Fast(er) Exact Decoding and Global Training for Transition-Based Dependency Parsing via a Minimal Feature Set
|
|
- Arron Davis
- 5 years ago
- Views:
Transcription
1 Fast(er) Exact Decoding and Global Training for Transition-Based Dependency Parsing via a Minimal Feature Set Tianze Shi* Liang Huang Lillian Lee* * Cornell University Oregon State University O n 3 O n 3 Minimal O n 6 Theoretical Feature Set Practical
2 Short Version Transition-based dependency parsing has an exponentially-large search space O n 3 exact solutions exist In practice, however, we needed rich features O n 6 (This work) with bi-lstms, now we can do O(n 3 )! And we get state-of-the-art results 2
3 Short Version Transition-based dependency parsing has an exponentially-large search space O n 3 exact solutions exist In practice, however, we needed rich features O n 6 (This work) with bi-lstms, now we can do O(n 3 )! And we get state-of-the-art results 3
4 Short Version Transition-based dependency parsing has an exponentially-large search space O n 3 exact solutions exist In practice, however, we needed rich features O n 6 (This work) with bi-lstms, now we can do O(n 3 )! And we get state-of-the-art results 4
5 Short Version Transition-based dependency parsing has an exponentially-large search space O n 3 exact solutions exist In practice, however, we needed rich features O n 6 (This work) with bi-lstms, now we can do O(n 3 )! And we get state-of-the-art results 5
6 Short Version Transition-based dependency parsing has an exponentially-large search space O n 3 exact solutions exist In practice, however, we needed rich features O n 6 (This work) with bi-lstms, now we can do O(n 3 )! And we get state-of-the-art results 6
7 Dependency Parsing root xcomp obj OUTPUT INPUT nsubj mark det She wanted to eat an apple 7
8 Transition-based Dependency Parsing Initial state Terminal states 8
9 Transition-based Dependency Parsing Goal: max score( ) = max score( ) Initial state Terminal states 9
10 Exact Decoding with Dynamic Programming Goal: max score( ) = max score( ) Initial state Exponential to polynomial Terminal states (Huang and Sagae, 2010; Kuhlmann, Gómez-Rodríguez and Satta, 2011) 10
11 Transition Systems DP Complexity # Action Types Arc-standard O n 4 3 Arc-eager O n 3 4 In our paper Arc-hybrid O n 3 3 Presentational convenience 11
12 Arc-hybrid Transition System State s 2 s 1 s 0 b 0 b 1 Stack Buffer Initial State ROOT She wanted Terminal State ROOT (Yamada and Matsumoto, 2003) (Gómez-Rodríguez et al., 2008) (Kuhlmann et al., 2011) 12
13 Arc-hybrid Transition System Transitions b 0 s 1 s 0 s 0 b 0 reduce reduce b 0 s 1 b 0 s 0 s 0 Same as arc-standard 13
14 Arc-hybrid Transition System Transitions b 0 s 1 s 0 s 0 b 0 reduce reduce b 0 s 1 b 0 s 0 s 0 Same as arc-standard 14
15 Arc-hybrid Transition System Transitions b 0 s 1 s 0 s 0 b 0 reduce reduce b 0 s 1 b 0 s 0 s 0 Same as arc-standard 15
16 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 16
17 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 17
18 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 18
19 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 19
20 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 20
21 Arc-hybrid Transition System Stack Buffer initial ROOT She wanted to eat an apple ROOT She wanted to eat an apple ROOT She wanted to eat an apple reduce ROOT wanted to eat an apple She ROOT wanted ROOT wanted to to eat an apple eat an apple 21
22 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 22
23 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 23
24 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 24
25 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 25
26 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 26
27 Arc-hybrid Transition System Stack Buffer ROOT wanted to eat an apple reduce ROOT wanted eat an apple reduce ROOT wanted eat ROOT wanted eat an ROOT wanted eat to an apple apple apple ROOT wanted eat apple an 27
28 Arc-hybrid Transition System Stack Buffer reduce reduce ROOT wanted eat apple ROOT wanted eat apple reduce terminal ROOT ROOT wanted eat wanted 28
29 Arc-hybrid Transition System Stack Buffer reduce reduce ROOT wanted eat apple ROOT wanted eat apple reduce terminal ROOT ROOT wanted eat wanted 29
30 Arc-hybrid Transition System Stack Buffer reduce reduce ROOT wanted eat apple ROOT wanted eat apple reduce terminal ROOT ROOT wanted eat wanted 30
31 Arc-hybrid Transition System Stack Buffer reduce reduce ROOT wanted eat apple ROOT wanted eat apple reduce terminal ROOT ROOT wanted eat wanted 31
32 Dynamic Programming for Arc-hybrid (n) ROOT She wanted to eat an apple Stack Buffer Deduction Item Goal i j 0 n + 1 [i, j] [0, n + 1] 32
33 Dynamic Programming for Arc-hybrid i j [i, j] [j, j + 1] i j j
34 Dynamic Programming for Arc-hybrid reduce i, k [k, j] [?, j] k j reduce? j k 34
35 Dynamic Programming for Arc-hybrid reduce i, k [k, j] [i, j] i k j reduce i j k 35
36 Dynamic Programming for Arc-hybrid reduce i, k [k, j] [i, j] i i * k k j reduce i j k 36
