Introduction to Linux Organizing Files
|
|
- Frederick Stevens
- 5 years ago
- Views:
Transcription
1 Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick
2 Arranging, Organizing, Packing 2
3 Command: sort Sort the lines contained in a file or a group of files, alphabetically, and write the solution to standard output. Very useful when combined with other commands (see pipes and redirections). Format: sort <filenames> Options: -r or --reverse -n or --numeric-sort -k or --key <pos1> [,<pos2>] 3
4 Command: tar tape archive This name is a misnomer and dates back to when it was used for tapes. Now tar is commonly used to collect together sets of files and directory trees into a single file, which is usually called a tar file and by convention ends with the extension.tar. This archive, or tar file, (or tar ball) is a file that contains other files plus information about them, such as their filename, owner, timestamps, and access permissions. This allows collections of files to be moved around, shared, or transported easily by simply manipulating the single tar file. 4
5 Options for tar Format: tar <operation> [options] <file(s)> Typical operations: (note, no dash(-) required) c - create x extract t list Options: -v - verbose -z - filter through gzip -f <thisfile> use file thisfile 5
6 Example: tar Create an archive by tarring up everything in the myproject mydata and mysrc directories: tar cvf myproject.tar myproject mydata mysrc Note: it is usually much better to use relative directory paths so that there are no issues when untarring the archive. List contents of a tar archive: tar tvf myproject.tar Extract all the data from the archive: tar xvf myproject.tar To unzip and untar in one step (note: by convention these files usually have the extension.tar.gz or more commonly,.tgz): tar xzf ncardata.tgz 6
7 Command: zip and unzip zip and unzip are common utilities for compressing and decompressing files. Format: zip <filename.zip> <list of files to add> filename.zip is the archive file name. <list of files to add> is the list of all the files you want to add to the zip. unzip <filename.zip> To restore use unzip <filename.zip> To list the files in the archive use -t option 7
8 Command: compress and gzip compress and gzip (gnu zip) are utilities for compressing and decompressing files (which may be or may not be archive files). Format: compress <filename> filename is replaced with compressed filename.z To restore use uncompress <filename.z> gzip <filename> filename is replaced with compressed filename.gz To restore use gunzip or gzip -d 8
9 Exercise 4 1. Use tar to create the archive files.tar of the scratch directory. 2. Generate a long listing of the directory. (Note the size of the archive file). 3. Compress the file files.tar. 4. Generate a long listing of the directory. (Note the size of the compressed archive file). 9
10 Pipes and Redirection 10
11 Redirection Output from programs are: usually written to the screen, referred to as standard output (stdout). Input for programs are: usually comes from the keyboard. If no file arguments are given, referred to as standard input (stdin). Error messages from processes go to another output channel: usually written to the screen, referred to as standard error (stderr). 11
12 Redirection and Pipes You begin to experience the power of Linux when you combine simple commands together to perform complex tasks. Most (all?) Linux commands can be piped together. Use a - as the value for an argument to mean read this from standard input. 12
13 Redirection and Pipes > >> < redirects stdout, appends stdout, redirects stdin, Redirecting stderr varies by the shell, use & in tcsh/csh use 2> in bash/ksh/sh pipes (connects) stdout of one command to stdin of another command. 13
14 Jobs and Processes 14
15 Command: ps process status This is a snapshot of current processes, and in particular, displays the process id (pid). Options vary somewhat with Linux flavors and you can customize the output, if desired. Examples: show all processes owned by userid. ps u <userid> show every process in long format ps -elf Find all processes of a particular kind labeled by <string>. ps elf grep <string> 15
16 Command: kill,pkill,ctrl-c Terminate a process. You can only terminate processes you own, unless, of course, you are root. ctrl-c To terminate a process running that hasn t ended. kill <pid> kill processes with the TERM signal. kill -9 <pid> kill processes with the KILL signal -9 (stronger form). pkill <name> looks up process based on name or other attribute (not in all versions of Linux). 16
17 Command: bg, fg, ctrl-z, & To run a job in the background, just end the command with an &. This allows the job to run and the shell will return control to the user (recall Linux is innately multiprocess). mylongrunningjob & If a job is already running and you want to interrupt it and put it in the background use ^z (ctrl-z) and bg. To return a job to the foreground, use fg. 17
