CSC152 Algorithm and Complexity. Lecture 7: String Match
|
|
- Brett Gabriel Miller
- 6 years ago
- Views:
Transcription
1 CSC152 Algorithm and Complexity Lecture 7: String Match
2 Outline Brute Force Algorithm Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm Boyer-Moore algorithm
3 String Matching Aims to Detecting the occurrence of a particular substring (called a pattern) in another string (called the text) The problem is usually presented in the context of character strings and arises often in text processing, and we will assume this context in the lecture. Algorithms Brute Force Solution The Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm The Boyer-Moore Algorithm
4 Brute Force solution Algorithm: Brute Force Algorithm Input: P and T, the pattern and text strings; m is the length of P. The pattern is assumed to be nonempty. Output: The return value is the index in T where a copy of P begins, or -1 if no match for P is found.
5 Brute Force Pseudo-Code do if (current text letter == current pattern letter) compare next letter of pattern to next letter of text else move pattern down text by one letter while (entire pattern found or end of text)
6
7 Analysis Worst-case complexity is in Θ(mn) Case 1: if the pattern appears at the beginning of the text, m comparisons are done Case 2: if P is not in T at all, n comparisons are done Waste case: for each possible starting place for P in T all but the last character of P matched the corresponding text characters. For example: P: aaaaab (m-1 a s and one b) T: aaaaaaaaa (n a s) Works quite well on average for natural language.
8 The Knuth-Morris-Pratt Algorithm Pattern Matching with Finite Automata (FA), Let be set of characters, from which the characters in P and T may be chosen. e.g. the following is the FA for P = AABC Try: T= CBBAABBAABC A match was found
9 The Knuth-Morris-Pratt Flowchart Character labels are inside the nodes Each node has two arrows out to other nodes: success link, or fail link Next character is read only after a success link A special node, node 0, called get next char which read in next text character. e.g. P = ABABCB Try: T= ACABAABABA
10 Construction of the KMP Flowchart Definition:Fail links Two arrays: one containing the characters of the pattern, one containing the failure links. The success links are implicit in the ordering of the array entries. We define fail[k] will be the index of the node pointed to by the failure link at the kth node in P, for 1 k m. The special node that merely forces the next text character to be read is considered to be the zero-th node; fail[1] = 0. We define fail[k] as the largest r (with r<k) such that p 1,.. p r-1 in P matches p k-r+1...p k-1 in T.That is the (r-1) character prefix of P is identical to the one (r-1) character substring ending at index k-1. Thus the fail links are determined by repetition within P itself. For example, k=7 p p 1,.. 4 P: ABABABCB Suppose x is not C P: ABABABCB T: ABABABx T: ABABABx p p 3,.. 6 The pattern is moved forward so that the longest initial segment that matches part of the text preceding x is lined up with that part of the text. Now x should be tested to see if it is an A to match the third A of the pattern. Thus the failure link for the node containing the C should point to the node containing the third A. r=5
11 Construction of the KMP Flowchart Thus the failure link for the node containing the C should point to the node containing the third A
12 Algorithm: KMP flowchart construction Input: P,a string of characters;m,the length of P. Output: fail, the array of failure links, defined for indexes 1,...,m. The array is passed in and the algorithm fills it. Step: void kmpsetup(char[] P, int m, int[] fail) int k,s 1. fail[1] = 0; 2. for (k = 2;k <= m;k++) 3. s = fail[k-1]; //s = 0 when k = 2 4. while (s >= 1) 5. if (p s == p k-1 ) 6. break; 7. s = fail[s]; 8. fail[k] = s+1; P: A B A B A B C B p 1 p 2 p 3 p 4 p 5 p 6 p 7 p 8
13 Analysis of KMP Flowchart Cibstructuib The body of for loop is ececuted m 1 times, and each time, the body of the while loop is executed at most m times. Since the character comparison in line 5 is executed in each pass through the while loop, the running time of the algorithm is bounded by a multiple of the number of character comparisons. A successful comparison (ps == pk-1) breaks out of the while loop so at most m-1 successful comparisons are done. After every unsuccessful comparison s is decreased, so we can bound the number of unsuccessful comparisons by determining how many times s can decrease S is initially assigned 0, when k = 2 S in increased only by executing line 8 on one pass of the for loop, following by line 3on the subsequent pass; these two statements increase s by 1. This occurs m 2 times, (when k=2, s will not be increased) s is never negative Therefore s cannot be decreased more than m-2 times, so the number of unsuccessful comparisons is at most m 2. So total, (m-1) + (m 2 ) = 2m -3
14 The Knuth-Morris-Pratt Scan Algorithm int kmpscan(char[] P,char[] T,int m,int[] fail) //m is the length of patter P int match, j,k; //j indexes text characters; k indexes the pattern and fail array match= -1; j=1; k=1; while(endtext(t, j)==false) if(k>m) match = j-m;//match found break; if(k==0) j++; k=1; //start pattern over else if(t j ==p k ) j++; k++; else //Follow fail arrow. k=fail[k]; //continue loop. return match; Try: P: ABABABCB T: ACABAABABA endtext(t,j) returns true if j is greater than the index of the last character of T. and Return false otherwise. The jth character in T equals to the kth character in P The return value is the index in T where a copy of P begins, or 1 if no match for P is found
