CSE 111 Bio: Program Design I Lecture 3: Python Basics & More Bio

Transcription

1 Theresa CSE 111 Bio: Program Design I Lecture 3: Python Basics & More Bio Robert Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago August 31, 2017

2 DNA sequencing Getting from here: To here:

3 Why sequence DNA? 3

4 This is a physical map of the human X chromosome. (credit: modification of work by NCBI, NIH) Figure 10.11

5 Figure Much basic research is done with model organisms, such as the mouse, Mus musculus; the fruit fly, Drosophila melanogaster; the nematode Caenorhabditis elegans; the yeast Saccharomyces cerevisiae; and the common weed, Arabidopsis thaliana. (credit mouse : modification of work by Florean Fortescue; credit nematodes : modification of work by snickclunk /Flickr; credit common weed : modification of work by Peggy Greb, USDA; scale-bar data from Matt Russell)

6 The bonds between each pair of DNA bases are A. Strong (covalent) bonds that keeps the two strands permanently attached B. Weak (hydrogen) bonds that allow the two strands to be separated C. Ionic bonds that allow a transfer of current along the molecule D. I don t know

7

8 DNA Sequencing: Sanger Method In Frederick Sanger's dideoxy chain termination method, dye-labeled dideoxynucleotides are used to generate DNA fragments that terminate at different points. The DNA is separated by capillary electrophoresis on the basis of size, and from the order of fragments formed, the DNA sequence can be read. The DNA sequence readout is shown on anelectropherogram that is generated by a laser scanner.

9

10

11

12 Metagenomics involves isolating and sequencing DNA from multiple species at the same time.

13

14 Bioinformatics Science that applies computational tools to DNA and protein sequences For the purpose of analyzing, storing, and accessing the sequences for comparative purposes

15 Next-generation sequencing Generates data 100x faster than Sanger method Massively parallel methods Large number of samples sequenced side by side Uses increased computer power and miniaturization

16

17

18 Template strand 3 5 Growing strand TAGGCCT ACACTT ACGCGAAT GT AT CCGGAT 3 PP i DNA polymerase 5 dgtp dntps ATP dndps dnmps + P i Light flash is detected by sensor.

19 Growing chain of DNA PP i Growing point Proton (H + ) release changes ph, generating an electrical signal. Incoming deoxyribonucleotide triphosphate Ion torrent semiconductor sequencing

20 Semiconductor sequencing was applied to sequencing the genome of Gordon Moore author of Moore's law at a mean coverage of 10.6-fold. This required ~1,000 ion chips to provide 1 billion sensors

21

22 ~MINUTES NOW

23

24

25

26

27 DNA Sequencing: Shotgun Assembly

28 Unknown DNA sequence T A G G T T A C C A C T C G A A Cleave DNA into fragments and sequence. Sequenced fragments C T C G A A G G T T A C C A G T T A C C A C T T A G G T T C C A C T C G A A T A C C A C T G T T A C C Computer analysis finds overlaps. T A G G T T G G T T A C C A G T T A C C G T T A C C A C T T A C C A C T C C A C T C G A A C T C G A A Sequence is deduced Pearson Education, Inc. TA GG T TA CCA C T C G A A

29 Suppose the shotgun sequences are: CTGC AGCAT AGCATG GCTGC What is the original sequence? A. AGCATGCTGC B. CTGCAGCATAGCATGGCTGC C. GCTGCAGCATG D. AGCATGC E. No clue

30 Theresa Randall Munroe, XKCD xkcd.com/1513/ VARIABLES FUNCTIONS STRINGS

31 Announcement: Assignment Assignment 2 ("Lab 2") is now out, available for you on Blackboard. Due this Friday at 9 pm (out 1 day later than usual, 45 extra hours on deadline) First small step on the way to finding genes in DNA sequence 31

32 Announcement 2: Bring laptop Th Thursday we will ask you to do short in-class survey at start of class We are studying CS 111! Qualtrics survey that should be okay on phone/tablet, but probably easier on laptop 32

33 To search DNA for specific genome variables functions strings need at least Let s start with variables and then as time allows very light look at functions and strings that may help with Lab2

34 Variables: Simple example In [1]: biologist1 = 'Rosalind Franklin' In [2]: biologist1 Out[2]: 'Rosalind Franklin' In [3]: biologist2 = "Watson" In [4]: biologist2 Out[4]: 'Watson' In [5]: print(biologist1) Out[5]: Rosalind Franklin

