First steps on Linux and programming

Size: px
Start display at page:

Download "First steps on Linux and programming"

Transcription

1 First steps on Linux and programming Adrien Poteaux CRIStAL, Université de Lille Year This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 Unported License. adrien.poteaux@univ-lille1.fr Linux? Programming? 1 / 16

2 Refresher course in Computer Science 6 weeks ; 50 hours in total A lot to do (not in that order): Linux basics / using a shell C language Fortran language Unix system How we ll work: A few lectures, More practical work, 4 projects (50%), One written exam (50%), Documents avalaible at Personal implication: take good uses, practice programmation, read, search on the web... Questions are welcome! My adrien.poteaux@univ-lille1.fr adrien.poteaux@univ-lille1.fr This lecture 2 / 16

3 Projects and notations During the lectures, 4 projects will get a mark : Fortran project ; due September 18th, before 9am ; 15% C project 1 (no pointers) ; 10% C project 2 (with pointers) ; 10% A last project (system) ; 15% These deadlines are in bold on the webpage. Remaining of the mark will be on paper: Written exam ; 50% adrien.poteaux@univ-lille1.fr This lecture 3 / 16

4 How to send your s! One archive by $ tar cvzf yourname-project.tar.gz cf man tar It should contain: The requested s (clean code - indentation, comments are welcome - put your names again there), Description of how to compile your s (better : make) Potentially a README (any general comment you want to make... ), No unnecessary (backup s, intermediate compilations s, executables that are generated by your code... ). = I cannot do anything from them! adrien.poteaux@univ-lille1.fr This lecture 4 / 16

5 Interpreted language vs compiled language Compiled language Interpreted language C, C++, Fortran... Shell, python, perl, php... The compiler transforms source code written in a programming language into binary form (the object code) to create an executable program. Executable is optimised. Produced executable unique to each processor (thus computer). = must be recompiled! The interpreter directly executes a sequence of instructions of the source code. No optimisation. The interpreter is required at each execution. adrien.poteaux@univ-lille1.fr Linux? Programming? 5 / 16

6 C and Fortran Fortran C Portable code (norm for the language and the librairies) High level language (data structure, functions, separated compilation... ) generic mathematical functions low-level language (bit & adresses manipulation) powerful and efficient languages not really premissive permissive specialised for scientific computing more general (operating system) multidimensional tables and associated functions adrien.poteaux@univ-lille1.fr Linux? Programming? 6 / 16

7 Compiled language? 1 Conception. Define your algorithm, write in pseudo-code... 2 Coding. Write your source code in a text.c for some C code,.f90 for some Fortran... like this one 3 Compiling your source code from the shell : $ gcc.c, $ gfortran.f90. 4 Execution. $./a.out run the command from the folder where the is! adrien.poteaux@univ-lille1.fr Linux? Programming? 7 / 16

8 The patriot bug In 1991, a Patriot anti-missile failed to intercept a Scud missile. 28 people were killed. The code worked with time increments of 0.1 s. But 0.1 is not representable in binary. In the 24-bit format used, the number stored was The error was After 100 hours = 360,000 seconds, time is wrong by 0.34s. In 0.34s, a Scud moves 500m adrien.poteaux@univ-lille1.fr Coding can be messy! 8 / 16

9 A real story (appeared at CERN) Using a IA32/x87 FPU (provides a 80 bit double extended format): Use the (robust and tested) standard sort function of the STL C++ library to sort objects by their radius: according to x x +y y. Sometimes (rarely) segfault, infinite loop... Why? Because the sort algorithm works under the following naive assumption: if A B, then, later, A B x x +y y inlined and compiled differently at two points of the program, computation on 64 or 80 bits, depending on register allocation enough to break the assumption (horribly rarely). No programming mistake! (thus very difficult to fix) adrien.poteaux@univ-lille1.fr Coding can be messy! 9 / 16

10 Another example: equality with floating point numbers What do you believe the following C program will print? (i.e. the execution of its compilation: $ gcc.c ;./a.out) # include <stdio.h> int main() { int i; float ref,index; ref = / 170.0; for ( i = 0; i < 250; i ++) { index = i ; if (ref==(index/(index+1.0))) break; } printf ("i = %d\n", i ) ; return 0; } adrien.poteaux@univ-lille1.fr Coding can be messy! 10 / 16