15 Analysis KMP Flowchart Construction require 2m 3 character comparisons in the worst case The scan algorithm requires 2n character comparisons in the worst case, n is the length of the text T. (see the next slid) Overall: Worst case complexity is θ(n+m)
16 Analysis Show that the scan algorithm requires 2n character comparisons in the worst case. At most one character comparison is done each time the body of the loop is executed, in the last of the three if statements. Each time this if statement is executed, either j is incremented (along with k) or k is decremented. So we count how many times j is incremented overall and how many times k is decremented. Since j begins at 1, is incremented by exactly 1 whenever it is incremented, and never decreases, and the loop terminates when j > n (where n is the length of T), j can increase at most n times. Since k is incremented the same number of times as j (note that in the second if statement, if k = 0, k is assigned 1), k is incremented at most n times. Since k starts at 1 and is never negative, k can decrease at most n times. Thus the last if statement, where the character comparison is done, is executed at most 2n times.
17 Boyer-Moore Algorithm Basic idea is simple. We match the pattern P against substrings in the text string T from right to left. We align the pattern with the beginning of the text string. Compare the characters starting from the rightmost character of the pattern. If fail, shift the pattern to the right, by how far?
18 Boyer-Moore Algorithm Suppose we are comparing the last character P[m-1] of the pattern with some character T[k] in the text. If P[m-1] T[k], then the pattern does not occur here Case (1): if the character T[k] does not appear in P at all, we should shift P all the way to align P[0] with T[k+1] and match P[m-1] with T[k+m] again. This saves a lot of character comparisons. Case (2): if the character T[k] appears in P, then we should shift P to align the rightmost occurrence of this character in P with T[k].
19 Examples T[k+m] T[k] Case (1) T[k] T[k] Case (2) Case (1)
20 If the last character P[m-1] of the pattern matches with T[k], then we continue scanning P from right to left and match with T. If we find a complete match, we are done. Otherwise (case (3)), whenever we fail to find a complete match at t j at T, we should always shift P just far enough to pass the t j and try again. P ababbb T abaabbaababbb ababbb ababbb Case(3) ababbb Case (2)
21 Boyer-Moore algorithm To implement, we need to find out for each character c in the alphabet, the amount of jump needed if P[m-1] aligns with the character c in the input text and they don t match. Void computejumps (char[] p, int m, int alpha, int[] charjump) char ch; int k; for (ch=0; ch < alpha; ch++) //alpha = charjump[ch] = m; //m is the length of the pattern P for (k = 1; k <= m; k++) charjump[p k ] = m-k; This takes O(m + alpha) time, where m is the length of the pattern P. Afterwards, matching P with substrings in T is very fast in practice.
22 must must must must must must must must must must must If you wish to understand others you must
Knuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011
Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given
More informationCSCI S-Q Lecture #13 String Searching 8/3/98
CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching
More informationString matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي
String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred
More informationString Matching Algorithms
String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -
More informationString matching algorithms
String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A
More informationString Matching Algorithms
String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational
More informationApplied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017
Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of
More informationCS/COE 1501
CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ String Pattern Matching General idea Have a pattern string p of length m Have a text string t of length n Can we find an index i of string t such that each of
More informationApplication of String Matching in Auto Grading System
Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute
More informationkvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx
COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?
More informationAlgorithms and Data Structures
Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction
More informationString Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42
String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt
More informationExact String Matching. The Knuth-Morris-Pratt Algorithm
Exact String Matching The Knuth-Morris-Pratt Algorithm Outline for Today The Exact Matching Problem A simple algorithm Motivation for better algorithms The Knuth-Morris-Pratt algorithm The Exact Matching
More informationString Algorithms. CITS3001 Algorithms, Agents and Artificial Intelligence. 2017, Semester 2. CLRS Chapter 32
String Algorithms CITS3001 Algorithms, Agents and Artificial Intelligence Tim French School of Computer Science and Software Engineering The University of Western Australia CLRS Chapter 32 2017, Semester
More informationA string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers.
