CSC152 Algorithm and Complexity. Lecture 7: String Match

Size: px
Start display at page:

Download "CSC152 Algorithm and Complexity. Lecture 7: String Match"

Transcription

1 CSC152 Algorithm and Complexity Lecture 7: String Match

2 Outline Brute Force Algorithm Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm Boyer-Moore algorithm

3 String Matching Aims to Detecting the occurrence of a particular substring (called a pattern) in another string (called the text) The problem is usually presented in the context of character strings and arises often in text processing, and we will assume this context in the lecture. Algorithms Brute Force Solution The Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm The Boyer-Moore Algorithm

4 Brute Force solution Algorithm: Brute Force Algorithm Input: P and T, the pattern and text strings; m is the length of P. The pattern is assumed to be nonempty. Output: The return value is the index in T where a copy of P begins, or -1 if no match for P is found.

5 Brute Force Pseudo-Code do if (current text letter == current pattern letter) compare next letter of pattern to next letter of text else move pattern down text by one letter while (entire pattern found or end of text)

6

7 Analysis Worst-case complexity is in Θ(mn) Case 1: if the pattern appears at the beginning of the text, m comparisons are done Case 2: if P is not in T at all, n comparisons are done Waste case: for each possible starting place for P in T all but the last character of P matched the corresponding text characters. For example: P: aaaaab (m-1 a s and one b) T: aaaaaaaaa (n a s) Works quite well on average for natural language.

8 The Knuth-Morris-Pratt Algorithm Pattern Matching with Finite Automata (FA), Let be set of characters, from which the characters in P and T may be chosen. e.g. the following is the FA for P = AABC Try: T= CBBAABBAABC A match was found

9 The Knuth-Morris-Pratt Flowchart Character labels are inside the nodes Each node has two arrows out to other nodes: success link, or fail link Next character is read only after a success link A special node, node 0, called get next char which read in next text character. e.g. P = ABABCB Try: T= ACABAABABA

10 Construction of the KMP Flowchart Definition:Fail links Two arrays: one containing the characters of the pattern, one containing the failure links. The success links are implicit in the ordering of the array entries. We define fail[k] will be the index of the node pointed to by the failure link at the kth node in P, for 1 k m. The special node that merely forces the next text character to be read is considered to be the zero-th node; fail[1] = 0. We define fail[k] as the largest r (with r<k) such that p 1,.. p r-1 in P matches p k-r+1...p k-1 in T.That is the (r-1) character prefix of P is identical to the one (r-1) character substring ending at index k-1. Thus the fail links are determined by repetition within P itself. For example, k=7 p p 1,.. 4 P: ABABABCB Suppose x is not C P: ABABABCB T: ABABABx T: ABABABx p p 3,.. 6 The pattern is moved forward so that the longest initial segment that matches part of the text preceding x is lined up with that part of the text. Now x should be tested to see if it is an A to match the third A of the pattern. Thus the failure link for the node containing the C should point to the node containing the third A. r=5

11 Construction of the KMP Flowchart Thus the failure link for the node containing the C should point to the node containing the third A

12 Algorithm: KMP flowchart construction Input: P,a string of characters;m,the length of P. Output: fail, the array of failure links, defined for indexes 1,...,m. The array is passed in and the algorithm fills it. Step: void kmpsetup(char[] P, int m, int[] fail) int k,s 1. fail[1] = 0; 2. for (k = 2;k <= m;k++) 3. s = fail[k-1]; //s = 0 when k = 2 4. while (s >= 1) 5. if (p s == p k-1 ) 6. break; 7. s = fail[s]; 8. fail[k] = s+1; P: A B A B A B C B p 1 p 2 p 3 p 4 p 5 p 6 p 7 p 8