37 Dynamic Programming for Arc-hybrid In Kuhlmann, Gómez-Rodríguez and Satta (2011) s notation i * [i, k] reduce i, k [k, j] [i, j] i k * [k, j] i k j * [i, j] reduce i j k 37
38 Dynamic Programming for Arc-hybrid i * [i, k] reduce i, k [k, j] [i, j] i k * [k, j] i k j * [i, j] reduce i j k 38
39 Dynamic Programming for Arc-hybrid [i, j] [j, j + 1] Goal: [0, n + 1] reduce i, k [k, j] [i, j] k j O n 3 reduce i, k [k, j] [i, j] i k 39
40 Time Complexity in Practice Complexity depends on feature representation! Typical feature representation: Feature templates look at specific positions in the stack and in the buffer 40
41 Time Complexity in Practice Compare the following features s 0 s 0 b 0 s 1 b 0 Time complexities are different!!! i j k i j s sh i, j s sh k, i, j j j + 1 i j j
42 Time Complexity in Practice Complexity depends on feature representation! Typical feature representation: Feature templates look at specific positions in the stack and in the buffer Best-known complexity in practice: O(n 6 ) (Huang and Sagae, 2010) Stack Buffer s 2 s 1 s 0 b 0 b 1 s 1. lc s 1. rc s 0. lc s 0. rc 42
43 Best-known Time Complexities (recap) O n 3 O n 6 Theoretical Gap: Feature representation Practical 43
44 In Practice, Instead of Exact Decoding Greedy search (Nivre, 2003, 2004, 2008; Chen and Manning, 2014) Beam search (Zhang and Clark, 2011; Weiss et al.,2015) Best-first search (Sagae and Lavie, 2006; Sagae and Tsujii, 2007; Zhao et al., 2013) Dynamic oracles (Goldberg and Nivre, 2012, 2013) Global normalization on the beam (Zhou et al., 2015; Andor et al., 2016) Reinforcement learning (Lê and Fokkens, 2017) Learning to search (Daumé III and Marcu, 2005; Chang et al., 2016; Wiseman and Rush, 2016) 44
45 How Many Positional Features Do We Need? Non-neural (manual engineering) Chen and Manning (2014) Stack Buffer s 2 s 1 s 0 b 0 b 1 b 2 s 1. lc i s 1. rc i s 0. lc i s 0. rc i s 1. lc 0. lc 0 s 1. rc 0. rc 0 s 0. lc 0. lc 0 s 0. rc 0. rc 0 45
46 How Many Positional Features Do We Need? Non-neural (manual engineering) Chen and Manning (2014) Stack LSTM Dyer et al. (2015) s σ 1 Stack s 2 s 1 s 0 Bi-LSTM Kiperwasser and Goldberg (2016) Cross and Huang (2016) 46
47 How Many Positional Features Do We Need? Bi-LSTMs give compact feature representations (Kiperwasser and Goldberg, 2016; Cross and Huang, 2016) Features used in Kiperwasser and Goldberg (2016) Stack s 2 s 1 s 0 b 0 Buffer Features used in Cross and Huang (2016) Stack s 1 s 0 b 0 Buffer 47
48 How Many Positional Features Do We Need? Non-neural (manual engineering) Chen and Manning (2014) Stack LSTM Dyer et al. (2015) Bi-LSTM Kiperwasser and Goldberg (2016) Cross and Huang (2016) Summarizing trees on stack Exponential DP Enables Slow DP Enables Fast DP Summarizing input 48
49 Model Architecture s sh, s re, s re Multi-layer perceptron s 2 s 1 s 0 b 0 Bi-directional LSTM Word embeddings + POS embeddings She wanted to eat an apple 49
50 Model Architecture s sh, s re, s re Multi-layer perceptron s 1 s 0 b 0 Bi-directional LSTM Word embeddings + POS embeddings She wanted to eat an apple 50
51 Model Architecture s sh, s re, s re Multi-layer perceptron s 0 b 0 Bi-directional LSTM Word embeddings + POS embeddings She wanted to eat an apple 51
52 Model Architecture s sh, s re, s re Multi-layer perceptron b 0 Bi-directional LSTM Word embeddings + POS embeddings She wanted to eat an apple 52
53 How Many Positional Features Do We Need? We answer the question empirically experimented with greedy decoding Two positional feature vectors are enough! ± ± ± ±0.23 UAS on PTB (dev) {s 2, s 1, s 0, b 0 } {s 1, s 0, b 0 } {s 0, b 0 } {b 0 } Considered in prior work 53
54 How Many Positional Features Do We Need? Our minimal feature set Stack s 0 b 0 Buffer Counter-intuitive, but works for greedy decoding s 1 s 0 b 0 reduce s 1 b 0 s 0 54
55 How Many Positional Features Do We Need? Our minimal feature set Stack s 0 b 0 Buffer Counter-intuitive, but works for greedy decoding The bare deduction items already contain enough information to extract features for DP Leads to the first O n 3 implementation of global decoders! 55
56 How Many Positional Features Do We Need? Non-neural (manual engineering) Chen and Manning (2014) Stack LSTM Dyer et al. (2015) Summarizing trees on stack Exponential DP Enables Slow DP Bi-LSTM Kiperwasser and Goldberg (2016) Cross and Huang (2016) Enables Fast DP Our work Summarizing input Fast(er) DP 56
57 Best-known Time Complexities (recap) O n 3 O n 6 Theoretical Gap: Feature representation Practical 57
58 Our contribution Minimal Feature Set O n 3 O n 3 O n 6 Theoretical Practical 58
59 Decoding i Score of the sub-sequence * [i, j] i, j : v j, j + 1 : 0 i j i j j
60 Decoding i * [i, k] i k reduce i, k : v 1 k, j : v 2 i, j : v 1 + v 2 + Δ Δ = s sh i, k + s re k, j * [k, j] * [i, j] i k j reduce i j k 60
61 Training Separate incorrect from correct by a margin max score( ) - score( ) + cost( ) Cost-augmented decoding (Taskar et al., 2005) reduce i, k : v 1 k, j : v 2 i, j : v 1 + v 2 + s sh i, k + s re k, j + 1 head k j i j k 61
62 Chinese CTB UAS Comparing with State-of-the-art BGDS16 DBLMS15 KG16b KG16a CH16 KG16a KBKDS16 CFHGD16 WC16 DM English PTB UAS Local Global 62
