub sub_name
More informationUsing NetBeans to document code. The NetBeans IDE can be used to help generate Javadoc documentation and to check that the documentation is complete.
Using NetBeans to document code The NetBeans IDE can be used to help generate Javadoc documentation and to check that the documentation is complete. Before you generate documentation you should set the
More informationCGI Programming. What is "CGI"?
CGI Programming What is "CGI"? Common Gateway Interface A means of running an executable program via the Web. CGI is not a Perl-specific concept. Almost any language can produce CGI programs even C++ (gasp!!)
More informationControl Structures. Important Semantic Difference
Control Structures Important Semantic Difference In all of these loops we are going to discuss, the braces are ALWAYS REQUIRED. Even if your loop/block only has one statement, you must include the braces.
More informationCOMS 3101 Programming Languages: Perl. Lecture 3
COMS 3101 Programming Languages: Perl Lecture 3 Fall 2013 Instructor: Ilia Vovsha http://www.cs.columbia.edu/~vovsha/coms3101/perl Lecture Outline Array / Hash manipulation (continued) Pattern Matching
More informationfind starting-directory -name filename -user username
Lab 7: Input and Output The goal of this lab is to gain proficiency in using I/O redirection to perform tasks on the system. You will combine commands you have learned in this course using shell redirection,
More informationPerl for Biologists. Arrays and lists. Session 4 April 2, Jaroslaw Pillardy. Session 4: Arrays and lists Perl for Biologists 1.
Perl for Biologists Session 4 April 2, 2014 Arrays and lists Jaroslaw Pillardy Session 4: Arrays and lists Perl for Biologists 1.1 1 if statement if(condition1) statement; elsif(condition2) statement;
More information1. Introduction. 2. Scalar Data
1. Introduction What Does Perl Stand For? Why Did Larry Create Perl? Why Didn t Larry Just Use Some Other Language? Is Perl Easy or Hard? How Did Perl Get to Be So Popular? What s Happening with Perl Now?
More informationSoftware. Programming Languages. Types of Software. Types of Languages. Types of Programming. Software does something
Software Software does something LBSC 690: Week 10 Programming, JavaScript Jimmy Lin College of Information Studies University of Maryland Monday, April 9, 2007 Tells the machine how to operate on some
More informationAppendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc.
Appendix B WORKSHOP SYS-ED/ Computer Education Techniques, Inc. 1 Scalar Variables 1. Write a Perl program that reads in a number, multiplies it by 2, and prints the result. 2. Write a Perl program that
More informationCOMS 3101 Programming Languages: Perl. Lecture 1
COMS 3101 Programming Languages: Perl Lecture 1 Fall 2013 Instructor: Ilia Vovsha http://www.cs.columbia.edu/~vovsha/coms3101/perl What is Perl? Perl is a high level language initially developed as a scripting
More informationECS 10 Concepts of Computation Example Final Problems
ECS 10 Concepts of Computation Example Final Problems 1. Here is a little program, not necessarily correct. ages= {} ages["cat"]=4 if 4 in ages: print ages[4] This program will... a) print cat b) print
More informationT-( )-MALV, Natural Language Processing The programming language Perl
T-(538 725)-MALV, Natural Language Processing The programming language Perl Hrafn Loftsson 1 Hannes Högni Vilhjálmsson 1 1 School of Computer Science, Reykjavik University September 2010 Outline 1 Perl
More informationMySpace 2. Developers guide
MySpace 2 Developers guide MySpace 2 is an application similar to Friendster or MySpace, where the items are users and relationships can be created between users. Some specifics about this system: A first
More informationIT441. Subroutines. (a.k.a., Functions, Methods, etc.) DRAFT. Network Services Administration
IT441 Network Services Administration Subroutines DRAFT (a.k.a., Functions, Methods, etc.) Organizing Code We have recently discussed the topic of organizing data (i.e., arrays and hashes) in order to
More informationWeb Site Documentation Eugene School District 4J
Eugene School District 4J Using this Documentation Revision 1.3 1. Instruction step-by-step. The left column contains the simple how-to steps. Over here on the right is the color commentary offered to
More informationSequence Analysis with Perl. Unix, Perl and BioPerl. Why Perl? Objectives. A first Perl program. Perl Input/Output. II: Sequence Analysis with Perl
Sequence Analysis with Perl Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Introduction Input/output Variables Functions Control structures
More informationSystems Skills in C and Unix
15-123 Systems Skills in C and Unix Plan Perl programming basics Operators loops, arrays, conditionals file processing subroutines, references Systems programming Command line arguments Perl intro Unix
More informationLab 2: Implementing a Shell COMPSCI 310: Introduction to Operating Systems
Lab 2: Implementing a Shell COMPSCI 310: Introduction to Operating Systems 1 Shells are cool Unix [3] embraces the philosophy: Write programs that do one thing and do it well. Write programs to work together.