13 Analysis of KMP Flowchart Cibstructuib The body of for loop is ececuted m 1 times, and each time, the body of the while loop is executed at most m times. Since the character comparison in line 5 is executed in each pass through the while loop, the running time of the algorithm is bounded by a multiple of the number of character comparisons. A successful comparison (ps == pk-1) breaks out of the while loop so at most m-1 successful comparisons are done. After every unsuccessful comparison s is decreased, so we can bound the number of unsuccessful comparisons by determining how many times s can decrease S is initially assigned 0, when k = 2 S in increased only by executing line 8 on one pass of the for loop, following by line 3on the subsequent pass; these two statements increase s by 1. This occurs m 2 times, (when k=2, s will not be increased) s is never negative Therefore s cannot be decreased more than m-2 times, so the number of unsuccessful comparisons is at most m 2. So total, (m-1) + (m 2 ) = 2m -3

14 The Knuth-Morris-Pratt Scan Algorithm int kmpscan(char[] P,char[] T,int m,int[] fail) //m is the length of patter P int match, j,k; //j indexes text characters; k indexes the pattern and fail array match= -1; j=1; k=1; while(endtext(t, j)==false) if(k>m) match = j-m;//match found break; if(k==0) j++; k=1; //start pattern over else if(t j ==p k ) j++; k++; else //Follow fail arrow. k=fail[k]; //continue loop. return match; Try: P: ABABABCB T: ACABAABABA endtext(t,j) returns true if j is greater than the index of the last character of T. and Return false otherwise. The jth character in T equals to the kth character in P The return value is the index in T where a copy of P begins, or 1 if no match for P is found

15 Analysis KMP Flowchart Construction require 2m 3 character comparisons in the worst case The scan algorithm requires 2n character comparisons in the worst case, n is the length of the text T. (see the next slid) Overall: Worst case complexity is θ(n+m)

16 Analysis Show that the scan algorithm requires 2n character comparisons in the worst case. At most one character comparison is done each time the body of the loop is executed, in the last of the three if statements. Each time this if statement is executed, either j is incremented (along with k) or k is decremented. So we count how many times j is incremented overall and how many times k is decremented. Since j begins at 1, is incremented by exactly 1 whenever it is incremented, and never decreases, and the loop terminates when j > n (where n is the length of T), j can increase at most n times. Since k is incremented the same number of times as j (note that in the second if statement, if k = 0, k is assigned 1), k is incremented at most n times. Since k starts at 1 and is never negative, k can decrease at most n times. Thus the last if statement, where the character comparison is done, is executed at most 2n times.

17 Boyer-Moore Algorithm Basic idea is simple. We match the pattern P against substrings in the text string T from right to left. We align the pattern with the beginning of the text string. Compare the characters starting from the rightmost character of the pattern. If fail, shift the pattern to the right, by how far?

18 Boyer-Moore Algorithm Suppose we are comparing the last character P[m-1] of the pattern with some character T[k] in the text. If P[m-1] T[k], then the pattern does not occur here Case (1): if the character T[k] does not appear in P at all, we should shift P all the way to align P[0] with T[k+1] and match P[m-1] with T[k+m] again. This saves a lot of character comparisons. Case (2): if the character T[k] appears in P, then we should shift P to align the rightmost occurrence of this character in P with T[k].

19 Examples T[k+m] T[k] Case (1) T[k] T[k] Case (2) Case (1)

20 If the last character P[m-1] of the pattern matches with T[k], then we continue scanning P from right to left and match with T. If we find a complete match, we are done. Otherwise (case (3)), whenever we fail to find a complete match at t j at T, we should always shift P just far enough to pass the t j and try again. P ababbb T abaabbaababbb ababbb ababbb Case(3) ababbb Case (2)

21 Boyer-Moore algorithm To implement, we need to find out for each character c in the alphabet, the amount of jump needed if P[m-1] aligns with the character c in the input text and they don t match. Void computejumps (char[] p, int m, int alpha, int[] charjump) char ch; int k; for (ch=0; ch < alpha; ch++) //alpha = charjump[ch] = m; //m is the length of the pattern P for (k = 1; k <= m; k++) charjump[p k ] = m-k; This takes O(m + alpha) time, where m is the length of the pattern P. Afterwards, matching P with substrings in T is very fast in practice.