63 Chinese CTB UAS Comparing with State-of-the-art BGDS16 DBLMS15 KG16b KG16a CH16 KG16a KBKDS16 CFHGD16 WC16 DM English PTB UAS Our arc-eager DP Our arc-hybrid DP Local Global Our Global 63
64 Chinese CTB UAS Comparing with State-of-the-art Our best local BGDS16 DBLMS15 KG16b KG16a CH16 KG16a KBKDS16 CFHGD16 WC16 DM English PTB UAS Our arc-eager DP Our arc-hybrid DP Local Global Our Local Our Global 64
65 Chinese CTB UAS Comparing with State-of-the-art Our best local BGDS16 DBLMS15 KG16b KG16a CH16 KG16a KBKDS16 CFHGD16 WC16 20 KBKDS16 DM English PTB UAS Our arc-eager DP Our arc-hybrid DP 15 Our all global 5 Our arc-eager DP 5 Our arc-hybrid DP Local Global Our Local Our Global Ensemble 65
66 Results CoNLL 17 Shared Task Macro-average of 81 treebanks in 49 languages 2 nd highest overall performance LAS Ensemble Exact Arc-eager Exact Arc-hybrid Graphbased (Shi, Wu, Chen and Cheng, 2017; Zeman et al., 2017) 66
67 Conclusion Bi-LSTM feature set is minimal yet highly effective First O n 3 implementation of exact decoders Global training and decoding gave high performance 67
68 More in Our Paper Description and analysis of three transition systems (arc-standard, arc-hybrid, arc-eager) CKY-style representations of the deduction systems = + Theoretical analysis of the global methods Arc-eager models can simulate arc-hybrid models Arc-eager models can simulate edge-factored models 68
69 Fast(er) Exact Decoding and Global Training for Transition-Based Dependency Parsing via a Minimal Feature Set Tianze Shi* Liang Huang Lillian Lee* * Cornell University Oregon State University
70 CKY-style Visualization 70
71 CKY-style Visualization 71
72 Results with Arc-eager and Arc-standard 72
73 Results with Arc-eager and Arc-standard 73
Transition-Based Dependency Parsing with Stack Long Short-Term Memory
Transition-Based Dependency Parsing with Stack Long Short-Term Memory Chris Dyer, Miguel Ballesteros, Wang Ling, Austin Matthews, Noah A. Smith Association for Computational Linguistics (ACL), 2015 Presented
More informationDependency Parsing 2 CMSC 723 / LING 723 / INST 725. Marine Carpuat. Fig credits: Joakim Nivre, Dan Jurafsky & James Martin
Dependency Parsing 2 CMSC 723 / LING 723 / INST 725 Marine Carpuat Fig credits: Joakim Nivre, Dan Jurafsky & James Martin Dependency Parsing Formalizing dependency trees Transition-based dependency parsing
More informationTransition-based Parsing with Neural Nets
CS11-747 Neural Networks for NLP Transition-based Parsing with Neural Nets Graham Neubig Site https://phontron.com/class/nn4nlp2017/ Two Types of Linguistic Structure Dependency: focus on relations between
More informationCS395T Project 2: Shift-Reduce Parsing
CS395T Project 2: Shift-Reduce Parsing Due date: Tuesday, October 17 at 9:30am In this project you ll implement a shift-reduce parser. First you ll implement a greedy model, then you ll extend that model
More informationTransition-based Dependency Parsing with Rich Non-local Features
Transition-based Dependency Parsing with Rich Non-local Features Yue Zhang University of Cambridge Computer Laboratory yue.zhang@cl.cam.ac.uk Joakim Nivre Uppsala University Department of Linguistics and
More informationBidirectional Transition-Based Dependency Parsing
Bidirectional Transition-Based Dependency Parsing Yunzhe Yuan, Yong Jiang, Kewei Tu School of Information Science and Technology ShanghaiTech University {yuanyzh,jiangyong,tukw}@shanghaitech.edu.cn Abstract
More informationEasy-First POS Tagging and Dependency Parsing with Beam Search
Easy-First POS Tagging and Dependency Parsing with Beam Search Ji Ma JingboZhu Tong Xiao Nan Yang Natrual Language Processing Lab., Northeastern University, Shenyang, China MOE-MS Key Lab of MCC, University
More informationTransition-Based Dependency Parsing with MaltParser
Transition-Based Dependency Parsing with MaltParser Joakim Nivre Uppsala University and Växjö University Transition-Based Dependency Parsing 1(13) Introduction Outline Goals of the workshop Transition-based
More informationNon-Projective Dependency Parsing with Non-Local Transitions
Non-Projective Dependency Parsing with Non-Local Transitions Daniel Fernández-González and Carlos Gómez-Rodríguez Universidade da Coruña FASTPARSE Lab, LyS Research Group, Departamento de Computación Campus
More informationDependency Parsing CMSC 723 / LING 723 / INST 725. Marine Carpuat. Fig credits: Joakim Nivre, Dan Jurafsky & James Martin
Dependency Parsing CMSC 723 / LING 723 / INST 725 Marine Carpuat Fig credits: Joakim Nivre, Dan Jurafsky & James Martin Dependency Parsing Formalizing dependency trees Transition-based dependency parsing
More informationParsing with Dynamic Programming
CS11-747 Neural Networks for NLP Parsing with Dynamic Programming Graham Neubig Site https://phontron.com/class/nn4nlp2017/ Two Types of Linguistic Structure Dependency: focus on relations between words
More informationLet s get parsing! Each component processes the Doc object, then passes it on. doc.is_parsed attribute checks whether a Doc object has been parsed