More informationUsing References to Create Complex Structures. The array and hash composers
Using References to Create Complex Structures The array and hash composers Copyright 2006 2009 Stewart Weiss Anonymous array composer You can create a hard reference to an anonymous array using square
More informationCSCI 4152/6509 Natural Language Processing. Perl Tutorial CSCI 4152/6509. CSCI 4152/6509, Perl Tutorial 1
CSCI 4152/6509 Natural Language Processing Perl Tutorial CSCI 4152/6509 Vlado Kešelj CSCI 4152/6509, Perl Tutorial 1 created in 1987 by Larry Wall About Perl interpreted language, with just-in-time semi-compilation
More informationCSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes
CSE 390a Lecture 2 Exploring Shell Commands, Streams, Redirection, and Processes slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture
More informationUnix, Perl and BioPerl
Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures
More informationBeginning Perl. Third Edition. Apress. JAMES LEE with SIMON COZENS
Beginning Perl Third Edition JAMES LEE with SIMON COZENS Apress About the Author... About the Technical Reviewers Acknowledgements Suitrod yetion «. xvi xvii xviii «xix. Chapter 1: First Steps in Perl..
More informationPathologically Eclectic Rubbish Lister
Pathologically Eclectic Rubbish Lister 1 Perl Design Philosophy Author: Reuben Francis Cornel perl is an acronym for Practical Extraction and Report Language. But I guess the title is a rough translation
More informationCSCI 4152/6509 Natural Language Processing Lecture 6: Regular Expressions; Text Processing in Perl
Lecture 6 p.1 Faculty of Computer Science, Dalhousie University CSCI 4152/6509 Natural Language Processing Lecture 6: Regular Expressions; Text Processing in Perl 18-Jan-2019 Location: LSC Psychology P5260
More informationSet 1 MCQ Which command is used to sort the lines of data in a file in reverse order A) sort B) sh C) st D) sort -r
1. Which symbol will be used with grep command to match the pattern pat at the beginning of a line? A) ^pat B) $pat C) pat$ D) pat^ 2. Which command is used to sort the lines of data in a file in reverse
More informationCMSC 331 Final Exam Fall 2013
CMSC 331 Final Exam Fall 2013 Name: UMBC username: You have two hours to complete this closed book exam. Use the backs of these pages if you need more room for your answers. Describe any assumptions you
More informationProvided by - Microsoft Placement Paper Technical 2012
Provided by www.yuvajobs.com - Microsoft Placement Paper Technical 2012 1. Analytical 25 questions ( 30 minutes) 2. Reasoning 25 questions (25 minutes) 3. Verbal 20 questions (20 minutes) Analytical (some
More informationPart 1: Basic Commands/U3li3es
Final Exam Part 1: Basic Commands/U3li3es May 17 th 3:00~4:00pm S-3-143 Same types of questions as in mid-term 1 2 ls, cat, echo ls -l e.g., regular file or directory, permissions, file size ls -a cat
More informationPerl Library Functions
Perl Library Functions Perl has literally hundreds of functions for all kinds of purposes: file manipulation, database access, network programming, etc. etc. It has an especially rich collection of functions
More informationSymbolic Programming. Dr. Zoran Duric () Symbolic Programming 1/ 89 August 28, / 89
Symbolic Programming Symbols: +, -, 1, 2 etc. Symbolic expressions: (+ 1 2), (+ (* 3 4) 2) Symbolic programs are programs that manipulate symbolic expressions. Symbolic manipulation: you do it all the
More informationCSCI2467: Systems Programming Concepts
CSCI2467: Systems Programming Concepts Class activity: bash shell literacy Instructor: Matthew Toups Fall 2017 Today 0 Shells History Usage Scripts vs. Programs 1 Bash shell: practical uses for your systems
More information(Refer Slide Time: 01:40)
Internet Technology Prof. Indranil Sengupta Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur Lecture No #25 Javascript Part I Today will be talking about a language