22 must must must must must must must must must must must If you wish to understand others you must

Knuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011

Knuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011 Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given

More information

CSCI S-Q Lecture #13 String Searching 8/3/98

CSCI S-Q Lecture #13 String Searching 8/3/98 CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching

More information

String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي

String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred

More information

String Matching Algorithms

String Matching Algorithms String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -

More information

String matching algorithms

String matching algorithms String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A

More information

String Matching Algorithms

String Matching Algorithms String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational

More information

Applied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017

Applied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017 Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of

More information

CS/COE 1501

CS/COE 1501 CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ String Pattern Matching General idea Have a pattern string p of length m Have a text string t of length n Can we find an index i of string t such that each of

More information

Application of String Matching in Auto Grading System

Application of String Matching in Auto Grading System Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute

More information

kvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx

kvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?

More information

Algorithms and Data Structures

Algorithms and Data Structures Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction

More information

String Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42

String Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42 String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt

More information

Exact String Matching. The Knuth-Morris-Pratt Algorithm

Exact String Matching. The Knuth-Morris-Pratt Algorithm Exact String Matching The Knuth-Morris-Pratt Algorithm Outline for Today The Exact Matching Problem A simple algorithm Motivation for better algorithms The Knuth-Morris-Pratt algorithm The Exact Matching

More information

String Algorithms. CITS3001 Algorithms, Agents and Artificial Intelligence. 2017, Semester 2. CLRS Chapter 32

String Algorithms. CITS3001 Algorithms, Agents and Artificial Intelligence. 2017, Semester 2. CLRS Chapter 32 String Algorithms CITS3001 Algorithms, Agents and Artificial Intelligence Tim French School of Computer Science and Software Engineering The University of Western Australia CLRS Chapter 32 2017, Semester

More information

A string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers.

A string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers. STRING ALGORITHMS : Introduction A string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers. There are many functions those can be applied on strings.

More information

Indexing and Searching

Indexing and Searching Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)

More information

Algorithms and Data Structures Lesson 3

Algorithms and Data Structures Lesson 3 Algorithms and Data Structures Lesson 3 Michael Schwarzkopf https://www.uni weimar.de/de/medien/professuren/medieninformatik/grafische datenverarbeitung Bauhaus University Weimar May 30, 2018 Overview...of

More information

Chapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input

More information

Problem Set 9 Solutions

Problem Set 9 Solutions Introduction to Algorithms December 8, 2004 Massachusetts Institute of Technology 6.046J/18.410J Professors Piotr Indyk and Charles E. Leiserson Handout 34 Problem Set 9 Solutions Reading: Chapters 32.1

More information

String Matching in Scribblenauts Unlimited

String Matching in Scribblenauts Unlimited String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia

More information

Data Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation

Data Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation Data Structures and Algorithms Course slides: String Matching, Algorithms growth evaluation String Matching Basic Idea: Given a pattern string P, of length M Given a text string, A, of length N Do all

More information

CMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction

CMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern

More information

Data structures for string pattern matching: Suffix trees

Data structures for string pattern matching: Suffix trees Suffix trees Data structures for string pattern matching: Suffix trees Linear algorithms for exact string matching KMP Z-value algorithm What is suffix tree? A tree-like data structure for solving problems

More information

String Matching. Geetha Patil ID: Reference: Introduction to Algorithms, by Cormen, Leiserson and Rivest

String Matching. Geetha Patil ID: Reference: Introduction to Algorithms, by Cormen, Leiserson and Rivest String Matching Geetha Patil ID: 312410 Reference: Introduction to Algorithms, by Cormen, Leiserson and Rivest Introduction: This paper covers string matching problem and algorithms to solve this problem.

