ASSIGNMENT 4. COMP-202, Summer 2017, All Sections. Due: Friday, June 16 th, 11:59pm

Transcription

1 ASSIGNMENT 4 COMP-202, Summer 2017, All Sections Due: Friday, June 16 th, 11:59pm Please read the entire PDF before starting. You must do this assignment individually. Question 1: 100 points 100 points total It is very important that you follow the directions as closely as possible. The directions, while perhaps tedious, are designed to make it as easy as possible for the TAs to mark the assignments by letting them run your assignment, in some cases through automated tests. While these tests will never be used to determine your entire grade, they speed up the process significantly, which allows the TAs to provide better feedback and not waste time on administrative details. Plus, if the TA is in a good mood while he or she is grading, then that increases the chance of them giving out partial marks. :) Up to 30% can be removed for bad indentation of your code as well as omitting comments, coding structure, or missing files. Marks will be removed as well if the class and method names are not respected. To get full marks, you must: Follow all directions below Make sure that your code compiles Non-compiling code will receive a very low mark Write your name and student name is written as a comment in all.java files you hand in Indent your code properly Name your variables appropriately The purpose of each variable should be obvious from the name Comment your work A comment every line is not needed, but there should be enough comments to fully understand your program 1

2 Part 1 (0 points): Warm-up Do NOT submit this part, as it will not be graded. However, doing these exercises might help you to do the second part of the assignment, which will be graded. If you have difficulties with the questions of Part 1, then we suggest that you consult the TAs during their office hours; they can help you and work with you through the warm-up questions. You are responsible for knowing all of the material in these questions. Warm-up Question 1 (0 points) Write a method firstnprimes that takes as input and integer n and returns an array of integers containing the first n prime numbers. Warm-up Question 2 (0 points) Write a method shiftstring which takes as input a String s an int n, and returns a new string obtained by shifting the characters in s by n positions to the right. For example: shiftstring( banana, 2) returns nabana, shiftstring( banana, 9) returns anaban, and shiftstring( banana, -1) returns ananab (a negative number will produce a shift to left!). Hint: Start by writing a method that shift the characters of a string by a fixed number of positions (say 2). Then generalize the method by letting the number of positions be determined by an input n which is less than the length of the string. And finally, write a method that works for any integer n. Warm-up Question 3 (0 points) Write a function LongestCommonPrefix that takes two input string s and t, and returns the longest common prefix of both strings. For example, if s = ACCTGAACTCCCCCC and t = ACCTAGGACCCCCC, then the longest common prefix is ACCT. Warm-up Question 4 (0 points) Write a class describing a Cat object. A cat has the following attributes: a name (String), a breed (String), an age (int) and a mood (String). The mood of a cat can be one of the following: sleepy, hungry, angry, happy, crazy. The cat constructor takes as input a String and sets that value to be the breed. The Cat class also contains a method called talk(). This method takes no input and returns nothing. Depending on the mood of the cat, it prints something different. If the cat s mood is sleepy, it prints meow. If the mood is hungry, it prints RAWR!. If the cat is angry, it prints hsssss. If the cat is happy it prints purrrr. If the cat is crazy, it prints a String of 10 gibberish characters (e.g. raseagafqa). The cat attributes are all private. Each one has a corresponding public method called getattributename() (ie: getname(), getmood(), etc.) which returns the value of the attribute. All but the breed also have a public method called setattributename() which takes as input a value of the type of the attribute and sets the attribute to that value. Be sure that only valid mood sets are permitted. (ie, a cat s mood can only be one of five things). There is no setbreed() method because the breed of a cat is set at birth and cannot change. Test your class in another file which contains only a main method. Test all methods to make sure they work as expected. Warm-up Question 5 (0 points) Using the Cat type defined in the previous question, create a Cat[] of size 5. Create 5 Cat objects and put them all into the array. Page 2