11 Another example: equality with floating point numbers What do you believe the following C program will print? (i.e. the execution of its compilation: $ gcc.c ;./a.out) # include <stdio.h> int main() { int i; float ref,index; ref = / 170.0; for ( i = 0; i < 250; i ++) { index = i ; if (ref==(index/(index+1.0))) break; } printf ("i = %d\n", i ) ; return 0; } Answer: i = 250 adrien.poteaux@univ-lille1.fr Coding can be messy! 10 / 16

12 Shell? interface between the user and the OS used to run commands / filters stdout, 1: standard output (default: screen) stdin, 0: standard input (default: keyboard) filter/command other s stderr, 2: error output (default: screen) One filter = one identifier (ls) + options (-al) + parameters (/bin) Each process returns a retour code (one byte echo $?). adrien.poteaux@univ-lille1.fr Linux? Programming? 11 / 16

13 Why using it? Some time to learn how to use it properly but... $ ls *.jpg wc -l will count the number jpeg pictures in the current directory (assuming they are correctly named). $ for i in *.JPG ; do mv $i `basename $i.jpg`.jpg ; done change the extension JPG by jpg for any concerned in the current directory. Way faster, and sometimes you have no choice! adrien.poteaux@univ-lille1.fr Linux? Programming? 12 / 16

14 Running commands The main idea : (options are parameters!) $ cmd [options] parameters Example, to start Firefox : $ firefox A parameter can be a bloc: $ command arg1 'arg 2 toto' "arg 3'" Running a command in background: $ emacs & Forgot to do so? C-z then $ bg A lot more! Cf chapter 1 of the lecture notes. Only one way to learn : PRACTICE! adrien.poteaux@univ-lille1.fr Linux? Programming? 13 / 16

15 Filesystem root home bin directory tmp ls cd rm poteaux toto.txt CS slides-shell.tex Filesystem 14 / 16

16 Absolute path (from the root) root home bin directory tmp ls cd rm poteaux toto.txt $ emacs /home/poteaux/cs/slides-shell.tex CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

17 Absolute path (from the root) root home bin directory tmp ls cd rm poteaux toto.txt $ emacs $HOME/CS/slides-shell.tex CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

18 Absolute path (from the root) root home bin directory tmp ls cd rm poteaux toto.txt $ emacs ~/CS/slides-shell.tex CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

19 Relative path (from the current directory) root home bin directory tmp ls cd rm poteaux toto.txt $ cd $ emacs CS/slides-shell.tex CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

20 Relative path (from the current directory) root home bin directory tmp ls cd rm poteaux toto.txt CS $ cd $ emacs CS/slides-shell.tex & $ cd CS ;$ emacs slides-shell.tex slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

21 Relative path (from the current directory) root home bin directory tmp ls cd rm poteaux toto.txt $ cd /directory $ /bin/rm CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

22 root home bin directory tmp ls cd rm poteaux toto.txt CS $ cd /directory $ rm (try echo $PATH) slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

23 Redirections root home bin directory tmp ls cd rm poteaux toto.txt $ cd ; ls CS > /tmp/toto.txt CS slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

24 Redirections root home bin directory tmp ls cd rm poteaux toto.txt CS $ cd ; ls CS > /tmp/toto.txt $ ls CS >> /tmp/toto.txt slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

25 A graph organisation root home bin directory tmp.. ls cd rm poteaux toto.txt. link $ cd ; emacs../poteaux/./link CS similar to $ emacs /directory/ slides-shell.tex adrien.poteaux@univ-lille1.fr Filesystem 14 / 16

26 Use the good tools! The key command: man. Uses the less viewer: h will display the available commands, q will quit the viewer, / followed by an expression will search the next apparition of this expression in the document, move to the first results, and highlight the others, n moves to the next apparition of the searched expression, N moves to the previous apparition of the searched expression, Use a programming text editor (emacs, vi). First contact is frightening but worths it! Print the refcard! Learn some shortcuts! (try not to use the mouse) Read more (links on the webpage)! Practice! An Introduction to the Linux Command Shell For Beginners, Unix Programming Tools (sections 4 and 5 at the moment). adrien.poteaux@univ-lille1.fr Miscellaneous 15 / 16