Let s get parsing! SpaCy default model includes tagger, parser and entity recognizer nlp = spacy.load('en ) tells spacy to use "en" with ["tagger", "parser", "ner"] Each component processes the Doc object,
More informationBasic Parsing with Context-Free Grammars. Some slides adapted from Karl Stratos and from Chris Manning
Basic Parsing with Context-Free Grammars Some slides adapted from Karl Stratos and from Chris Manning 1 Announcements HW 2 out Midterm on 10/19 (see website). Sample ques>ons will be provided. Sign up
More informationarxiv: v1 [cs.cl] 25 Apr 2017
Joint POS Tagging and Dependency Parsing with Transition-based Neural Networks Liner Yang 1, Meishan Zhang 2, Yang Liu 1, Nan Yu 2, Maosong Sun 1, Guohong Fu 2 1 State Key Laboratory of Intelligent Technology
More informationGeneralized Higher-Order Dependency Parsing with Cube Pruning
Generalized Higher-Order Dependency Parsing with Cube Pruning Hao Zhang Ryan McDonald Google, Inc. {haozhang,ryanmcd}@google.com Abstract State-of-the-art graph-based parsers use features over higher-order
More informationStack- propaga+on: Improved Representa+on Learning for Syntax
Stack- propaga+on: Improved Representa+on Learning for Syntax Yuan Zhang, David Weiss MIT, Google 1 Transi+on- based Neural Network Parser p(action configuration) So1max Hidden Embedding words labels POS
More informationIncremental Integer Linear Programming for Non-projective Dependency Parsing
Incremental Integer Linear Programming for Non-projective Dependency Parsing Sebastian Riedel James Clarke ICCS, University of Edinburgh 22. July 2006 EMNLP 2006 S. Riedel, J. Clarke (ICCS, Edinburgh)
More informationA Transition-Based Dependency Parser Using a Dynamic Parsing Strategy
A Transition-Based Dependency Parser Using a Dynamic Parsing Strategy Francesco Sartorio Department of Information Engineering University of Padua, Italy sartorio@dei.unipd.it Giorgio Satta Department
More informationTransition-based dependency parsing
Transition-based dependency parsing Syntactic analysis (5LN455) 2014-12-18 Sara Stymne Department of Linguistics and Philology Based on slides from Marco Kuhlmann Overview Arc-factored dependency parsing
More informationIntroduction to Data-Driven Dependency Parsing
Introduction to Data-Driven Dependency Parsing Introductory Course, ESSLLI 2007 Ryan McDonald 1 Joakim Nivre 2 1 Google Inc., New York, USA E-mail: ryanmcd@google.com 2 Uppsala University and Växjö University,
More informationOptimal Incremental Parsing via Best-First Dynamic Programming
Optimal Incremental Parsing via Best-First Dynamic Programming Kai Zhao 1 James Cross 1 1 Graduate Center City University of New York 365 Fifth Avenue, New York, NY 10016 {kzhao,jcross}@gc.cuny.edu Liang
More informationUndirected Dependency Parsing
Computational Intelligence, Volume 59, Number 000, 2010 Undirected Dependency Parsing CARLOS GÓMEZ-RODRÍGUEZ cgomezr@udc.es Depto. de Computación, Universidade da Coruña. Facultad de Informática, Campus
More informationDynamic Feature Selection for Dependency Parsing
Dynamic Feature Selection for Dependency Parsing He He, Hal Daumé III and Jason Eisner EMNLP 2013, Seattle Structured Prediction in NLP Part-of-Speech Tagging Parsing N N V Det N Fruit flies like a banana
More informationarxiv: v2 [cs.cl] 24 Mar 2015
Yara Parser: A Fast and Accurate Dependency Parser Mohammad Sadegh Rasooli 1 and Joel Tetreault 2 1 Department of Computer Science, Columbia University, New York, NY, rasooli@cs.columbia.edu 2 Yahoo Labs,
More informationSupplementary A. Built-in transition systems
L. Aufrant, G. Wisniewski PanParser (Supplementary) Supplementary A. Built-in transition systems In the following, we document all transition systems built in PanParser, along with their cost. s and s
More informationHC-search for Incremental Parsing
HC-search for Incremental Parsing Yijia Liu, Wanxiang Che, Bing Qin, Ting Liu Research Center for Social Computing and Information Retrieval Harbin Institute of Technology, China {yjliu,car,qinb,tliu}@ir.hit.edu.cn
More informationCombining Discrete and Continuous Features for Deterministic Transition-based Dependency Parsing
Combining Discrete and Continuous Features for Deterministic Transition-based Dependency Parsing Meishan Zhang and Yue Zhang Singapore University of Technology and Design {meishan zhang yue zhang}@sutd.edu.sg
More informationAccurate Parsing and Beyond. Yoav Goldberg Bar Ilan University
Accurate Parsing and Beyond Yoav Goldberg Bar Ilan University Syntactic Parsing subj root rcmod rel xcomp det subj aux acomp acomp The soup, which I expected to be good, was bad subj root rcmod rel xcomp
More informationOnline Graph Planarisation for Synchronous Parsing of Semantic and Syntactic Dependencies
Online Graph Planarisation for Synchronous Parsing of Semantic and Syntactic Dependencies Ivan Titov University of Illinois at Urbana-Champaign James Henderson, Paola Merlo, Gabriele Musillo University
More informationCollins and Eisner s algorithms
Collins and Eisner s algorithms Syntactic analysis (5LN455) 2015-12-14 Sara Stymne Department of Linguistics and Philology Based on slides from Marco Kuhlmann Recap: Dependency trees dobj subj det pmod