More information

Clever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange

Clever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]

More information

CSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs

CSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to

More information

Implementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature

Implementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature Implementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature Yodi Pramudito (13511095) Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi

More information

SORTING. Practical applications in computing require things to be in order. To consider: Runtime. Memory Space. Stability. In-place algorithms???

SORTING. Practical applications in computing require things to be in order. To consider: Runtime. Memory Space. Stability. In-place algorithms??? SORTING + STRING COMP 321 McGill University These slides are mainly compiled from the following resources. - Professor Jaehyun Park slides CS 97SI - Top-coder tutorials. - Programming Challenges book.

More information

Clever Linear Time Algorithms. Maximum Subset String Searching

Clever Linear Time Algorithms. Maximum Subset String Searching Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]

More information

Study of Selected Shifting based String Matching Algorithms

Study of Selected Shifting based String Matching Algorithms Study of Selected Shifting based String Matching Algorithms G.L. Prajapati, PhD Dept. of Comp. Engg. IET-Devi Ahilya University, Indore Mohd. Sharique Dept. of Comp. Engg. IET-Devi Ahilya University, Indore

More information

A New String Matching Algorithm Based on Logical Indexing

A New String Matching Algorithm Based on Logical Indexing The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department

More information

Strings. Zachary Friggstad. Programming Club Meeting

Strings. Zachary Friggstad. Programming Club Meeting Strings Zachary Friggstad Programming Club Meeting Outline Suffix Arrays Knuth-Morris-Pratt Pattern Matching Suffix Arrays (no code, see Comp. Prog. text) Sort all of the suffixes of a string lexicographically.

More information

5.3 Substring Search

5.3 Substring Search 5.3 Substring Search brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp lgorithms, 4 th Edition Robert Sedgewick and Kevin Wayne opyright 2002 2010 December 3, 2010 7:00:21 M Substring search Goal.

More information

Assignment 2 (programming): Problem Description

Assignment 2 (programming): Problem Description CS2210b Data Structures and Algorithms Due: Monday, February 14th Assignment 2 (programming): Problem Description 1 Overview The purpose of this assignment is for students to practice on hashing techniques

More information

Lecture 5: Suffix Trees

Lecture 5: Suffix Trees Longest Common Substring Problem Lecture 5: Suffix Trees Given a text T = GGAGCTTAGAACT and a string P = ATTCGCTTAGCCTA, how do we find the longest common substring between them? Here the longest common

More information

International Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, ISSN

International Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17,  ISSN International Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, www.ijcea.com ISSN 2321-3469 DNA PATTERN MATCHING - A COMPARATIVE STUDY OF THREE PATTERN MATCHING ALGORITHMS

More information

Algorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE

Algorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE lgorithms ROBERT SEDGEWICK KEVIN WYNE 5.3 SUBSTRING SERCH lgorithms F O U R T H E D I T I O N ROBERT SEDGEWICK KEVIN WYNE introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp http://algs4.cs.princeton.edu

More information

Fast Exact String Matching Algorithms

Fast Exact String Matching Algorithms Fast Exact String Matching Algorithms Thierry Lecroq Thierry.Lecroq@univ-rouen.fr Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore

More information

Data Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi.

Data Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi. Data Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi Lecture 18 Tries Today we are going to be talking about another data

More information

University of Waterloo CS240R Fall 2017 Review Problems

University of Waterloo CS240R Fall 2017 Review Problems University of Waterloo CS240R Fall 2017 Review Problems Reminder: Final on Tuesday, December 12 2017 Note: This is a sample of problems designed to help prepare for the final exam. These problems do not

More information

String Processing Workshop

String Processing Workshop String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string

More information

Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II

Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)

More information

SUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search.

SUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search. M 202 - LGORITHMS TODY Substring search DPT. OF OMPUTR NGINRING rute force Knuth-Morris-Pratt oyer-moore Rabin-Karp SUSTRING SRH cknowledgement: The course slides are adapted from the slides prepared by

More information

Inexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming)

Inexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Inexact Matching, Alignment See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Outline Yet more applications of generalized suffix trees, when combined with a least common ancestor

More information

CSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming

CSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming (2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence

More information

String Patterns and Algorithms on Strings

String Patterns and Algorithms on Strings String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms

More information

6.3 Substring Search. brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp !!!! Substring search

6.3 Substring Search. brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp !!!! Substring search Substring search Goal. Find pattern of length M in a text of length N. 6.3 Substring Search typically N >> M pattern N E E D L E text I N H Y S T K N E E D L E I N match!!!! lgorithms in Java, 4th Edition

More information

An introduction to suffix trees and indexing

An introduction to suffix trees and indexing An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet

More information

ECE 122. Engineering Problem Solving with Java

ECE 122. Engineering Problem Solving with Java ECE 122 Engineering Problem Solving with Java Lecture 8 More Conditional Statements Outline Problem: How do I make choices in my Java program? Understanding conditional statements Remember: Boolean logic

More information

ECE 122. Engineering Problem Solving with Java

ECE 122. Engineering Problem Solving with Java ECE 122 Engineering Problem Solving with Java Lecture 8 More Conditional Statements Outline Problem: How do I make choices in my Java program? Understanding conditional statements Remember: Boolean logic

More information

University of Waterloo CS240R Winter 2018 Help Session Problems

University of Waterloo CS240R Winter 2018 Help Session Problems University of Waterloo CS240R Winter 2018 Help Session Problems Reminder: Final on Monday, April 23 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems do

More information

An analysis of the Intelligent Predictive String Search Algorithm: A Probabilistic Approach

An analysis of the Intelligent Predictive String Search Algorithm: A Probabilistic Approach I.J. Information Technology and Computer Science, 2017, 2, 66-75 Published Online February 2017 in MECS (http://www.mecs-press.org/) DOI: 10.5815/ijitcs.2017.02.08 An analysis of the Intelligent Predictive

More information

Project Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio

Project Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade

More information

CMPUT 403: Strings. Zachary Friggstad. March 11, 2016

CMPUT 403: Strings. Zachary Friggstad. March 11, 2016 CMPUT 403: Strings Zachary Friggstad March 11, 2016 Outline Tries Suffix Arrays Knuth-Morris-Pratt Pattern Matching Tries Given a dictionary D of strings and a query string s, determine if s is in D. Using

More information

Introduction to Algorithms

Introduction to Algorithms Introduction to Algorithms 6.046J/18.401J Lecture 22 Prof. Piotr Indyk Today String matching problems HKN Evaluations (last 15 minutes) Graded Quiz 2 (outside) Piotr Indyk Introduction to Algorithms December

More information

CSC 421: Algorithm Design & Analysis. Spring Space vs. time

CSC 421: Algorithm Design & Analysis. Spring Space vs. time CSC 421: Algorithm Design & Analysis Spring 2015 Space vs. time space/time tradeoffs examples: heap sort, data structure redundancy, hashing string matching brute force, Horspool algorithm, Boyer-Moore

More information

A NEW STRING MATCHING ALGORITHM

A NEW STRING MATCHING ALGORITHM Intern. J. Computer Math., Vol. 80, No. 7, July 2003, pp. 825 834 A NEW STRING MATCHING ALGORITHM MUSTAQ AHMED a, *, M. KAYKOBAD a,y and REZAUL ALAM CHOWDHURY b,z a Department of Computer Science and Engineering,

More information

Fast Hybrid String Matching Algorithms

Fast Hybrid String Matching Algorithms Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms

More information

REPETITION CONTROL STRUCTURE LOGO

REPETITION CONTROL STRUCTURE LOGO CSC 128: FUNDAMENTALS OF COMPUTER PROBLEM SOLVING REPETITION CONTROL STRUCTURE 1 Contents 1 Introduction 2 for loop 3 while loop 4 do while loop 2 Introduction It is used when a statement or a block of