18 Command: jobs jobs shows all processes running in the background. Use fg %n to move job n to the foreground, if required. fg by itself will foreground the default job. kill %n will kill job n Example: % jobs [1] + Running OracleCalendar/bin/ocal [2] - Running emacs [3] Running mulberry 18
19 Environment Variables Environment variables are used (sometimes required) by many applications. Environment variables can be modified by you. Environment variables customize the runtime behavior for applications (including the shell). You can save environment variables in a special file called a resource file. 19
20 1. In your current shell, type env. Try to interpret the results. Try env sort Exercise 5 2.Use setenv to set an environment variable TEST to the value /usr/share. Confirm this using env. 3.Type bash to change your shell. 4.Use alias to create a simple shortcut, alias more to the letter m. 20
21 Tips and Tricks 21
22 Command: history tcsh shell Issued as a command, this displays the history of commands used in the particular shell, as a list. In the tcsh shell, set the variables: history number of events saved within a session, savehist number of events saved between sessions.!string will repeat command beginning with string. Use the ^p, ^n keys to page through history or use the up/down arrow keys. You can interactively edit the command line to modify the previous command as needed. Use the left/right arrows, crtl-e end of line, ctrl-a to get to the beginning of the line. 22
23 Command: history - bash shell Issued as a command, this shows the history of commands, used in the particular shell, as a list. In the bash shell, set the variables: HISTSIZE number of events saved within a session, Histfilesize number of events saved between sessions. The rest works much like it does in the tcsh, except it does not have the searching using the meta keys. Caveat: I m not a bash user so maybe there are redeeming features to it. 23
24 File Completion To avoid typing mistakes, use file completion. The <tab> character will complete the entry, up to the next non-unique point. tcsh: ^d shows you all possible completions. set autolist which will show you possible completions automatically. You can put this variable in your.cshrc resource file. bash: A second <tab> shows all possible completions. 24
25 Command: alias This will allow you to create shortcuts for commonly used commands. alias, by itself, will display all the currently (i.e. in the shell you are in) defined aliases. You can pass arguments to alias. Examples: alias ls ls CFA alias lm ls lt \!* more alias h history 25
26 Good (lots) Linux: The Good, The Bad, and The Ugly Powerful, efficient, secure, stable, widespread, free, developerfriendly, fast, extensible, customizable. Bad (depends on the user) UI needs work, poor plug-n-play support, help may be hard to find (if no one you know uses it). Ugly (rarely) Sometimes arcane syntax. 26
27 man pages Linux Commands Summary Working with files and directories pwd, cd, ls, mkdir, rmdir, cp, mv, rm, cat, more, less, grep Wildcards *,?, [] Permissions chmod, chgrp Finding stuff find, which, whereis, locate Packing and Unpacking stuff tar, gzip, gunzip, compress, uncompress 27
28 Linux Commands Summary Cont'd Pipes and redirection >, >>, <, Jobs and processes ps, kill, pkill, ctrl-c (^c), bg, ctrl-z (^z), &, fg, jobs Quick and Easy: shortcuts and tricks of the trade file completion, history, alias 28
29 Linux is an oral tradition. For More Information man pages, man pages, man pages info command We used some material from: 29
30 Resources Google: GNU: Linux documentation project: O'Reilly: Red Hat's documentation: UNIX: Your distribution's man pages and assorted documentation. 30
Computer Systems and Architecture
Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,
More informationIntroduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen
Introduction to Unix The Windows User perspective Wes Frisby Kyle Horne Todd Johansen What is Unix? Portable, multi-tasking, and multi-user operating system Software development environment Hardware independent
More informationComputer Systems and Architecture
Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,
More informationIntroduction to UNIX Shell Exercises
Introduction to UNIX Shell Exercises Determining Your Shell Open a new window or use an existing window for this exercise. Observe your shell prompt - is it a $ or %? What does this tell you? Find out
More informationLinux Command Line Interface. December 27, 2017
Linux Command Line Interface December 27, 2017 Foreword It is supposed to be a refresher (?!) If you are familiar with UNIX/Linux/MacOS X CLI, this is going to be boring... I will not talk about editors
More informationVirtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/
Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux
More informationIntroduction to remote command line Linux. Research Computing Team University of Birmingham
Introduction to remote command line Linux Research Computing Team University of Birmingham Linux/UNIX/BSD/OSX/what? v All different v UNIX is the oldest, mostly now commercial only in large environments
More informationIntroduction to Linux
Introduction to Linux January 2011 Don Bahls User Consultant (Group Leader) bahls@arsc.edu (907) 450-8674 Overview The shell Common Commands File System Organization Permissions Environment Variables I/O
More informationLab 2: Linux/Unix shell
Lab 2: Linux/Unix shell Comp Sci 1585 Data Structures Lab: Tools for Computer Scientists Outline 1 2 3 4 5 6 7 What is a shell? What is a shell? login is a program that logs users in to a computer. When
More informationMills HPC Tutorial Series. Linux Basics I
Mills HPC Tutorial Series Linux Basics I Objectives Command Line Window Anatomy Command Structure Command Examples Help Files and Directories Permissions Wildcards and Home (~) Redirection and Pipe Create
More informationUNIX Quick Reference
UNIX Quick Reference This card represents a brief summary of some of the more frequently used UNIX commands that all users should be at least somewhat familiar with. Some commands listed have much more
More informationPerl and R Scripting for Biologists
Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications
More informationUnix background. COMP9021, Session 2, Using the Terminal application, open an x-term window. You type your commands in an x-term window.
Unix background COMP9021, Session 2, 2016 1 Introduction Using the Terminal application, open an x-term window. You type your commands in an x-term window. Many commands take one or more arguments. Many
More informationacmteam/unix.pdf How to manage your account (user ID, password, shell); How to compile C, C++, and Java programs;
Note: you can find this file under: http://www.cs.queensu.ca/ acmteam/unix.pdf Introduction to Unix Tutorial In this tutorial, you will learn: How to manage your account (user ID, password, shell); Navigating
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationLab Week02 - Part I. Shell Commands. Professional Training Academy Linux Series
Lab Week02 - Part I Shell Commands Professional Training Academy Linux Series Commands: Manipulation cp : copy a file To copy a file you need to give a source and then a destination e.g. to copy the file
More informationCommand-line interpreters
Command-line interpreters shell Wiki: A command-line interface (CLI) is a means of interaction with a computer program where the user (or client) issues commands to the program in the form of successive
More informationIntroduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
More informationRead the relevant material in Sobell! If you want to follow along with the examples that follow, and you do, open a Linux terminal.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationSystem Administration
Süsteemihaldus MTAT.08.021 System Administration UNIX shell basics Name service DNS 1/69 Command Line Read detailed manual for specific command using UNIX online documentation or so called manual (man)
More informationIntroduction to Unix: Fundamental Commands
Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating
More informationChap2: Operating-System Structures
Chap2: Operating-System Structures Objectives: services OS provides to users, processes, and other systems structuring an operating system how operating systems are designed and customized and how they
More informationUNIX Basics. UNIX Basics CIS 218 Oakton Community College
UNIX Basics UNIX Basics CIS 218 Oakton Community College History UNIX was invented in 1969 at AT&T Bell Labs Ken Thompson and Dennis Ritchie are credited as the original architects and developers of C.
More informationUnix basics exercise MBV-INFX410
Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.
More informationBasic Shell Commands
Basic Shell Commands Jeremy Sanders October 2011 1. acroread - Read or print a PDF file. 2. cat - Send a file to the screen in one go. Useful for piping to other programs cat file1 # list file1 to screen
More informationCSE 390a Lecture 2. Exploring Shell Commands, Streams, Redirection, and Processes
CSE 390a Lecture 2 Exploring Shell Commands, Streams, Redirection, and Processes slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture
More informationProcesses. Shell Commands. a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms:
Processes The Operating System, Shells, and Python Shell Commands a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms: - Command prompt - Shell - CLI Shell commands
More information5/20/2007. Touring Essential Programs
Touring Essential Programs Employing fundamental utilities. Managing input and output. Using special characters in the command-line. Managing user environment. Surveying elements of a functioning system.