More informationEasy-First Chinese POS Tagging and Dependency Parsing
Easy-First Chinese POS Tagging and Dependency Parsing ABSTRACT Ji Ma, Tong Xiao, Jingbo Zhu, Feiliang Ren Natural Language Processing Laboratory Northeastern University, China majineu@outlook.com, zhujingbo@mail.neu.edu.cn,
More informationTransition-Based Parsing of the Chinese Treebank using a Global Discriminative Model
Transition-Based Parsing of the Chinese Treebank using a Global Discriminative Model Yue Zhang Oxford University Computing Laboratory yue.zhang@comlab.ox.ac.uk Stephen Clark Cambridge University Computer
More informationDynamic Programming Algorithms for Transition-Based Dependency Parsers
Dynamic Programming Algorithms for Transition-Based Dependency Parsers Marco Kuhlmann Dept. of Linguistics and Philology Uppsala University, Sweden marco.kuhlmann@lingfil.uu.se Carlos Gómez-Rodríguez Departamento
More informationAdvanced Search Algorithms
CS11-747 Neural Networks for NLP Advanced Search Algorithms Daniel Clothiaux https://phontron.com/class/nn4nlp2017/ Why search? So far, decoding has mostly been greedy Chose the most likely output from
More informationStructured Perceptron with Inexact Search
Structured Perceptron with Inexact Search Liang Huang Suphan Fayong Yang Guo presented by Allan July 15, 2016 Slides: http://www.statnlp.org/sperceptron.html Table of Contents Structured Perceptron Exact
More informationHybrid Combination of Constituency and Dependency Trees into an Ensemble Dependency Parser
Hybrid Combination of Constituency and Dependency Trees into an Ensemble Dependency Parser Nathan David Green and Zdeněk Žabokrtský Charles University in Prague Institute of Formal and Applied Linguistics
More informationTekniker för storskalig parsning: Dependensparsning 2
Tekniker för storskalig parsning: Dependensparsning 2 Joakim Nivre Uppsala Universitet Institutionen för lingvistik och filologi joakim.nivre@lingfil.uu.se Dependensparsning 2 1(45) Data-Driven Dependency
More informationNon-Projective Dependency Parsing in Expected Linear Time
Non-Projective Dependency Parsing in Expected Linear Time Joakim Nivre Uppsala University, Department of Linguistics and Philology, SE-75126 Uppsala Växjö University, School of Mathematics and Systems
More informationGraph-Based Parsing. Miguel Ballesteros. Algorithms for NLP Course. 7-11
Graph-Based Parsing Miguel Ballesteros Algorithms for NLP Course. 7-11 By using some Joakim Nivre's materials from Uppsala University and Jason Eisner's material from Johns Hopkins University. Outline
More informationUtilizing Dependency Language Models for Graph-based Dependency Parsing Models
Utilizing Dependency Language Models for Graph-based Dependency Parsing Models Wenliang Chen, Min Zhang, and Haizhou Li Human Language Technology, Institute for Infocomm Research, Singapore {wechen, mzhang,
More informationCS224n: Natural Language Processing with Deep Learning 1 Lecture Notes: Part IV Dependency Parsing 2 Winter 2019
CS224n: Natural Language Processing with Deep Learning 1 Lecture Notes: Part IV Dependency Parsing 2 Winter 2019 1 Course Instructors: Christopher Manning, Richard Socher 2 Authors: Lisa Wang, Juhi Naik,
More informationStatistical Dependency Parsing
Statistical Dependency Parsing The State of the Art Joakim Nivre Uppsala University Department of Linguistics and Philology joakim.nivre@lingfil.uu.se Statistical Dependency Parsing 1(29) Introduction
More informationK-best Parsing Algorithms
K-best Parsing Algorithms Liang Huang University of Pennsylvania joint work with David Chiang (USC Information Sciences Institute) k-best Parsing Liang Huang (Penn) k-best parsing 2 k-best Parsing I saw
More informationDensity-Driven Cross-Lingual Transfer of Dependency Parsers
Density-Driven Cross-Lingual Transfer of Dependency Parsers Mohammad Sadegh Rasooli Michael Collins rasooli@cs.columbia.edu Presented by Owen Rambow EMNLP 2015 Motivation Availability of treebanks Accurate
More informationTransition-based Dependency Parsing Using Two Heterogeneous Gated Recursive Neural Networks
Transition-based Dependency Parsing Using Two Heterogeneous Gated Recursive Neural Networks Xinchi Chen, Yaqian Zhou, Chenxi Zhu, Xipeng Qiu, Xuanjing Huang Shanghai Key Laboratory of Intelligent Information
More informationDependency grammar and dependency parsing
Dependency grammar and dependency parsing Syntactic analysis (5LN455) 2015-12-09 Sara Stymne Department of Linguistics and Philology Based on slides from Marco Kuhlmann Activities - dependency parsing
More informationDependency grammar and dependency parsing
Dependency grammar and dependency parsing Syntactic analysis (5LN455) 2016-12-05 Sara Stymne Department of Linguistics and Philology Based on slides from Marco Kuhlmann Activities - dependency parsing
More informationLinearFold GCGGGAAUAGCUCAGUUGGUAGAGCACGACCUUGCCAAGGUCGGGGUCGCGAGUUCGAGUCUCGUUUCCCGCUCCA. Liang Huang. Oregon State University & Baidu Research