27 Script: short definition File containing shell commands. Interpret the : $. foo (in the current shell), $ sh foo (in another shell),... Run the directly: Need to be executable (chmod) Magic number: #!/bin/sh interpreted in a another shell Remark /bin/sh is just a link to the shell interpreter you are using. It can be for instance bash, dash or csh. You can see which version you are using via the command $ ls -l /bin/sh adrien.poteaux@univ-lille1.fr Miscellaneous 16 / 16

Perl and R Scripting for Biologists

Perl and R Scripting for Biologists Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications

More information

CSC209H Lecture 1. Dan Zingaro. January 7, 2015

CSC209H Lecture 1. Dan Zingaro. January 7, 2015 CSC209H Lecture 1 Dan Zingaro January 7, 2015 Welcome! Welcome to CSC209 Comments or questions during class? Let me know! Topics: shell and Unix, pipes and filters, C programming, processes, system calls,

More information

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen Introduction to Unix The Windows User perspective Wes Frisby Kyle Horne Todd Johansen What is Unix? Portable, multi-tasking, and multi-user operating system Software development environment Hardware independent

More information

Lec 1 add-on: Linux Intro

Lec 1 add-on: Linux Intro Lec 1 add-on: Linux Intro Readings: - Unix Power Tools, Powers et al., O Reilly - Linux in a Nutshell, Siever et al., O Reilly Summary: - Linux File System - Users and Groups - Shell - Text Editors - Misc

More information

M2PGER FORTRAN programming. General introduction. Virginie DURAND and Jean VIRIEUX 10/13/2013 M2PGER - ALGORITHME SCIENTIFIQUE

M2PGER FORTRAN programming. General introduction. Virginie DURAND and Jean VIRIEUX 10/13/2013 M2PGER - ALGORITHME SCIENTIFIQUE M2PGER 2013-2014 FORTRAN programming General introduction Virginie DURAND and Jean VIRIEUX 1 Why learning programming??? 2 Why learning programming??? ACQUISITION numerical Recording on magnetic supports

More information

Processes. Shell Commands. a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms:

Processes. Shell Commands. a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms: Processes The Operating System, Shells, and Python Shell Commands a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms: - Command prompt - Shell - CLI Shell commands

More information

Assignment 1: Communicating with Programs

Assignment 1: Communicating with Programs Assignment 1: Communicating with Programs EC602 Design by Software Fall 2018 Contents 1 Introduction 2 1.1 Assignment Goals........................... 2 1.2 Group Size.............................. 2 1.3

More information

Essential Unix and Linux! Perl for Bioinformatics, ! F. Pineda

Essential Unix and Linux! Perl for Bioinformatics, ! F. Pineda Essential Unix and Linux! Perl for Bioinformatics, 140.636! F. Pineda Generic computer architecture Memory Storage Fig. 1.2 From Designing Embedded Hardware, 2 nd Ed. by John Catsoulis OS concepts Shell

More information

Chapter 1 - Introduction. September 8, 2016

Chapter 1 - Introduction. September 8, 2016 Chapter 1 - Introduction September 8, 2016 Introduction Overview of Linux/Unix Shells Commands: built-in, aliases, program invocations, alternation and iteration Finding more information: man, info Help

More information

CMPUT 201: Practical Programming Methodology. Guohui Lin Department of Computing Science University of Alberta September 2018

CMPUT 201: Practical Programming Methodology. Guohui Lin Department of Computing Science University of Alberta September 2018 CMPUT 201: Practical Programming Methodology Guohui Lin guohui@ualberta.ca Department of Computing Science University of Alberta September 2018 Lecture 1: Course Outline Agenda: Course calendar description

More information

Linux Command Line Interface. December 27, 2017

Linux Command Line Interface. December 27, 2017 Linux Command Line Interface December 27, 2017 Foreword It is supposed to be a refresher (?!) If you are familiar with UNIX/Linux/MacOS X CLI, this is going to be boring... I will not talk about editors

More information

Command-line interpreters

Command-line interpreters Command-line interpreters shell Wiki: A command-line interface (CLI) is a means of interaction with a computer program where the user (or client) issues commands to the program in the form of successive

More information

CS370 Operating Systems

CS370 Operating Systems CS370 Operating Systems Colorado State University Yashwant K Malaiya Fall 2016 Lecture 5 Slides based on Text by Silberschatz, Galvin, Gagne Various sources 1 1 User Operating System Interface - CLI CLI

More information

Introduction to Linux

Introduction to Linux Introduction to Linux Prof. Jin-Soo Kim( jinsookim@skku.edu) TA - Dong-Yun Lee (dylee@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu What is Linux? A Unix-like operating

More information

Files

Files http://www.cs.fsu.edu/~langley/cop3353-2013-1/reveal.js-2013-02-11/02.html?print-pdf 02/11/2013 10:55 AM Files A normal "flat" file is a collection of information. It's usually stored somewhere reasonably

More information

18-Sep CSCI 2132 Software Development Lecture 6: Links and Inodes. Faculty of Computer Science, Dalhousie University. Lecture 6 p.