More informationScript Programming Systems Skills in C and Unix
Script Programming with Perl II 15-123 Systems Skills in C and Unix Subroutines sub sum { return $a + $b; } So we can call this as: $a = 12; $b = 10; $sum = sum(); print the sum is $sum\n ; Passing Arguments
More informationeopf Tips & Techniques
Search, View, Print, and Save Documents Using My eopf Introduction Your electronic Official Personnel Folder, or eopf, manages all of your personnel documents, organized by virtual folders. The Permanent
More informationJavaScript Functions, Objects and Array
JavaScript Functions, Objects and Array Defining a Function A definition starts with the word function. A name follows that must start with a letter or underscore, followed by any number of letters, digits,
More informationCSC105, Introduction to Computer Science I. Introduction. Perl Directions NOTE : It is also a good idea to
CSC105, Introduction to Computer Science Lab03: Introducing Perl I. Introduction. [NOTE: This material assumes that you have reviewed Chapters 1, First Steps in Perl and 2, Working With Simple Values in
More informationModularity and Reusability I. Functions and code reuse
Modularity and Reusability I Functions and code reuse Copyright 2006 2009 Stewart Weiss On being efficient When you realize that a piece of Perl code that you wrote may be useful in future programs, you
More informationUNIX System Programming Lecture 3: BASH Programming
UNIX System Programming Outline Filesystems Redirection Shell Programming Reference BLP: Chapter 2 BFAQ: Bash FAQ BMAN: Bash man page BPRI: Bash Programming Introduction BABS: Advanced Bash Scripting Guide
More informationGuide to Programming with Python. Algorithms & Computer programs. Hello World
Guide to Programming with Python Yuzhen Ye (yye@indiana.edu) School of Informatics and Computing, IUB Objectives Python basics How to run a python program How to write a python program Variables Basic
More informationPerl Programming Fundamentals for the Computational Biologist
Perl Programming Fundamentals for the Computational Biologist Class 2 Marine Biological Laboratory, Woods Hole Advances in Genome Technology and Bioinformatics Fall 2004 Andrew Tolonen Chisholm lab, MIT
More informationUsing UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program
Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the
More informationWeek 2 Lecture 3. Unix
Lecture 3 Unix Terminal and Shell 2 Terminal Prompt Command Argument Result 3 Shell Intro A system program that allows a user to execute: shell functions (e.g., ls -la) other programs (e.g., eclipse) shell
More informationM2PGER FORTRAN programming. General introduction. Virginie DURAND and Jean VIRIEUX 10/13/2013 M2PGER - ALGORITHME SCIENTIFIQUE
M2PGER 2013-2014 FORTRAN programming General introduction Virginie DURAND and Jean VIRIEUX 1 Why learning programming??? 2 Why learning programming??? ACQUISITION numerical Recording on magnetic supports
More informationPerl. Interview Questions and Answers
and Answers Prepared by Abhisek Vyas Document Version 1.0 Team, www.sybaseblog.com 1 of 13 Q. How do you separate executable statements in perl? semi-colons separate executable statements Example: my(
More informationInstructor s Manual. Perl How to Program
Instructor s Manual for Perl How to Program Harvey M. Deitel Paul J. Deitel Tem R. Nieto David C. McPhie 2001 Deitel & Associates, Inc. and Prentice Hall. All Rights Reserved. Contents Preface iv 1 Introduction
More informationChapter 3. Basics in Perl. 3.1 Variables and operations Scalars Strings
Chapter 3 Basics in Perl 3.1 Variables and operations 3.1.1 Scalars 2 $hello = "Hello World!"; 3 print $hello; $hello is a scalar variable. It represents an area in the memory where you can store data.