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationIntroduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines
Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical
More informationLinux Command Line Primer. By: Scott Marshall
Linux Command Line Primer By: Scott Marshall Draft: 10/21/2007 Table of Contents Topic Page(s) Preface 1 General Filesystem Background Information 2 General Filesystem Commands 2 Working with Files and
More informationIntroduction to the Linux Command Line January Presentation Topics
1/22/13 Introduction to the Linux Command Line January 2013 Presented by Oralee Nudson ARSC User Consultant & Student Supervisor onudson@alaska.edu Presentation Topics Information Assurance and Security
More informationIntroduction: What is Unix?
Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix
More informationRecap From Last Time:
Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and
More informationUnix Tools / Command Line
Unix Tools / Command Line An Intro 1 Basic Commands / Utilities I expect you already know most of these: ls list directories common options: -l, -F, -a mkdir, rmdir make or remove a directory mv move/rename
More informationBGGN 213 Working with UNIX Barry Grant
BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and
More informationChapter-3. Introduction to Unix: Fundamental Commands
Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system
More informationCSC UNIX System, Spring 2015
CSC 352 - UNIX System, Spring 2015 Study guide for the CSC352 midterm exam (20% of grade). Dr. Dale E. Parson, http://faculty.kutztown.edu/parson We will have a midterm on March 19 on material we have
More informationIntroduction To. Barry Grant
Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up
More informationResearch. We make it happen. Unix Basics. User Support Group help-line: personal:
Research. We make it happen. Unix Basics Presented by: Patton Fast User Support Group help-line: help@msi.umn.edu 612-626-0802 personal: pfast@msi.umn.edu 612-625-6573 Outline I. Warnings! II. III. IV.
More informationIntroduction To Linux. Rob Thomas - ACRC
Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free
More informationIntroduction to Linux Workshop 1
Introduction to Linux Workshop 1 The George Washington University SEAS Computing Facility Created by Jason Hurlburt, Hadi Mohammadi, Marco Suarez hurlburj@gwu.edu Logging In The lab computers will authenticate
More informationIMPORTANT: Logging Off LOGGING IN
These are a few basic Unix commands compiled from Unix web sites, and printed materials. The main purpose is to help a beginner to go around with fewer difficulties. Therefore, I will be adding to this
More informationComputer Architecture Lab 1 (Starting with Linux)
Computer Architecture Lab 1 (Starting with Linux) Linux is a computer operating system. An operating system consists of the software that manages your computer and lets you run applications on it. The
More informationCSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2
CSE Linux VM For Microsoft Windows Based on opensuse Leap 42.2 Dr. K. M. Flurchick February 2, 2017 Contents 1 Introduction 1 2 Requirements 1 3 Procedure 1 4 Usage 3 4.1 Start/Stop.................................................
More informationUnix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University
Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )
More informationUnix/Linux Operating System. Introduction to Computational Statistics STAT 598G, Fall 2011
Unix/Linux Operating System Introduction to Computational Statistics STAT 598G, Fall 2011 Sergey Kirshner Department of Statistics, Purdue University September 7, 2011 Sergey Kirshner (Purdue University)
More informationUsing UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program
Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the
More informationBIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description:
BIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description: This course provides Bioinformatics students with the
More informationLinux Refresher (1) 310/ Fourth Workshop on Distributed Laboratory Instrumentation Systems (30 October - 24 November 2006)
310/1779-4 Fourth Workshop on Distributed Laboratory Instrumentation Systems (30 October - 24 November 2006) Linux Refresher (1) Razaq Babalola IJADUOLA These lecture notes are intended only for distribution
More informationLinux at the Command Line Don Johnson of BU IS&T
Linux at the Command Line Don Johnson of BU IS&T We ll start with a sign in sheet. We ll end with a class evaluation. We ll cover as much as we can in the time allowed; if we don t cover everything, you
More informationIntroduction to UNIX/Linux
Introduction to UNIX/Linux Biochemistry Boot Camp 2018 Session #3 Nick Fitzkee nfitzkee@chemistry.msstate.edu Operating system (OS) Some terms Command-line interface (CLI) Graphical user interface (GUI)
More informationLab #1 Installing a System Due Friday, September 6, 2002
Lab #1 Installing a System Due Friday, September 6, 2002 Name: Lab Time: Grade: /10 The Steps of Installing a System Today you will install a software package. Implementing a software system is only part
More informationFREEENGINEER.ORG. 1 of 6 11/5/15 8:31 PM. Learn UNIX in 10 minutes. Version 1.3. Preface