18-Sep CSCI 2132 Software Development Lecture 6: Links and Inodes. Faculty of Computer Science, Dalhousie University. Lecture 6 p. Lecture 6 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 6: Links and s 18-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor: Vlado Keselj Previous

More information

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )

More information

CSCI 2132 Software Development. Lecture 4: Files and Directories

CSCI 2132 Software Development. Lecture 4: Files and Directories CSCI 2132 Software Development Lecture 4: Files and Directories Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 12-Sep-2018 (4) CSCI 2132 1 Previous Lecture Some hardware concepts

More information

Introduction to the shell Part II

Introduction to the shell Part II Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility

More information

Shells and Shell Programming

Shells and Shell Programming Shells and Shell Programming 1 Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed

More information

Shells. A shell is a command line interpreter that is the interface between the user and the OS. The shell:

Shells. A shell is a command line interpreter that is the interface between the user and the OS. The shell: Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed performs the actions Example:

More information

Today. Review. Unix as an OS case study Intro to Shell Scripting. What is an Operating System? What are its goals? How do we evaluate it?

Today. Review. Unix as an OS case study Intro to Shell Scripting. What is an Operating System? What are its goals? How do we evaluate it? Today Unix as an OS case study Intro to Shell Scripting Make sure the computer is in Linux If not, restart, holding down ALT key Login! Posted slides contain material not explicitly covered in class 1

More information

5/20/2007. Touring Essential Programs

5/20/2007. Touring Essential Programs Touring Essential Programs Employing fundamental utilities. Managing input and output. Using special characters in the command-line. Managing user environment. Surveying elements of a functioning system.

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up

More information

Introduction to Linux. Woo-Yeong Jeong Computer Systems Laboratory Sungkyunkwan University

Introduction to Linux. Woo-Yeong Jeong Computer Systems Laboratory Sungkyunkwan University Introduction to Linux Woo-Yeong Jeong (wooyeong@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu What is Linux? A Unix-like operating system of a computer What is an

More information

Lecture 1. A. Sahu and S. V. Rao. Indian Institute of Technology Guwahati

Lecture 1. A. Sahu and S. V. Rao. Indian Institute of Technology Guwahati Lecture 1 Introduction to Computing A. Sahu and S. V. Rao Dept of Comp. Sc. & Engg. Indian Institute of Technology Guwahati 1 Outline Computer System Problem Solving and Flow Chart Linux Command ls, mkdir,

More information

CSCI 2132 Software Development. Lecture 3: Unix Shells and Other Basic Concepts

CSCI 2132 Software Development. Lecture 3: Unix Shells and Other Basic Concepts CSCI 2132 Software Development Lecture 3: Unix Shells and Other Basic Concepts Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 10-Sep-2018 (3) CSCI 2132 1 Introduction to UNIX

More information

An Introduction to Unix Power Tools

An Introduction to Unix Power Tools An to Unix Power Tools Randolph Langley Department of Computer Science Florida State University August 27, 2008 History of Unix Unix Today Command line versus graphical interfaces to COP 4342, Fall History

More information

Getting started with Hugs on Linux

Getting started with Hugs on Linux Getting started with Hugs on Linux COM1022 Functional Programming Techniques Dr Hans Georg Schaathun University of Surrey Autumn 2009 Week 7 Dr Hans Georg Schaathun Getting started with Hugs on Linux Autumn

More information

Unix as a Platform Exercises. Course Code: OS-01-UNXPLAT

Unix as a Platform Exercises. Course Code: OS-01-UNXPLAT Unix as a Platform Exercises Course Code: OS-01-UNXPLAT Working with Unix 1. Use the on-line manual page to determine the option for cat, which causes nonprintable characters to be displayed. Run the command

More information

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80 CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure

More information

Chap2: Operating-System Structures

Chap2: Operating-System Structures Chap2: Operating-System Structures Objectives: services OS provides to users, processes, and other systems structuring an operating system how operating systems are designed and customized and how they

More information

Introduction to Linux

Introduction to Linux Introduction to Linux Prof. Jin-Soo Kim( jinsookim@skku.edu) TA - Kisik Jeong (kisik@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu What is Linux? A Unix-like operating

More information

Shells and Shell Programming

Shells and Shell Programming Shells and Shell Programming Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed

More information

Beyond this course. Machine code. Readings: CP:AMA 2.1, 15.4

Beyond this course. Machine code. Readings: CP:AMA 2.1, 15.4 Beyond this course Readings: CP:AMA 2.1, 15.4 CS 136 Spring 2018 13: Beyond 1 Machine code In Section 04 we briefly discussed compiling: converting source code into machine code so it can be run or executed.

More information

Introduction to Linux

Introduction to Linux Introduction to Linux Prof. Jin-Soo Kim( jinsookim@skku.edu) TA Sanghoon Han(sanghoon.han@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu Announcement (1) Please come

More information

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

Shell Programming Systems Skills in C and Unix

Shell Programming Systems Skills in C and Unix Shell Programming 15-123 Systems Skills in C and Unix The Shell A command line interpreter that provides the interface to Unix OS. What Shell are we on? echo $SHELL Most unix systems have Bourne shell

More information

Getting started with Hugs on Linux

Getting started with Hugs on Linux Getting started with Hugs on Linux CS190 Functional Programming Techniques Dr Hans Georg Schaathun University of Surrey Autumn 2008 Week 1 Dr Hans Georg Schaathun Getting started with Hugs on Linux Autumn

More information

Unix System Architecture, File System, and Shell Commands

Unix System Architecture, File System, and Shell Commands Unix System Architecture, File System, and Shell Commands Prof. (Dr.) K.R. Chowdhary, Director COE Email: kr.chowdhary@iitj.ac.in webpage: http://www.krchowdhary.com JIET College of Engineering August

More information

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version... Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing

More information

Linux Systems Administration Getting Started with Linux

Linux Systems Administration Getting Started with Linux Linux Systems Administration Getting Started with Linux Network Startup Resource Center www.nsrc.org These materials are licensed under the Creative Commons Attribution-NonCommercial 4.0 International

More information

Lecture 7: file I/O, more Unix

Lecture 7: file I/O, more Unix CIS 330: / / / / (_) / / / / _/_/ / / / / / \/ / /_/ / `/ \/ / / / _/_// / / / / /_ / /_/ / / / / /> < / /_/ / / / / /_/ / / / /_/ / / / / / \ /_/ /_/_/_/ _ \,_/_/ /_/\,_/ \ /_/ \ //_/ /_/ Lecture 7: file

More information

Working with Basic Linux. Daniel Balagué

Working with Basic Linux. Daniel Balagué Working with Basic Linux Daniel Balagué How Linux Works? Everything in Linux is either a file or a process. A process is an executing program identified with a PID number. It runs in short or long duration

More information

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking

More information

Introduction to remote command line Linux. Research Computing Team University of Birmingham

Introduction to remote command line Linux. Research Computing Team University of Birmingham Introduction to remote command line Linux Research Computing Team University of Birmingham Linux/UNIX/BSD/OSX/what? v All different v UNIX is the oldest, mostly now commercial only in large environments

More information

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical

More information

CSCI2467: Systems Programming Concepts

CSCI2467: Systems Programming Concepts CSCI2467: Systems Programming Concepts Class activity: bash shell literacy Instructor: Matthew Toups Fall 2017 Today 0 Shells History Usage Scripts vs. Programs 1 Bash shell: practical uses for your systems

More information

Introduction. Let s start with the first set of slides

Introduction. Let s start with the first set of slides Tux Wars Class - 1 Table of Contents 1) Introduction to Linux and its history 2) Booting process of a linux system 3) Linux Kernel 4) What is a shell 5) Bash Shell 6) Anatomy of command 7) Let s make our

More information

Introduction to Linux

Introduction to Linux Introduction to Linux Mukesh Pund Principal Scientist, NISCAIR, New Delhi, India History In 1969, a team of developers developed a new operating system called Unix which was written using C Linus Torvalds,

More information

Lecture 9: Potpourri: Call by reference vs call by value Enum / struct / union Advanced Unix