LinearFold Linear-Time Prediction of RN Secondary Structures Liang Huang Oregon State niversity & Baidu Research Joint work with Dezhong Deng Oregon State / Baidu and Kai Zhao Oregon State / oogle and
More informationIncremental Joint POS Tagging and Dependency Parsing in Chinese
Incremental Joint POS Tagging and Dependency Parsing in Chinese Jun Hatori 1 Takuya Matsuzaki 1 Yusuke Miyao 3 Jun ichi Tsujii 4 1 University of Tokyo / 7-3-1 Hongo, Bunkyo, Tokyo, Japan 2 National Institute
More informationDependency Parsing domain adaptation using transductive SVM
Dependency Parsing domain adaptation using transductive SVM Antonio Valerio Miceli-Barone University of Pisa, Italy / Largo B. Pontecorvo, 3, Pisa, Italy miceli@di.unipi.it Giuseppe Attardi University
More informationLearning Latent Linguistic Structure to Optimize End Tasks. David A. Smith with Jason Naradowsky and Xiaoye Tiger Wu
Learning Latent Linguistic Structure to Optimize End Tasks David A. Smith with Jason Naradowsky and Xiaoye Tiger Wu 12 October 2012 Learning Latent Linguistic Structure to Optimize End Tasks David A. Smith
More informationOptimal Shift-Reduce Constituent Parsing with Structured Perceptron
Optimal Shift-Reduce Constituent Parsing with Structured Perceptron Le Quang Thang Hanoi University of Science and Technology {lelightwin@gmail.com} Hiroshi Noji and Yusuke Miyao National Institute of
More informationDRAGNN: A TRANSITION-BASED FRAMEWORK FOR DYNAMICALLY CONNECTED NEURAL NETWORKS
DRAGNN: A TRANSITION-BASED FRAMEWORK FOR DYNAMICALLY CONNECTED NEURAL NETWORKS Lingpeng Kong Carnegie Mellon University Pittsburgh, PA lingpenk@cs.cmu.edu Chris Alberti Daniel Andor Ivan Bogatyy David
More informationImproving Transition-Based Dependency Parsing with Buffer Transitions
Improving Transition-Based Dependency Parsing with Buffer Transitions Daniel Fernández-González Departamento de Informática Universidade de Vigo Campus As Lagoas, 32004 Ourense, Spain danifg@uvigo.es Carlos
More informationSpanning Tree Methods for Discriminative Training of Dependency Parsers
University of Pennsylvania ScholarlyCommons Technical Reports (CIS) Department of Computer & Information Science January 2006 Spanning Tree Methods for Discriminative Training of Dependency Parsers Ryan
More informationAutomatic Discovery of Feature Sets for Dependency Parsing
Automatic Discovery of Feature Sets for Dependency Parsing Peter Nilsson Pierre Nugues Department of Computer Science Lund University peter.nilsson.lund@telia.com Pierre.Nugues@cs.lth.se Abstract This
More informationDependency grammar and dependency parsing
Dependency grammar and dependency parsing Syntactic analysis (5LN455) 2014-12-10 Sara Stymne Department of Linguistics and Philology Based on slides from Marco Kuhlmann Mid-course evaluation Mostly positive
More informationEncoder-Decoder Shift-Reduce Syntactic Parsing
Encoder-Decoder Shift-Reduce Syntactic Parsing Jiangming Liu and Yue Zhang Singapore University of Technology and Design, 8 Somapah Road, Singapore, 487372 {jiangming liu, yue zhang}@sutd.edu.sg encoder
More informationIn-Order Transition-based Constituent Parsing
In-Order Transition-based Constituent Parsing Jiangming Liu and Yue Zhang Singapore University of Technology and Design, 8 Somapah Road, Singapore, 487372 jmliunlp@gmail.com, yue zhang@sutd.edu.sg Abstract
More informationProbabilistic Structured-Output Perceptron: An Effective Probabilistic Method for Structured NLP Tasks
Probabilistic Structured-Output Perceptron: An Effective Probabilistic Method for Structured NLP Tasks Xu Sun MOE Key Laboratory of Computational Linguistics, Peking University Abstract Many structured
More informationSpan-Based Constituency Parsing with a Structure-Label System and Provably Optimal Dynamic Oracles
Span-Based Constituency Parsing with a Structure-Label System and Provably Optimal Dynamic Oracles James Cross and Liang Huang School of EECS, Oregon State University, Corvallis, OR, USA {james.henry.cross.iii,
More informationOn Structured Perceptron with Inexact Search, NAACL 2012
On Structured Perceptron with Inexact Search, NAACL 2012 John Hewitt CIS 700-006 : Structured Prediction for NLP 2017-09-23 All graphs from Huang, Fayong, and Guo (2012) unless otherwise specified. All
More informationAT&T: The Tag&Parse Approach to Semantic Parsing of Robot Spatial Commands
AT&T: The Tag&Parse Approach to Semantic Parsing of Robot Spatial Commands Svetlana Stoyanchev, Hyuckchul Jung, John Chen, Srinivas Bangalore AT&T Labs Research 1 AT&T Way Bedminster NJ 07921 {sveta,hjung,jchen,srini}@research.att.com
More informationarxiv: v1 [cs.cl] 13 Mar 2017
DRAGNN: A Transition-based Framework for Dynamically Connected Neural Networks Lingpeng Kong Chris Alberti Daniel Andor Ivan Bogatyy David Weiss lingpengk@cs.cmu.edu, {chrisalberti,danielandor,bogatyy,djweiss}@google.com
More informationProbabilistic Graph-based Dependency Parsing with Convolutional Neural Network
Probabilistic Graph-based Dependency Parsing with Convolutional Neural Network Zhisong Zhang 1,2, Hai Zhao 1,2,, Lianhui Qin 1,2 1 Department of Computer Science and Engineering, Shanghai Jiao Tong University,