FREEENGINEER.ORG Learn UNIX in 10 minutes. Version 1.3 Preface This is something that I had given out to students (CAD user training) in years past. The purpose was to have on one page the basics commands
More informationUnix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois
Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No
More informationChapter 1 - Introduction. September 8, 2016
Chapter 1 - Introduction September 8, 2016 Introduction Overview of Linux/Unix Shells Commands: built-in, aliases, program invocations, alternation and iteration Finding more information: man, info Help
More informationCSCI 2132 Software Development. Lecture 5: File Permissions
CSCI 2132 Software Development Lecture 5: File Permissions Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 14-Sep-2018 (5) CSCI 2132 1 Files and Directories Pathnames Previous
More informationIntroduction to Linux
Introduction to Linux University of Bristol - Advance Computing Research Centre 1 / 47 Operating Systems Program running all the time Interfaces between other programs and hardware Provides abstractions
More informationTable of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs
Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationUnix Basics. Systems Programming Concepts
Concepts Unix directories Important Unix file commands man, pwd, ls, mkdir, cd, cp, mv File and directory access rights through permission settings Using chmod to change permissions Other important Unix
More informationIntroduction to Linux
Introduction to Linux Mukesh Pund Principal Scientist, NISCAIR, New Delhi, India History In 1969, a team of developers developed a new operating system called Unix which was written using C Linus Torvalds,
More informationWorking with Basic Linux. Daniel Balagué
Working with Basic Linux Daniel Balagué How Linux Works? Everything in Linux is either a file or a process. A process is an executing program identified with a PID number. It runs in short or long duration
More informationWeek 2 Lecture 3. Unix
Lecture 3 Unix Terminal and Shell 2 Terminal Prompt Command Argument Result 3 Shell Intro A system program that allows a user to execute: shell functions (e.g., ls -la) other programs (e.g., eclipse) shell
More informationCSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80
CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure
More informationGetting Started With UNIX Lab Exercises
Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.
More informationUsing Linux as a Virtual Machine
Intro to UNIX Using Linux as a Virtual Machine We will use the VMware Player to run a Virtual Machine which is a way of having more than one Operating System (OS) running at once. Your Virtual OS (Linux)
More informationBashed One Too Many Times. Features of the Bash Shell St. Louis Unix Users Group Jeff Muse, Jan 14, 2009
Bashed One Too Many Times Features of the Bash Shell St. Louis Unix Users Group Jeff Muse, Jan 14, 2009 What is a Shell? The shell interprets commands and executes them It provides you with an environment
More informationEECS2301. Lab 1 Winter 2016
EECS2301 Lab 1 Winter 2016 Lab Objectives In this lab, you will be introduced to the Linux operating system. The basic commands will be presented in this lab. By the end of you alb, you will be asked to
More informationUtilities. September 8, 2015
Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow
More informationIntroduction to UNIX Command Line
Introduction to UNIX Command Line Files and directories Some useful commands (echo, cat, grep, find, diff, tar) Redirection Pipes Variables Background processes Remote connections (e.g. ssh, curl) Scripts
More informationBasic UNIX commands. HORT Lab 2 Instructor: Kranthi Varala
Basic UNIX commands HORT 59000 Lab 2 Instructor: Kranthi Varala Client/Server architecture User1 User2 User3 Server (UNIX/ Web/ Database etc..) User4 High Performance Compute (HPC) cluster User1 Compute
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings Linux Commands 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material
More informationIntroduction to the shell Part II
Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility
More informationIntroduction to Unix and Linux. Workshop 1: Directories and Files
Introduction to Unix and Linux Workshop 1: Directories and Files Genomics Core Lab TEXAS A&M UNIVERSITY CORPUS CHRISTI Anvesh Paidipala, Evan Krell, Kelly Pennoyer, Chris Bird Genomics Core Lab Informatics
More informationLecture # 2 Introduction to UNIX (Part 2)
CS390 UNIX Programming Spring 2009 Page 1 Lecture # 2 Introduction to UNIX (Part 2) UNIX is case sensitive (lowercase, lowercase, lowercase) Logging in (Terminal Method) Two basic techniques: 1. Network
More informationUsing LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12)
Using LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12) Objective: Learn some basic aspects of the UNIX operating system and how to use it. What is UNIX? UNIX is the operating system used by most computers
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationCrash Course in Unix. For more info check out the Unix man pages -orhttp://www.cs.rpi.edu/~hollingd/unix. -or- Unix in a Nutshell (an O Reilly book).