Lecture 9: Potpourri: Call by reference vs call by value Enum / struct / union Advanced Unix ....... \ \ \ / / / / \ \ \ \ / \ / \ \ \ V /,----' / ^ \ \.--..--. / ^ \ `--- ----` / ^ \. ` > < / /_\ \. ` / /_\ \ / /_\ \ `--' \ /. \ `----. / \ \ '--' '--' / \ / \ \ / \ / / \ \ (_ ) \ (_ ) / / \ \

More information

BIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description:

BIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description: BIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description: This course provides Bioinformatics students with the

More information

Assignment clarifications

Assignment clarifications Assignment clarifications How many errors to print? at most 1 per token. Interpretation of white space in { } treat as a valid extension, involving white space characters. Assignment FAQs have been updated.

More information

Welcome to Linux. Lecture 1.1

Welcome to Linux. Lecture 1.1 Welcome to Linux Lecture 1.1 Some history 1969 - the Unix operating system by Ken Thompson and Dennis Ritchie Unix became widely adopted by academics and businesses 1977 - the Berkeley Software Distribution

More information

Problem Set 1: Unix Commands 1

Problem Set 1: Unix Commands 1 Problem Set 1: Unix Commands 1 WARNING: IF YOU DO NOT FIND THIS PROBLEM SET TRIVIAL, I WOULD NOT RECOMMEND YOU TAKE THIS OFFERING OF 300 AS YOU DO NOT POSSESS THE REQUISITE BACKGROUND TO PASS THE COURSE.

More information

CHE3935. Lecture 1. Introduction to Linux

CHE3935. Lecture 1. Introduction to Linux CHE3935 Lecture 1 Introduction to Linux 1 Logging In PuTTY is a free telnet/ssh client that can be run without installing it within Windows. It will only give you a terminal interface, but used with a

More information

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow

More information

Linux Essentials. Smith, Roderick W. Table of Contents ISBN-13: Introduction xvii. Chapter 1 Selecting an Operating System 1

Linux Essentials. Smith, Roderick W. Table of Contents ISBN-13: Introduction xvii. Chapter 1 Selecting an Operating System 1 Linux Essentials Smith, Roderick W. ISBN-13: 9781118106792 Table of Contents Introduction xvii Chapter 1 Selecting an Operating System 1 What Is an OS? 1 What Is a Kernel? 1 What Else Identifies an OS?

More information

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2 CSE Linux VM For Microsoft Windows Based on opensuse Leap 42.2 Dr. K. M. Flurchick February 2, 2017 Contents 1 Introduction 1 2 Requirements 1 3 Procedure 1 4 Usage 3 4.1 Start/Stop.................................................

More information

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/ Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux

More information

EECS2301. Lab 1 Winter 2016

EECS2301. Lab 1 Winter 2016 EECS2301 Lab 1 Winter 2016 Lab Objectives In this lab, you will be introduced to the Linux operating system. The basic commands will be presented in this lab. By the end of you alb, you will be asked to

More information

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking

More information

Recap From Last Time:

Recap From Last Time: Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Php Scripts If Then Else Linux Bash Shell

Php Scripts If Then Else Linux Bash Shell Php Scripts If Then Else Linux Bash Shell I am using awk as part of and if then else statement. KSH, CSH, SH, BASH, PERL, PHP, SED, AWK and shell scripts and shell scripting languages here. I just wrote

More information

1Z Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions

1Z Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions 1Z0-409 Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions Table of Contents Introduction to 1Z0-409 Exam on Oracle Linux Fundamentals (Oracle Partner Network)... 2 Oracle

More information

BGGN 213 Working with UNIX Barry Grant

BGGN 213 Working with UNIX Barry Grant BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Crash Course in Unix. For more info check out the Unix man pages -orhttp://www.cs.rpi.edu/~hollingd/unix. -or- Unix in a Nutshell (an O Reilly book).