More informationA Quick Guide to MaltParser Optimization
A Quick Guide to MaltParser Optimization Joakim Nivre Johan Hall 1 Introduction MaltParser is a system for data-driven dependency parsing, which can be used to induce a parsing model from treebank data
More informationAdvanced PCFG Parsing
Advanced PCFG Parsing Computational Linguistics Alexander Koller 8 December 2017 Today Parsing schemata and agenda-based parsing. Semiring parsing. Pruning techniques for chart parsing. The CKY Algorithm
More informationA Dependency Parser for Tweets. Lingpeng Kong, Nathan Schneider, Swabha Swayamdipta, Archna Bhatia, Chris Dyer, and Noah A. Smith
A Dependency Parser for Tweets Lingpeng Kong, Nathan Schneider, Swabha Swayamdipta, Archna Bhatia, Chris Dyer, and Noah A. Smith NLP for Social Media Boom! Ya ur website suxx bro @SarahKSilverman michelle
More informationTurning on the Turbo: Fast Third-Order Non- Projective Turbo Parsers
Carnegie Mellon University Research Showcase @ CMU Language Technologies Institute School of Computer Science 8-2013 Turning on the Turbo: Fast Third-Order Non- Projective Turbo Parsers Andre F.T. Martins
More informationBidirectional LTAG Dependency Parsing
Bidirectional LTAG Dependency Parsing Libin Shen BBN Technologies Aravind K. Joshi University of Pennsylvania We propose a novel algorithm for bi-directional parsing with linear computational complexity,
More informationOnline Learning of Approximate Dependency Parsing Algorithms
Online Learning of Approximate Dependency Parsing Algorithms Ryan McDonald Fernando Pereira Department of Computer and Information Science University of Pennsylvania Philadelphia, PA 19104 {ryantm,pereira}@cis.upenn.edu
More informationEDAN20 Language Technology Chapter 13: Dependency Parsing
EDAN20 Language Technology http://cs.lth.se/edan20/ Pierre Nugues Lund University Pierre.Nugues@cs.lth.se http://cs.lth.se/pierre_nugues/ September 19, 2016 Pierre Nugues EDAN20 Language Technology http://cs.lth.se/edan20/
More informationForest-Based Search Algorithms
Forest-Based Search Algorithms for Parsing and Machine Translation Liang Huang University of Pennsylvania Google Research, March 14th, 2008 Search in NLP is not trivial! I saw her duck. Aravind Joshi 2
More informationAn Empirical Study of Semi-supervised Structured Conditional Models for Dependency Parsing
An Empirical Study of Semi-supervised Structured Conditional Models for Dependency Parsing Jun Suzuki, Hideki Isozaki NTT CS Lab., NTT Corp. Kyoto, 619-0237, Japan jun@cslab.kecl.ntt.co.jp isozaki@cslab.kecl.ntt.co.jp
More informationSeq2SQL: Generating Structured Queries from Natural Language Using Reinforcement Learning
Seq2SQL: Generating Structured Queries from Natural Language Using Reinforcement Learning V. Zhong, C. Xiong, R. Socher Salesforce Research arxiv: 1709.00103 Reviewed by : Bill Zhang University of Virginia
More informationNatural Language Processing with Deep Learning CS224N/Ling284
Natural Language Processing with Deep Learning CS224N/Ling284 Lecture 8: Recurrent Neural Networks Christopher Manning and Richard Socher Organization Extra project office hour today after lecture Overview
More informationContext Encoding LSTM CS224N Course Project
Context Encoding LSTM CS224N Course Project Abhinav Rastogi arastogi@stanford.edu Supervised by - Samuel R. Bowman December 7, 2015 Abstract This project uses ideas from greedy transition based parsing
More informationFully Delexicalized Contexts for Syntax-Based Word Embeddings
Fully Delexicalized Contexts for Syntax-Based Word Embeddings Jenna Kanerva¹, Sampo Pyysalo² and Filip Ginter¹ ¹Dept of IT - University of Turku, Finland ²Lang. Tech. Lab - University of Cambridge turkunlp.github.io
More informationAssignment 4 CSE 517: Natural Language Processing
Assignment 4 CSE 517: Natural Language Processing University of Washington Winter 2016 Due: March 2, 2016, 1:30 pm 1 HMMs and PCFGs Here s the definition of a PCFG given in class on 2/17: A finite set
More informationSupport Vector Machine Learning for Interdependent and Structured Output Spaces
Support Vector Machine Learning for Interdependent and Structured Output Spaces I. Tsochantaridis, T. Hofmann, T. Joachims, and Y. Altun, ICML, 2004. And also I. Tsochantaridis, T. Joachims, T. Hofmann,
More informationan incremental algorithm for transition-based ccg parsing
an incremental algorithm for transition-based ccg parsing B. R. Ambati, T. Deoskar, M. Johnson and M. Steedman Miyazawa Akira January 22, 2016 The Graduate University For Advanced Studies / National Institute
More informationSemantic Dependency Graph Parsing Using Tree Approximations
Semantic Dependency Graph Parsing Using Tree Approximations Željko Agić Alexander Koller Stephan Oepen Center for Language Technology, University of Copenhagen Department of Linguistics, University of
More informationAgenda for today. Homework questions, issues? Non-projective dependencies Spanning tree algorithm for non-projective parsing