More informationCIS 505: Software Systems
CIS 505: Software Systems Fall 2017 Assignment 3: Chat server Due on November 3rd, 2017, at 10:00pm EDT 1 Overview For this assignment, you will implement a simple replicated chat server that uses multicast
More informationPerl Scripting. Students Will Learn. Course Description. Duration: 4 Days. Price: $2295
Perl Scripting Duration: 4 Days Price: $2295 Discounts: We offer multiple discount options. Click here for more info. Delivery Options: Attend face-to-face in the classroom, remote-live or on-demand streaming.
More informationPROGRAMMING PROJECT ONE DEVELOPING A SHELL
PROGRAMMING PROJECT ONE DEVELOPING A SHELL William Stallings Copyright 2011 Supplement to Operating Systems, Seventh Edition Prentice Hall 2011 ISBN: 013230998X http://williamstallings.com/os/os7e.html
More informationCSC UNIX System, Spring 2015
CSC 352 - UNIX System, Spring 2015 Study guide for the CSC352 midterm exam (20% of grade). Dr. Dale E. Parson, http://faculty.kutztown.edu/parson We will have a midterm on March 19 on material we have
More informationPerl and Python ESA 2007/2008. Eelco Schatborn 27 September 2007
Perl and Python ESA 2007/2008 Eelco Schatborn eelco@os3.nl 27 September 2007 ESA: Perl Vandaag: 1. Perl introduction 2. Basic Perl: types, variables, statements,... 3. Object Oriented Perl 4. Documentation
More informationSpring CS Homework 2 p. 1. CS Homework 2. To practice with PL/SQL stored procedures and functions, and possibly exception handling.
Spring 2018 - CS 328 - Homework 2 p. 1 Deadline Due by 11:59 pm on Sunday, February 4, 2018. Purpose CS 328 - Homework 2 To practice with PL/SQL stored procedures and functions, and possibly exception
More informationProgramming in Perl CSCI-2230 Final Exam
Rules and Information: Programming in Perl CSCI-2230 Final Exam 1. TURN OFF ALL CELULAR PHONES AND PAGERS! 2. Make sure you are seated at least one empty seat away from any other student. 3. Write your
More informationIntroduction to Perl Session 6. special variables subroutines Introduction to Perl
1.0.1.8.6 Introduction to Perl Session 6 special variables subroutines 6/17/2008 1.0.1.8.6 - Introduction to Perl - Special Variables and Subroutines 1 I/O Recap file handles are created using open(f,$file);
More informationProtocols. Module UFCE Topic: Protocols and More HTML
Protocols Module UFCE47-20-1 Topic: Protocols and More HTML Introduction This worksheet is designed to encourage you to continuing your web page writing skills. Also to give you the opportunity to use
More informationHaskell Types COMP360
Haskell Types COMP360 Should array indices start at 0 or 1? My compromise of 0.5 was rejected without, I thought, proper consideration. Stan Kelly-Bootle British author, singer-songwriter and computer
More informationVERY SHORT INTRODUCTION TO UNIX
VERY SHORT INTRODUCTION TO UNIX Tore Samuelsson, Nov 2009. An operating system (OS) is an interface between hardware and user which is responsible for the management and coordination of activities and
More informationIndian Institute of Technology Kharagpur. PERL Part III. Prof. Indranil Sen Gupta Dept. of Computer Science & Engg. I.I.T.
Indian Institute of Technology Kharagpur PERL Part III Prof. Indranil Sen Gupta Dept. of Computer Science & Engg. I.I.T. Kharagpur, INDIA Lecture 23: PERL Part III On completion, the student will be able
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More information