STRING ALGORITHMS : Introduction A string is a sequence of characters. In the field of computer science, we use strings more often as we use numbers. There are many functions those can be applied on strings.
More informationIndexing and Searching
Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)
More informationAlgorithms and Data Structures Lesson 3
Algorithms and Data Structures Lesson 3 Michael Schwarzkopf https://www.uni weimar.de/de/medien/professuren/medieninformatik/grafische datenverarbeitung Bauhaus University Weimar May 30, 2018 Overview...of
More informationChapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input
More informationProblem Set 9 Solutions
Introduction to Algorithms December 8, 2004 Massachusetts Institute of Technology 6.046J/18.410J Professors Piotr Indyk and Charles E. Leiserson Handout 34 Problem Set 9 Solutions Reading: Chapters 32.1
More informationString Matching in Scribblenauts Unlimited
String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia
More informationData Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation
Data Structures and Algorithms Course slides: String Matching, Algorithms growth evaluation String Matching Basic Idea: Given a pattern string P, of length M Given a text string, A, of length N Do all
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern
More informationData structures for string pattern matching: Suffix trees
Suffix trees Data structures for string pattern matching: Suffix trees Linear algorithms for exact string matching KMP Z-value algorithm What is suffix tree? A tree-like data structure for solving problems
More informationString Matching. Geetha Patil ID: Reference: Introduction to Algorithms, by Cormen, Leiserson and Rivest
String Matching Geetha Patil ID: 312410 Reference: Introduction to Algorithms, by Cormen, Leiserson and Rivest Introduction: This paper covers string matching problem and algorithms to solve this problem.
More informationClever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationCSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs
CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to
More informationImplementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature
Implementation of Pattern Matching Algorithm on Antivirus for Detecting Virus Signature Yodi Pramudito (13511095) Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi
More informationSORTING. Practical applications in computing require things to be in order. To consider: Runtime. Memory Space. Stability. In-place algorithms???
SORTING + STRING COMP 321 McGill University These slides are mainly compiled from the following resources. - Professor Jaehyun Park slides CS 97SI - Top-coder tutorials. - Programming Challenges book.
More informationClever Linear Time Algorithms. Maximum Subset String Searching
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationStudy of Selected Shifting based String Matching Algorithms
Study of Selected Shifting based String Matching Algorithms G.L. Prajapati, PhD Dept. of Comp. Engg. IET-Devi Ahilya University, Indore Mohd. Sharique Dept. of Comp. Engg. IET-Devi Ahilya University, Indore
More informationA New String Matching Algorithm Based on Logical Indexing
The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department
More informationStrings. Zachary Friggstad. Programming Club Meeting
Strings Zachary Friggstad Programming Club Meeting Outline Suffix Arrays Knuth-Morris-Pratt Pattern Matching Suffix Arrays (no code, see Comp. Prog. text) Sort all of the suffixes of a string lexicographically.
More information5.3 Substring Search
5.3 Substring Search brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp lgorithms, 4 th Edition Robert Sedgewick and Kevin Wayne opyright 2002 2010 December 3, 2010 7:00:21 M Substring search Goal.
More informationAssignment 2 (programming): Problem Description
CS2210b Data Structures and Algorithms Due: Monday, February 14th Assignment 2 (programming): Problem Description 1 Overview The purpose of this assignment is for students to practice on hashing techniques
More informationLecture 5: Suffix Trees
Longest Common Substring Problem Lecture 5: Suffix Trees Given a text T = GGAGCTTAGAACT and a string P = ATTCGCTTAGCCTA, how do we find the longest common substring between them? Here the longest common
More informationInternational Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, ISSN
International Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, www.ijcea.com ISSN 2321-3469 DNA PATTERN MATCHING - A COMPARATIVE STUDY OF THREE PATTERN MATCHING ALGORITHMS
More informationAlgorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE
lgorithms ROBERT SEDGEWICK KEVIN WYNE 5.3 SUBSTRING SERCH lgorithms F O U R T H E D I T I O N ROBERT SEDGEWICK KEVIN WYNE introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp http://algs4.cs.princeton.edu
More informationFast Exact String Matching Algorithms
Fast Exact String Matching Algorithms Thierry Lecroq Thierry.Lecroq@univ-rouen.fr Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore
More informationData Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi.