35 Variables: Simple example (cont.) In [1]: biologist1 = 'Rosalind Franklin' In [2]: biologist1 Out[2]: 'Rosalind Franklin' In [3]: biologist2 = "Watson" In [4]: biologist1 Out[4]: 'Watson' In [5]: print(biologist1) Out[5]: Rosalind Franklin In [6]: biologist1 + biologist2 Out[6]: 'Rosalind FranklinWatson' In [7]: print("my favorite is ", biologist1) Out[7]: My favorite is Rosalind Franklin

36 print() Requires those parentheses! Prints out what you give it, and you can give it a sequence of things separated by commas If some of the things you give it are variables, will print value of the variable 36

37 Code print(3*5) print( 3*5 ) print( 3 * 5) At the end of this code, what will appear on the terminal? 3*5 3* * * A B C D E. I don t know

38 Variables We want to tell computer to use specific value we put into its memory (To print out a word, to add 2 numbers together, etc.) Much easier for us as humans to give these things names than to remember addresses

39 A box that holds a value Think of variable as box that holds a value (Pythonistas will say value or object more or less interchangeably), and variable's name as sticky note on the box biologist1 biologist2 "Rosalind Franklin" "Watson"

40 >>> biologist1 = "Watson" >>> biologist1 'Watson >>> biologist2 = 'Crick' >>> biologist2 'Crick >>> result = biologist1+biologist2 >>> print ( The two biologists are, result) The two biologists are WatsonCrick Name biologist1 Value Watson >>> biologist1 = biologist1+biologist2 >>> biologist1 Name biologist1 biologist2 Value WatsonCrick Copyright (c) Henry Grant Archive/Museum of London B Crick A Name Value Name biologist1 Value Watson biologist1 biologist2 Watson Crick biologist2 Crick D biologist1 C WatsonCrick E. I don t know

41 Types Objects come in few different types. E.g., strings vs. numbers In Python computer (i.e., interpreter/spyder lower right window) generally figures it out for us, but we still need to know little bit about this since, e.g., In[1] : biologist1+biologist2 Out[1]: 'Rosalind FranklinWatson' In [2]: 3 + biologist1 Traceback (most recent call last): File "<ipython-input-7-900fb9c901d0>", line 1, in <module> 3 + biologist1 TypeError: unsupported operand type(s) for +: 'int' and 'str'

42 Some Python Types Python Type Example(s) String String "CATTAG" Integer (whole number) Integer 3, 0, 17, 42, -21, Decimal number Float Boolean (true/false) Boolean True, False

43 Types: Pick row that is 100% correct iclicker Choice Integer Float String A "" B "1" 4.4 'h' C "hello" D goodbye

44 We love you Python, oh yes we do! We have now covered well over half of everything you will need to know about types for this semester Types much bigger hassle in Java, C, C++

45 A Bit more on Strings (Lab 2!): indexing A A T G C C G T G C T T In [1]: mydna="aatgccgtgctt" In [2]: mydna[0] Out[2]: 'A' In [3]: mydna[3] Out[3]: 'G' In [4]: mydna[20] Out[4]: IndexError: string index out of range In [5]: mydna[0:3] Out[5]: 'AAT' 45

46 Assignment to variables: Semantics <variable> = <expression> 1. Evaluate <expression> 2. Put that value into computer's memory and attach name <variable> as "sticky note" giving name for that memory location

47 Expressions Can be a simple value, like "Rosalind Franklin" or 17 Can be almost any mathematical statement

48 Expressions Can be a simple value, like "Rosalind Franklin" or 17 Also can be almost any mathematical statement x = 6 * 2 y = x - 10 x Memory ("object space") 12

49 Expressions Can be a simple value, like "Rosalind Franklin" or 17 Also can be almost any mathematical statement x = 6 * 2 y = x - 10 x Memory ("object space") 12 Now evaluate x 10 getting à 2

50 Expressions Can be a simple value, like "Rosalind Franklin" or 17 Also can be almost any mathematical statement x = 6 * 2 y = x - 10 x y Memory ("object space") 12 2

51 At end of this code y will be x = 5 y = x * 3 x = 2 A. 2 B. 5 C. 6 D. 15