Agenda for today Homework questions, issues? Non-projective dependencies Spanning tree algorithm for non-projective parsing 1 Projective vs non-projective dependencies If we extract dependencies from trees,
More informationDynamic Programming for Higher Order Parsing of Gap-Minding Trees
Dynamic Programming for Higher Order Parsing of Gap-Minding Trees Emily Pitler, Sampath Kannan, Mitchell Marcus Computer and Information Science University of Pennsylvania Philadelphia, PA 19104 epitler,kannan,mitch@seas.upenn.edu
More informationHomework 2: Parsing and Machine Learning
Homework 2: Parsing and Machine Learning COMS W4705_001: Natural Language Processing Prof. Kathleen McKeown, Fall 2017 Due: Saturday, October 14th, 2017, 2:00 PM This assignment will consist of tasks in
More informationsplitsvm: Fast, Space-Efficient, non-heuristic, Polynomial Kernel Computation for NLP Applications
splitsvm: Fast, Space-Efficient, non-heuristic, Polynomial Kernel Computation for NLP Applications Yoav Goldberg Michael Elhadad ACL 2008, Columbus, Ohio Introduction Support Vector Machines SVMs are supervised
More informationClinical Named Entity Recognition Method Based on CRF
Clinical Named Entity Recognition Method Based on CRF Yanxu Chen 1, Gang Zhang 1, Haizhou Fang 1, Bin He, and Yi Guan Research Center of Language Technology Harbin Institute of Technology, Harbin, China
More informationDependency Parsing with Undirected Graphs
Dependency Parsing with Undirected Graphs Carlos Gómez-Rodríguez Departamento de Computación Universidade da Coruña Campus de Elviña, 15071 A Coruña, Spain carlos.gomez@udc.es Daniel Fernández-González
More informationDiscriminative Classifiers for Deterministic Dependency Parsing
Discriminative Classifiers for Deterministic Dependency Parsing Johan Hall Växjö University jni@msi.vxu.se Joakim Nivre Växjö University and Uppsala University nivre@msi.vxu.se Jens Nilsson Växjö University
More informationNeural Transition Based Parsing of Web Queries: An Entity Based Approach
Neural Transition Based Parsing of Web Queries: An Entity Based Approach Rivka Malca and Roi Reichart Technion, Israel Institute of Technology srikim@st.technion.ac.il, roiri@technion.ac.il Abstract Web
More informationApproximate Dynamic Oracle for Dependency Parsing with Reinforcement Learning
Approximate Dynamic Oracle for Dependency Parsing with Reinforcement Learning Xiang Yu, Ngoc Thang Vu, and Jonas Kuhn Institut für Maschinelle Sprachverarbeitung Universität Stuttgart {xiangyu,thangvu,jonas}@ims.uni-stuttgart.de
More informationDependency Parsing. Allan Jie. February 20, Slides: Allan Jie Dependency Parsing February 20, / 16
Dependency Parsing Allan Jie February 20, 2016 Slides: http://www.statnlp.org/dp.html Allan Jie Dependency Parsing February 20, 2016 1 / 16 Table of Contents 1 Dependency Labeled/Unlabeled Dependency Projective/Non-projective
More informationPredicting Structure in Handwritten Algebra Data From Low Level Features
Predicting Structure in Handwritten Algebra Data From Low Level Features James A. Duyck Machine Learning Department Carnegie Mellon University Pittsburgh, PA 15213, USA jduyck@andrew.cmu.edu Geoffrey J.
More informationA Continuous Relaxation of Beam Search for End-to-end Training of Neural Sequence Models
A Continuous Relaxation of Beam Search for End-to-end Training of Neural Sequence Models Kartik Goyal Carnegie Mellon University kartikgo@cs.cmu.edu Graham Neubig Carnegie Mellon University gneubig@cs.cmu.edu
More informationNon-projective Dependency Parsing using Spanning Tree Algorithms
Non-projective Dependency Parsing using Spanning Tree Algorithms Ryan McDonald Fernando Pereira Department of Computer and Information Science University of Pennsylvania {ryantm,pereira}@cis.upenn.edu
More informationTransition-Based Dependency Parsing with Stack Long Short-Term Memory
Transition-Based Dependency Parsing with Stack Long Short-Term Memory Chris Dyer Miguel Ballesteros Wang Ling Austin Matthews Noah A. Smith Marianas Labs NLP Group, Pompeu Fabra University Carnegie Mellon
More informationDiscriminative Training with Perceptron Algorithm for POS Tagging Task
Discriminative Training with Perceptron Algorithm for POS Tagging Task Mahsa Yarmohammadi Center for Spoken Language Understanding Oregon Health & Science University Portland, Oregon yarmoham@ohsu.edu
More informationApproximate Large Margin Methods for Structured Prediction
: Approximate Large Margin Methods for Structured Prediction Hal Daumé III and Daniel Marcu Information Sciences Institute University of Southern California {hdaume,marcu}@isi.edu Slide 1 Structured Prediction
More informationA Transition-based Algorithm for AMR Parsing
A Transition-based Algorithm for AMR Parsing Chuan Wang Brandeis University cwang24@brandeis.edu Nianwen Xue Brandeis University xuen@brandeis.edu Sameer Pradhan Harvard Medical School Sameer.Pradhan@
More informationDiscriminative Training for Phrase-Based Machine Translation
Discriminative Training for Phrase-Based Machine Translation Abhishek Arun 19 April 2007 Overview 1 Evolution from generative to discriminative models Discriminative training Model Learning schemes Featured
More information