More information

Application of the BWT Method to Solve the Exact String Matching Problem

Application of the BWT Method to Solve the Exact String Matching Problem Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com

More information

Fast Substring Matching

Fast Substring Matching Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which

More information

The Language for Specifying Lexical Analyzer

The Language for Specifying Lexical Analyzer The Language for Specifying Lexical Analyzer We shall now study how to build a lexical analyzer from a specification of tokens in the form of a list of regular expressions The discussion centers around

More information

Chapter. String Algorithms. Contents

Chapter. String Algorithms. Contents Chapter 23 String Algorithms Algorithms Book Word Cloud, 2014. Word cloud produced by frequency ranking the words in this book using wordcloud.cs.arizona.edu. Used with permission. Contents 23.1StringOperations...653

More information

Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies

Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com

More information

Algorithms and Data Structures CS-CO-412

Algorithms and Data Structures CS-CO-412 Algorithms and Data Structures CS-CO-412 David Vernon Professor of Informatics University of Skövde Sweden david@vernon.eu www.vernon.eu Algorithms and Data Structures 1 Copyright D. Vernon 2014 Trees

More information

Inexact Pattern Matching Algorithms via Automata 1

Inexact Pattern Matching Algorithms via Automata 1 Inexact Pattern Matching Algorithms via Automata 1 1. Introduction Chung W. Ng BioChem 218 March 19, 2007 Pattern matching occurs in various applications, ranging from simple text searching in word processors

More information

Unit-II Programming and Problem Solving (BE1/4 CSE-2)

Unit-II Programming and Problem Solving (BE1/4 CSE-2) Unit-II Programming and Problem Solving (BE1/4 CSE-2) Problem Solving: Algorithm: It is a part of the plan for the computer program. An algorithm is an effective procedure for solving a problem in a finite

More information

Data Structures and Algorithms(4)

Data Structures and Algorithms(4) Ming Zhang Data Structures and Algorithms Data Structures and Algorithms(4) Instructor: Ming Zhang Textbook Authors: Ming Zhang, Tengjiao Wang and Haiyan Zhao Higher Education Press, 2008.6 (the "Eleventh

More information

Computing Patterns in Strings I. Specific, Generic, Intrinsic

Computing Patterns in Strings I. Specific, Generic, Intrinsic Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems

More information

More Simulations. CS154 Chris Pollett Apr 25, 2007.

More Simulations. CS154 Chris Pollett Apr 25, 2007. More Simulations CS154 Chris Pollett Apr 25, 2007. Outline Multi-tape Turing Machines RAMS k-tape Turing Machine One way you might try to improve the power of a TM is to allow multiple tapes. Definition

More information

Text Algorithms (6EAP) Lecture 3: Exact paaern matching II

Text Algorithms (6EAP) Lecture 3: Exact paaern matching II Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND

More information

Data Structures Lecture 3

Data Structures Lecture 3 Fall 201 Fang Yu Software Security Lab. Dept. Management Information Systems, National Chengchi University Data Structures Lecture 3 HWs Review What you should have learned? Calculate your BMI Java Class

More information

A very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)

A very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract) A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de

More information

Lecture 7 February 26, 2010

Lecture 7 February 26, 2010 6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain 1 2 Compiler Construction F6S Lecture - 2 1 3 4 Compiler Construction F6S Lecture - 2 2 5 #include.. #include main() { char in; in = getch ( ); if ( isalpha (in) ) in = getch ( ); else error (); while

More information

Applications of Suffix Tree

Applications of Suffix Tree Applications of Suffix Tree Let us have a glimpse of the numerous applications of suffix trees. Exact String Matching As already mentioned earlier, given the suffix tree of the text, all occ occurrences