Crash Course in Unix. For more info check out the Unix man pages -orhttp://www.cs.rpi.edu/~hollingd/unix. -or- Unix in a Nutshell (an O Reilly book). Crash Course in Unix For more info check out the Unix man pages -orhttp://www.cs.rpi.edu/~hollingd/unix -or- Unix in a Nutshell (an O Reilly book). 1 Unix Accounts To access a Unix system you need to have

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Introduction to Linux Organizing Files

Introduction to Linux Organizing Files Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing

More information

The Unix Shell & Shell Scripts

The Unix Shell & Shell Scripts The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises

More information

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater)

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) 28 January 2013 Jason Yosinski Original slides available under Creative Commons Attribution-ShareAlike 3.0

More information

Short Read Sequencing Analysis Workshop

Short Read Sequencing Analysis Workshop Short Read Sequencing Analysis Workshop Day 2 Learning the Linux Compute Environment In-class Slides Matt Hynes-Grace Manager of IT Operations, BioFrontiers Institute Review of Day 2 Videos Video 1 Introduction

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

UNIX. The Very 10 Short Howto for beginners. Soon-Hyung Yook. March 27, Soon-Hyung Yook UNIX March 27, / 29

UNIX. The Very 10 Short Howto for beginners. Soon-Hyung Yook. March 27, Soon-Hyung Yook UNIX March 27, / 29 UNIX The Very 10 Short Howto for beginners Soon-Hyung Yook March 27, 2015 Soon-Hyung Yook UNIX March 27, 2015 1 / 29 Table of Contents 1 History of Unix 2 What is UNIX? 3 What is Linux? 4 How does Unix

More information

Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny.

Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny. Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny stefano.gaiarsa@unimi.it Linux and the command line PART 1 Survival kit for the bash environment Purpose of the

More information

CS : Programming for Non-Majors, Fall 2018 Programming Project #5: Big Statistics Due by 10:20am Wednesday November

CS : Programming for Non-Majors, Fall 2018 Programming Project #5: Big Statistics Due by 10:20am Wednesday November CS 1313 010: Programming for Non-Majors, Fall 2018 Programming Project #5: Big Statistics Due by 10:20am Wednesday November 7 2018 This fifth programming project will give you experience writing programs

More information

Files and Directories

Files and Directories CSCI 2132: Software Development Files and Directories Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Files and Directories Much of the operation of Unix and programs running on

More information

System Administration

System Administration Süsteemihaldus MTAT.08.021 System Administration UNIX shell basics Name service DNS 1/69 Command Line Read detailed manual for specific command using UNIX online documentation or so called manual (man)

More information

Vi & Shell Scripting

Vi & Shell Scripting Vi & Shell Scripting Comp-206 : Introduction to Week 3 Joseph Vybihal Computer Science McGill University Announcements Sina Meraji's office hours Trottier 3rd floor open area Tuesday 1:30 2:30 PM Thursday

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,

More information

Lecture 8: Structs & File I/O

Lecture 8: Structs & File I/O ....... \ \ \ / / / / \ \ \ \ / \ / \ \ \ V /,----' / ^ \ \.--..--. / ^ \ `--- ----` / ^ \. ` > < / /_\ \. ` / /_\ \ / /_\ \ `--' \ /. \ `----. / \ \ '--' '--' / \ / \ \ / \ / / \ \ (_ ) \ (_ ) / / \ \

More information

Chapter-3. Introduction to Unix: Fundamental Commands

Chapter-3. Introduction to Unix: Fundamental Commands Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system

More information

Introduction in Unix. Linus Torvalds Ken Thompson & Dennis Ritchie

Introduction in Unix. Linus Torvalds Ken Thompson & Dennis Ritchie Introduction in Unix Linus Torvalds Ken Thompson & Dennis Ritchie My name: John Donners John.Donners@surfsara.nl Consultant at SURFsara And Cedric Nugteren Cedric.Nugteren@surfsara.nl Consultant at SURFsara

More information

Linux for Beginners. Windows users should download putty or bitvise:

Linux for Beginners. Windows users should download putty or bitvise: Linux for Beginners Windows users should download putty or bitvise: https://putty.org/ Brief History UNIX (1969) written in PDP-7 assembly, not portable, and designed for programmers as a reaction by Bell

More information

CSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes

CSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes CSE 390a Lecture 2 Exploring Shell Commands, Streams, Redirection, and Processes slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture

More information

A Brief Introduction to Unix

A Brief Introduction to Unix A Brief Introduction to Unix Sean Barag Drexel University March 30, 2011 Sean Barag (Drexel University) CS 265 - A Brief Introduction to Unix March 30, 2011 1 / 17 Outline 1 Directories

More information

GNU/Linux 101. Casey McLaughlin. Research Computing Center Spring Workshop Series 2018

GNU/Linux 101. Casey McLaughlin. Research Computing Center Spring Workshop Series 2018 GNU/Linux 101 Casey McLaughlin Research Computing Center Spring Workshop Series 2018 rccworkshop IC;3df4mu bash-2.1~# man workshop Linux101 RCC Workshop L101 OBJECTIVES - Operating system concepts - Linux

More information

: the User (owner) for this file (your cruzid, when you do it) Position: directory flag. read Group.