Data Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi Lecture 18 Tries Today we are going to be talking about another data
More informationUniversity of Waterloo CS240R Fall 2017 Review Problems
University of Waterloo CS240R Fall 2017 Review Problems Reminder: Final on Tuesday, December 12 2017 Note: This is a sample of problems designed to help prepare for the final exam. These problems do not
More informationString Processing Workshop
String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string
More informationText Algorithms (6EAP) Lecture 3: Exact pa;ern matching II
Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)
More informationSUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search.
M 202 - LGORITHMS TODY Substring search DPT. OF OMPUTR NGINRING rute force Knuth-Morris-Pratt oyer-moore Rabin-Karp SUSTRING SRH cknowledgement: The course slides are adapted from the slides prepared by
More informationInexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming)
Inexact Matching, Alignment See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Outline Yet more applications of generalized suffix trees, when combined with a least common ancestor
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationString Patterns and Algorithms on Strings
String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms
More information6.3 Substring Search. brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp !!!! Substring search
Substring search Goal. Find pattern of length M in a text of length N. 6.3 Substring Search typically N >> M pattern N E E D L E text I N H Y S T K N E E D L E I N match!!!! lgorithms in Java, 4th Edition
More informationAn introduction to suffix trees and indexing
An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet
More informationECE 122. Engineering Problem Solving with Java
ECE 122 Engineering Problem Solving with Java Lecture 8 More Conditional Statements Outline Problem: How do I make choices in my Java program? Understanding conditional statements Remember: Boolean logic
More informationECE 122. Engineering Problem Solving with Java
ECE 122 Engineering Problem Solving with Java Lecture 8 More Conditional Statements Outline Problem: How do I make choices in my Java program? Understanding conditional statements Remember: Boolean logic
More informationUniversity of Waterloo CS240R Winter 2018 Help Session Problems
University of Waterloo CS240R Winter 2018 Help Session Problems Reminder: Final on Monday, April 23 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems do
More informationAn analysis of the Intelligent Predictive String Search Algorithm: A Probabilistic Approach
I.J. Information Technology and Computer Science, 2017, 2, 66-75 Published Online February 2017 in MECS (http://www.mecs-press.org/) DOI: 10.5815/ijitcs.2017.02.08 An analysis of the Intelligent Predictive
More informationProject Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio
Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade
More informationCMPUT 403: Strings. Zachary Friggstad. March 11, 2016
CMPUT 403: Strings Zachary Friggstad March 11, 2016 Outline Tries Suffix Arrays Knuth-Morris-Pratt Pattern Matching Tries Given a dictionary D of strings and a query string s, determine if s is in D. Using
More informationIntroduction to Algorithms
Introduction to Algorithms 6.046J/18.401J Lecture 22 Prof. Piotr Indyk Today String matching problems HKN Evaluations (last 15 minutes) Graded Quiz 2 (outside) Piotr Indyk Introduction to Algorithms December
More informationCSC 421: Algorithm Design & Analysis. Spring Space vs. time
CSC 421: Algorithm Design & Analysis Spring 2015 Space vs. time space/time tradeoffs examples: heap sort, data structure redundancy, hashing string matching brute force, Horspool algorithm, Boyer-Moore
More informationA NEW STRING MATCHING ALGORITHM
Intern. J. Computer Math., Vol. 80, No. 7, July 2003, pp. 825 834 A NEW STRING MATCHING ALGORITHM MUSTAQ AHMED a, *, M. KAYKOBAD a,y and REZAUL ALAM CHOWDHURY b,z a Department of Computer Science and Engineering,
More informationFast Hybrid String Matching Algorithms
Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms
More informationREPETITION CONTROL STRUCTURE LOGO
CSC 128: FUNDAMENTALS OF COMPUTER PROBLEM SOLVING REPETITION CONTROL STRUCTURE 1 Contents 1 Introduction 2 for loop 3 while loop 4 do while loop 2 Introduction It is used when a statement or a block of
More informationApplication of the BWT Method to Solve the Exact String Matching Problem
Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com
More informationFast Substring Matching
Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which
More informationThe Language for Specifying Lexical Analyzer
The Language for Specifying Lexical Analyzer We shall now study how to build a lexical analyzer from a specification of tokens in the form of a list of regular expressions The discussion centers around