More information

University of Waterloo CS240 Spring 2018 Help Session Problems

University of Waterloo CS240 Spring 2018 Help Session Problems University of Waterloo CS240 Spring 2018 Help Session Problems Reminder: Final on Wednesday, August 1 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems

More information

A Scanner should create a token stream from the source code. Here are 4 ways to do this:

A Scanner should create a token stream from the source code. Here are 4 ways to do this: Writing A Scanner A Scanner should create a token stream from the source code. Here are 4 ways to do this: A. Hack something together till it works. (Blech!) B. Use the language specs to produce a Deterministic

More information

Princeton University Computer Science COS226: Data Structures and Algorithms. Final, Spring 2013

Princeton University Computer Science COS226: Data Structures and Algorithms. Final, Spring 2013 Princeton University Computer Science COS226: Data Structures and Algorithms Final, Spring 2013 This test has 14 questions worth a total of 116 points. The exam is closed book, except that you are allowed

More information

Practical Fast Searching in Strings

Practical Fast Searching in Strings SOFTWARE-PRACTICE AND EXPERIENCE, VOL. 10, 501-506 (1980) Practical Fast Searching in Strings R. NIGEL HORSPOOL School of Computer Science, McGill University, 805 Sherbrooke Street West, Montreal, Quebec

More information

Parallel and Sequential Data Structures and Algorithms Lecture (Spring 2012) Lecture 25 Suffix Arrays

Parallel and Sequential Data Structures and Algorithms Lecture (Spring 2012) Lecture 25 Suffix Arrays Lecture 25 Suffix Arrays Parallel and Sequential Data Structures and Algorithms, 15-210 (Spring 2012) Lectured by Kanat Tangwongsan April 17, 2012 Material in this lecture: The main theme of this lecture

More information

COMP 261 ALGORITHMS and DATA STRUCTURES

COMP 261 ALGORITHMS and DATA STRUCTURES T E W H A R E W Ā N A N G A O T E Ū P O K O O T E I K A A M Ā U I VUW V I C T O R I A UNIVERSITY OF WELLINGTON Student ID:....................... EXAMINATIONS 2012 TRIMESTER 2 *** WITH SOLUTIONS *** COMP

More information

Given a text file, or several text files, how do we search for a query string?

Given a text file, or several text files, how do we search for a query string? CS 840 Fall 2016 Text Search and Succinct Data Structures: Unit 4 Given a text file, or several text files, how do we search for a query string? Note the query/pattern is not of fixed length, unlike key

More information

1 Lexical Considerations

1 Lexical Considerations Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.035, Spring 2013 Handout Decaf Language Thursday, Feb 7 The project for the course is to write a compiler

More information

END-TERM EXAMINATION

END-TERM EXAMINATION (Please Write your Exam Roll No. immediately) Exam. Roll No... END-TERM EXAMINATION Paper Code : MCA-205 DECEMBER 2006 Subject: Design and analysis of algorithm Time: 3 Hours Maximum Marks: 60 Note: Attempt

More information

CSE 5311 Notes 14: Sequences

CSE 5311 Notes 14: Sequences CSE 5311 Notes 14: Sequences (Last updated 4/19/17 3:56 PM) PATTERN-BASED PREPROCESSING Simple Rescanning Pattern - m symbols Text - n symbols Example: Pattern: A B A C Text: A B A B A B A C A B A B A

More information

COS 226 Algorithms and Data Structures Fall Final

COS 226 Algorithms and Data Structures Fall Final COS 226 Algorithms and Data Structures Fall 2018 Final This exam has 16 questions (including question 0) worth a total of 100 points. You have 180 minutes. This exam is preprocessed by a computer when

More information

Solutions to Assessment

Solutions to Assessment Solutions to Assessment 1. In the bad character rule, what are the values of R(P) for the given pattern. CLICKINLINK (Please refer the lecture). Ans: a) C-1,K-10,N-9,I-8,L-2 b) C-1,K-10,N-9,I-8,L-7 c)