3 Part 2 The questions in this part of the assignment will be graded. Question 1: Creating Data Types (100 points) DNA is a molecule that carries the genetic instructions used in the growth, development, functioning and reproduction of all known living organisms 1. A genome is an organism s complete set of DNA (or genetic material). Each genome contains all of the information needed to build and maintain that organism, and passing life on to the next generation. Biologists usually abstract away the genome to a sequence of nucleotides (A, C, G, or T) (Each letter represents a small molecule, and a DNA sequence is a macromolecular chain of them.). This sequence is just a succession of letters that indicate the order of nucleotides within a DNA molecule. Then, a DNA sequence that has been translated from life s chemical alphabet into our alphabet of written letters might look like this: (AGTCCGC...). That is, in this particular piece of DNA, an adenine (A) is followed by a guanine (G), which is followed by a thymine (T), which in turn is followed by a cytosine (C), another cytosine (C), and so on. The cost of sequencing a human genome (i.e., the process of figuring out the order of DNA nucleotides in a genome) has fallen from approximately $100 million in 2001 to $1,000 in Scientists are able now to study entire genome sequences to try to understand how the genome as a whole works. Although the sequences of many genomes have been (almost) completely determined, yet much work still needs to be done. One very needed task in the field is the creation of a new Data Type in Java that would be able to store and model the genome in a object-oriented fashion. As a student of COMP202 you have been commissioned to develop this new data type. To be fully functional (and useful for biologists) the new data type should support the following attributes and methods. 1. Create a java class called Genome. This class has three attributes. Two Strings called sequence and species (which store the DNA sequence [a sequence of nucleotides] and the origin species [such as humans, giraffe, monkey etc] of the Genome, respectively). One int called numgenes representing the number of genes present in the Genome. All the attributes must be non-static and private. 2. Generate getter methods for each of the three previously defined attributes. 3. Generate a constructor that get two String parameters: the sequence and species of the Genome. Your constructor must initialize the class attributes. Please make sure that you initialize the Genome sequence only with uppercase letters extracted from the valid alphabet (A, C, G, T). HINT: It is a good idea to declare a method checknucleotide to check if a character belongs to the valid alphabet, you will use it again later. 4. Generate a private method called tostring(). This method must overwrite the default method tostring(). This method should now print information regarding the three attributes (i.e., sequence, species and numgenes). If the number of genes has not been computed for the Genome, you should inform the user that there is no information about the number of genes. 5. Generate a private method called addnucleotide that gets as parameter a char c and an int index. This method should insert the new nucleotide at the position index of the Genome sequence. addnucleotide must throw a RuntimeException if the character c is an illegal nucleotide. 6. Generate a private method called nucleotideat that gets as parameter an int index. This method should return the nucleotide located at the position index in the Genome. nucleotideat should throw a RuntimeException if the Genome is out of bounds 7. Generate a private method called length that returns the number of nucleotides in the Genome. 8. Generate a private method called isvalid. This method receive a String seq as parameter and it validates (returning true) if seq is a valid DNA sequence. A DNA sequence is valid if all the nucleotides belong to the uppercase alphabet (A, C, G, T). 1 Definition extracted from: Page 3

4 9. Generate a private method called checkequality. This method has as a unique parameter Genome obj and it returns true if the two Genomes (i.e., the one received as parameter and the one referenced by this) have the same elements (i.e., The sequences and species are the same). 10. Generate a private method called subsequence. Given two strings s and t (as parameters), write a private function Subsequence that determines whether s is a subsequence of t. That is, the letters of s should appear in the same order in t, but not necessarily contiguously. For example accag is a subsequence of taagcccaaccgg. 11. Generate a private method called isgene which validates if a subsequence (of the DNA Genome) is a gene. A gene is a region of the genome that represents a functional unit of critical importance in understanding life processes. Particularly, a gene is a substring that contains the instructions for making one protein. To perform the creation of proteins, the Genome is conceptually partitioned into units of three consecutive nucleotides, each called a codon. isgene takes a DNA string as an argument and determines whether it corresponds to a potential gene based on the following criteria: It begins with the start codon ATG. Its length is a multiple of 3. It ends with one of the stop codons TAG, TAA, or TGA. It has no intervening stop codons. For example, having as parameter the String ATGCGCCTGCGTCTGTACTAG the method isgene should return true because: i) The length (i.e., 21) is a multiple of three, ii) it starts with the start codon ATG, iii) it ends with the stop codon TAG and iv) There are no intervening stop codons in the substring CGCCTGCGTCTGTAC. 12. Generate a private void method called findgenes which do not receive parameters and calculates the total number of genes in the Genome sequence. Once you compute the total number of genes the method must update the class attribute numgenes with the computed number. HINT: You can use the previously computed isgene method to know if a substring is a gene or not. 13. Generate a private function called iscircularshift that checks whether two strings s and t (given as parameters) are circular shifts of one another. For example, ACTGACG is a circular shift of TGACGAC, and vice versa. Detecting this condition is important in the study of genomic sequences. HINT: Think how can you use the String function contains to solve this problem. 14. Generate a private method called reversecomplemented that returns the reverse complement of the Genome sequence. Normally, DNA occurs as a double strand where each A is paired with a T and vice versa, and each C is paired with a G and vice versa. The reverse complement of a DNA sequence is formed by reversing the letters, interchanging A and T and interchanging C and G. Thus the reverse complement of ACCTGAG is CTCAGGT (please note that the strings are reversed). 15. In DNA sequence analysis, a complemented palindrome is a string equal to its reverse complement. Adenine (A) and Thymine (T) are complements, as are Cytosine (C) and Guanine (G). For example, ACGGT is a complement palindrome. Write a function called longestcomplementedpalindrome that given a String input, finds the longest complemented palindrome that is a substring of the text. For example, if the text is GACACGGTTTTA then the longest complemented palindrome is ACGGT. HINT: consider each letter as the center of a possible palindrome of odd length, then consider each pair of letters as the center of a possible palindrome of even length. What To Submit You have to submit the Genome.java file to mycourses. Do not submit any other files, especially.class files. You can also submit the file called Confession.txt. In this file, you can tell the TA about any issues you ran into doing this assignment. If you point out an error that you know occurs in your problem, it may lead Page 4

5 the TA to give you more partial credit. On the other hand, it also may lead the TA to notice something that otherwise they would not. Page 5