More informationChapter. String Algorithms. Contents
Chapter 23 String Algorithms Algorithms Book Word Cloud, 2014. Word cloud produced by frequency ranking the words in this book using wordcloud.cs.arizona.edu. Used with permission. Contents 23.1StringOperations...653
More informationVolume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies
Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com
More informationAlgorithms and Data Structures CS-CO-412
Algorithms and Data Structures CS-CO-412 David Vernon Professor of Informatics University of Skövde Sweden david@vernon.eu www.vernon.eu Algorithms and Data Structures 1 Copyright D. Vernon 2014 Trees
More informationInexact Pattern Matching Algorithms via Automata 1
Inexact Pattern Matching Algorithms via Automata 1 1. Introduction Chung W. Ng BioChem 218 March 19, 2007 Pattern matching occurs in various applications, ranging from simple text searching in word processors
More informationUnit-II Programming and Problem Solving (BE1/4 CSE-2)
Unit-II Programming and Problem Solving (BE1/4 CSE-2) Problem Solving: Algorithm: It is a part of the plan for the computer program. An algorithm is an effective procedure for solving a problem in a finite
More informationData Structures and Algorithms(4)
Ming Zhang Data Structures and Algorithms Data Structures and Algorithms(4) Instructor: Ming Zhang Textbook Authors: Ming Zhang, Tengjiao Wang and Haiyan Zhao Higher Education Press, 2008.6 (the "Eleventh
More informationComputing Patterns in Strings I. Specific, Generic, Intrinsic
Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems
More informationMore Simulations. CS154 Chris Pollett Apr 25, 2007.
More Simulations CS154 Chris Pollett Apr 25, 2007. Outline Multi-tape Turing Machines RAMS k-tape Turing Machine One way you might try to improve the power of a TM is to allow multiple tapes. Definition
More informationText Algorithms (6EAP) Lecture 3: Exact paaern matching II
Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND
More informationData Structures Lecture 3
Fall 201 Fang Yu Software Security Lab. Dept. Management Information Systems, National Chengchi University Data Structures Lecture 3 HWs Review What you should have learned? Calculate your BMI Java Class
More informationA very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)
A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de
More informationLecture 7 February 26, 2010
6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some
More informationDr. D.M. Akbar Hussain
1 2 Compiler Construction F6S Lecture - 2 1 3 4 Compiler Construction F6S Lecture - 2 2 5 #include.. #include main() { char in; in = getch ( ); if ( isalpha (in) ) in = getch ( ); else error (); while
More informationApplications of Suffix Tree
Applications of Suffix Tree Let us have a glimpse of the numerous applications of suffix trees. Exact String Matching As already mentioned earlier, given the suffix tree of the text, all occ occurrences
More informationUniversity of Waterloo CS240 Spring 2018 Help Session Problems
University of Waterloo CS240 Spring 2018 Help Session Problems Reminder: Final on Wednesday, August 1 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems
More informationA Scanner should create a token stream from the source code. Here are 4 ways to do this:
Writing A Scanner A Scanner should create a token stream from the source code. Here are 4 ways to do this: A. Hack something together till it works. (Blech!) B. Use the language specs to produce a Deterministic
More informationPrinceton University Computer Science COS226: Data Structures and Algorithms. Final, Spring 2013
Princeton University Computer Science COS226: Data Structures and Algorithms Final, Spring 2013 This test has 14 questions worth a total of 116 points. The exam is closed book, except that you are allowed
More informationPractical Fast Searching in Strings
SOFTWARE-PRACTICE AND EXPERIENCE, VOL. 10, 501-506 (1980) Practical Fast Searching in Strings R. NIGEL HORSPOOL School of Computer Science, McGill University, 805 Sherbrooke Street West, Montreal, Quebec
More informationParallel and Sequential Data Structures and Algorithms Lecture (Spring 2012) Lecture 25 Suffix Arrays
Lecture 25 Suffix Arrays Parallel and Sequential Data Structures and Algorithms, 15-210 (Spring 2012) Lectured by Kanat Tangwongsan April 17, 2012 Material in this lecture: The main theme of this lecture
More informationCOMP 261 ALGORITHMS and DATA STRUCTURES
T E W H A R E W Ā N A N G A O T E Ū P O K O O T E I K A A M Ā U I VUW V I C T O R I A UNIVERSITY OF WELLINGTON Student ID:....................... EXAMINATIONS 2012 TRIMESTER 2 *** WITH SOLUTIONS *** COMP
More informationGiven a text file, or several text files, how do we search for a query string?