: the User (owner) for this file (your cruzid, when you do it) Position: directory flag. read Group. CMPS 12L Introduction to Programming Lab Assignment 2 We have three goals in this assignment: to learn about file permissions in Unix, to get a basic introduction to the Andrew File System and it s directory

More information

Lecture P3: Unix. Overview. Operating Systems. Layers of Abstractions in Unix. Background

Lecture P3: Unix. Overview. Operating Systems. Layers of Abstractions in Unix. Background Overview Lecture P3: Unix Background Files Abstraction for storage (disks). File manipulation commands. Processes. Abstraction for processor (CPU). Some useful commands. Interactions. Between files and

More information

PROGRAMMAZIONE I A.A. 2015/2016

PROGRAMMAZIONE I A.A. 2015/2016 PROGRAMMAZIONE I A.A. 2015/2016 SHELL SHELL SHELL A program that interprets commands Allows a user to execute commands by typing them manually at a terminal, or automatically in programs called shell scripts.

More information

CS 1110 SPRING 2016: GETTING STARTED (Jan 27-28) First Name: Last Name: NetID:

CS 1110 SPRING 2016: GETTING STARTED (Jan 27-28)   First Name: Last Name: NetID: CS 1110 SPRING 2016: GETTING STARTED (Jan 27-28) http://www.cs.cornell.edu/courses/cs1110/2016sp/labs/lab01/lab01.pdf First Name: Last Name: NetID: Goals. Learning a computer language is a lot like learning

More information

Lecture 3. Unix. Question? b. The world s best restaurant. c. Being in the top three happiest countries in the world.

Lecture 3. Unix. Question? b. The world s best restaurant. c. Being in the top three happiest countries in the world. Lecture 3 Unix Question? Denmark is famous for? a. LEGO. b. The world s best restaurant. c. Being in the top three happiest countries in the world. d. Having the highest taxes in Europe (57%). e. All of

More information

EE516: Embedded Software Project 1. Setting Up Environment for Projects

EE516: Embedded Software Project 1. Setting Up Environment for Projects EE516: Embedded Software Project 1. Setting Up Environment for Projects By Dong Jae Shin 2015. 09. 01. Contents Introduction to Projects of EE516 Tasks Setting Up Environment Virtual Machine Environment

More information

Working with Shell Scripting. Daniel Balagué

Working with Shell Scripting. Daniel Balagué Working with Shell Scripting Daniel Balagué Editing Text Files We offer many text editors in the HPC cluster. Command-Line Interface (CLI) editors: vi / vim nano (very intuitive and easy to use if you

More information

Linux Essentials Objectives Topics:

Linux Essentials Objectives Topics: Linux Essentials Linux Essentials is a professional development certificate program that covers basic knowledge for those working and studying Open Source and various distributions of Linux. Exam Objectives

More information

Unix basics exercise MBV-INFX410

Unix basics exercise MBV-INFX410 Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.

More information

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt

More information

Linux Shell Script. J. K. Mandal

Linux Shell Script. J. K. Mandal Linux Shell Script J. K. Mandal Professor, Department of Computer Science & Engineering, Faculty of Engineering, Technology & Management University of Kalyani Kalyani, Nadia, West Bengal E-mail: jkmandal@klyuniv.ac.in,

More information

9.2 Linux Essentials Exam Objectives

9.2 Linux Essentials Exam Objectives 9.2 Linux Essentials Exam Objectives This chapter will cover the topics for the following Linux Essentials exam objectives: Topic 3: The Power of the Command Line (weight: 10) 3.3: Turning Commands into

More information

ITST Searching, Extracting & Archiving Data

ITST Searching, Extracting & Archiving Data ITST 1136 - Searching, Extracting & Archiving Data Name: Step 1 Sign into a Pi UN = pi PW = raspberry Step 2 - Grep - One of the most useful and versatile commands in a Linux terminal environment is the

More information