Crash Course in Unix For more info check out the Unix man pages -orhttp://www.cs.rpi.edu/~hollingd/unix -or- Unix in a Nutshell (an O Reilly book). 1 Unix Accounts To access a Unix system you need to have
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationWorking With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen
Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking
More informationWhat is the Shell. Whenever you login to a Unix system you are placed in a program called the shell. All of your work is done within the shell.
What is the Shell Whenever you login to a Unix system you are placed in a program called the shell. All of your work is done within the shell. The shell is your interface to the operating system. It acts
More informationCSE 390a Lecture 2. Exploring Shell Commands, Streams, and Redirection
1 CSE 390a Lecture 2 Exploring Shell Commands, Streams, and Redirection slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 2 Lecture summary Unix
More informationIntroduction to Linux Part 1. Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017
Introduction to Linux Part 1 Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system kp001 kp002. kpxxx FastX
More informationUnix Introduction. Part 3
Unix Introduction Part 3 More Unix Commands cat more head tail Working with files Now that you can navigate directories and move files around, you need to be able to work with the files and directories
More informationContents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...
Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationIntroduction to the Linux for HPC. Basic Linux for Beginner HPC Users
Introduction to the Linux for HPC Basic Linux for Beginner HPC Users Purpose of This Lecture Fundamentals of using Linux and Linux-like systems on HPC systems History of Linux Shell and basic commands
More informationUNIX and Linux Essentials Student Guide
UNIX and Linux Essentials Student Guide D76989GC10 Edition 1.0 June 2012 D77816 Authors Uma Sannasi Pardeep Sharma Technical Contributor and Reviewer Harald van Breederode Editors Anwesha Ray Raj Kumar
More informationRecitation #1 Boot Camp. August 30th, 2016
18-600 Recitation #1 Boot Camp August 30th, 2016 Welcome to 18-600! Purpose of recitation Useful tools, information pertaining to the labs Hands-on activities Problem solving and exam prep Last ~30 mins
More informationBasic Linux Commands. Srihari Kalgi M.Tech, CSE (KReSIT), IIT Bombay. May 5, 2009
Basic Linux Commands Srihari Kalgi M.Tech, CSE (KReSIT), IIT Bombay May 5, 2009 General Purpose utilities Linux File System File Handling Commands Compressing and Archiving Files Simple Filters General
More informationAn Introduction to Unix Power Tools
An to Unix Power Tools Randolph Langley Department of Computer Science Florida State University August 27, 2008 History of Unix Unix Today Command line versus graphical interfaces to COP 4342, Fall History
More informationA Brief Introduction to Unix
A Brief Introduction to Unix Sean Barag Drexel University March 30, 2011 Sean Barag (Drexel University) CS 265 - A Brief Introduction to Unix March 30, 2011 1 / 17 Outline 1 Directories
More informationWhen talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:
Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt
More informationLinux Essentials Objectives Topics:
Linux Essentials Linux Essentials is a professional development certificate program that covers basic knowledge for those working and studying Open Source and various distributions of Linux. Exam Objectives
More informationCS Fundamentals of Programming II Fall Very Basic UNIX
CS 215 - Fundamentals of Programming II Fall 2012 - Very Basic UNIX This handout very briefly describes how to use Unix and how to use the Linux server and client machines in the CS (Project) Lab (KC-265)
More information*nix Crash Course. Presented by: Virginia Tech Linux / Unix Users Group VTLUUG
*nix Crash Course Presented by: Virginia Tech Linux / Unix Users Group VTLUUG Ubuntu LiveCD No information on your hard-drive will be modified. Gives you a working Linux system without having to install
More informationM2PGER FORTRAN programming. General introduction. Virginie DURAND and Jean VIRIEUX 10/13/2013 M2PGER - ALGORITHME SCIENTIFIQUE
M2PGER 2013-2014 FORTRAN programming General introduction Virginie DURAND and Jean VIRIEUX 1 Why learning programming??? 2 Why learning programming??? ACQUISITION numerical Recording on magnetic supports
More information