CS 840 Fall 2016 Text Search and Succinct Data Structures: Unit 4 Given a text file, or several text files, how do we search for a query string? Note the query/pattern is not of fixed length, unlike key
More information1 Lexical Considerations
Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.035, Spring 2013 Handout Decaf Language Thursday, Feb 7 The project for the course is to write a compiler
More informationEND-TERM EXAMINATION
(Please Write your Exam Roll No. immediately) Exam. Roll No... END-TERM EXAMINATION Paper Code : MCA-205 DECEMBER 2006 Subject: Design and analysis of algorithm Time: 3 Hours Maximum Marks: 60 Note: Attempt
More informationCSE 5311 Notes 14: Sequences
CSE 5311 Notes 14: Sequences (Last updated 4/19/17 3:56 PM) PATTERN-BASED PREPROCESSING Simple Rescanning Pattern - m symbols Text - n symbols Example: Pattern: A B A C Text: A B A B A B A C A B A B A
More informationCOS 226 Algorithms and Data Structures Fall Final
COS 226 Algorithms and Data Structures Fall 2018 Final This exam has 16 questions (including question 0) worth a total of 100 points. You have 180 minutes. This exam is preprocessed by a computer when
More informationSolutions to Assessment
Solutions to Assessment 1. In the bad character rule, what are the values of R(P) for the given pattern. CLICKINLINK (Please refer the lecture). Ans: a) C-1,K-10,N-9,I-8,L-2 b) C-1,K-10,N-9,I-8,L-7 c)
More informationEfficient Algorithm for Two Dimensional Pattern Matching Problem (Square Pattern)
Efficient Algorithm for Two Dimensional Pattern Matching Problem (Square Pattern) Hussein Abu-Mansour 1, Jaber Alwidian 1, Wael Hadi 2 1 ITC department Arab Open University Riyadh- Saudi Arabia 2 CIS department
More informationAnnouncements. Programming assignment 1 posted - need to submit a.sh file
Greedy algorithms Announcements Programming assignment 1 posted - need to submit a.sh file The.sh file should just contain what you need to type to compile and run your program from the terminal Greedy
More informationTechnical University of Denmark
page 1 of 12 pages Technical University of Denmark Written exam, December 11, 2015. Course name: Algorithms and data structures. Course number: 02110. Aids allowed: All written materials are permitted.
More informationDepartment of Computer Applications. MCA 312: Design and Analysis of Algorithms. [Part I : Medium Answer Type Questions] UNIT I
MCA 312: Design and Analysis of Algorithms [Part I : Medium Answer Type Questions] UNIT I 1) What is an Algorithm? What is the need to study Algorithms? 2) Define: a) Time Efficiency b) Space Efficiency
More informationGiri Narasimhan. COT 6936: Topics in Algorithms. The String Matching Problem. Approximate String Matching
COT 6936: Topics in lgorithms Giri Narasimhan ECS 254 / EC 2443; Phone: x3748 giri@cs.fiu.edu http://www.cs.fiu.edu/~giri/teach/cot6936_s10.html https://online.cis.fiu.edu/portal/course/view.php?id=427
More informationSolution to Problem 1 of HW 2. Finding the L1 and L2 edges of the graph used in the UD problem, using a suffix array instead of a suffix tree.
Solution to Problem 1 of HW 2. Finding the L1 and L2 edges of the graph used in the UD problem, using a suffix array instead of a suffix tree. The basic approach is the same as when using a suffix tree,
More informationThere are algorithms, however, that need to execute statements in some other kind of ordering depending on certain conditions.
Introduction In the programs that we have dealt with so far, all statements inside the main function were executed in sequence as they appeared, one after the other. This type of sequencing is adequate
More informationLexical Considerations
Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.035, Spring 2010 Handout Decaf Language Tuesday, Feb 2 The project for the course is to write a compiler
More informationMulti-Pattern String Matching with Very Large Pattern Sets
Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume
More informationAdvanced Algorithms: Project
Advanced Algorithms: Project (deadline: May 13th, 2016, 17:00) Alexandre Francisco and Luís Russo Last modified: February 26, 2016 This project considers two different problems described in part I and
More informationAccelerating Boyer Moore Searches on Binary Texts
Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il
More information1- Write a single C++ statement that: A. Calculates the sum of the two integrates 11 and 12 and outputs the sum to the consol.
1- Write a single C++ statement that: A. Calculates the sum of the two integrates 11 and 12 and outputs the sum to the consol. B. Outputs to the console a floating point number f1 in scientific format
More information