More information

Efficient Algorithm for Two Dimensional Pattern Matching Problem (Square Pattern)

Efficient Algorithm for Two Dimensional Pattern Matching Problem (Square Pattern) Efficient Algorithm for Two Dimensional Pattern Matching Problem (Square Pattern) Hussein Abu-Mansour 1, Jaber Alwidian 1, Wael Hadi 2 1 ITC department Arab Open University Riyadh- Saudi Arabia 2 CIS department

More information

Announcements. Programming assignment 1 posted - need to submit a.sh file

Announcements. Programming assignment 1 posted - need to submit a.sh file Greedy algorithms Announcements Programming assignment 1 posted - need to submit a.sh file The.sh file should just contain what you need to type to compile and run your program from the terminal Greedy

More information

Technical University of Denmark

Technical University of Denmark page 1 of 12 pages Technical University of Denmark Written exam, December 11, 2015. Course name: Algorithms and data structures. Course number: 02110. Aids allowed: All written materials are permitted.

More information

Department of Computer Applications. MCA 312: Design and Analysis of Algorithms. [Part I : Medium Answer Type Questions] UNIT I

Department of Computer Applications. MCA 312: Design and Analysis of Algorithms. [Part I : Medium Answer Type Questions] UNIT I MCA 312: Design and Analysis of Algorithms [Part I : Medium Answer Type Questions] UNIT I 1) What is an Algorithm? What is the need to study Algorithms? 2) Define: a) Time Efficiency b) Space Efficiency

More information

Giri Narasimhan. COT 6936: Topics in Algorithms. The String Matching Problem. Approximate String Matching

Giri Narasimhan. COT 6936: Topics in Algorithms. The String Matching Problem. Approximate String Matching COT 6936: Topics in lgorithms Giri Narasimhan ECS 254 / EC 2443; Phone: x3748 giri@cs.fiu.edu http://www.cs.fiu.edu/~giri/teach/cot6936_s10.html https://online.cis.fiu.edu/portal/course/view.php?id=427

More information

Solution to Problem 1 of HW 2. Finding the L1 and L2 edges of the graph used in the UD problem, using a suffix array instead of a suffix tree.

Solution to Problem 1 of HW 2. Finding the L1 and L2 edges of the graph used in the UD problem, using a suffix array instead of a suffix tree. Solution to Problem 1 of HW 2. Finding the L1 and L2 edges of the graph used in the UD problem, using a suffix array instead of a suffix tree. The basic approach is the same as when using a suffix tree,

More information

There are algorithms, however, that need to execute statements in some other kind of ordering depending on certain conditions.

There are algorithms, however, that need to execute statements in some other kind of ordering depending on certain conditions. Introduction In the programs that we have dealt with so far, all statements inside the main function were executed in sequence as they appeared, one after the other. This type of sequencing is adequate

More information

Lexical Considerations

Lexical Considerations Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.035, Spring 2010 Handout Decaf Language Tuesday, Feb 2 The project for the course is to write a compiler

More information

Multi-Pattern String Matching with Very Large Pattern Sets

Multi-Pattern String Matching with Very Large Pattern Sets Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume

More information

Advanced Algorithms: Project

Advanced Algorithms: Project Advanced Algorithms: Project (deadline: May 13th, 2016, 17:00) Alexandre Francisco and Luís Russo Last modified: February 26, 2016 This project considers two different problems described in part I and

More information

Accelerating Boyer Moore Searches on Binary Texts

Accelerating Boyer Moore Searches on Binary Texts Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il

More information

1- Write a single C++ statement that: A. Calculates the sum of the two integrates 11 and 12 and outputs the sum to the consol.

1- Write a single C++ statement that: A. Calculates the sum of the two integrates 11 and 12 and outputs the sum to the consol. 1- Write a single C++ statement that: A. Calculates the sum of the two integrates 11 and 12 and outputs the sum to the consol. B. Outputs to the console a floating point number f1 in scientific format

More information