Evolutionary Genetics. LV Lecture with exercises 6KP. Bioinformatics. Jean-Claude Walser

Transcription

1 Evolutionary Genetics LV Lecture with exercises 6KP Bioinformatics Jean-Claude Walser 1 HS2018

2 What is bioinformatics? Why bioinformatics? What is the difference between informatics and bioinformatics? Does a biologist need bioinformatics?!8

3 What is Bioinformatics? in vivo - in vitro - in silico!9

4 Does a biologist need bioinformatics? YES, absolutely!!!!10

5 >Seq1 Example tmp ACCGTAGCTAGTACGTACGATATATCGAT CCTAGCTCTGACGTACGAGTCGATCGATC GGCGCGATGATCGTAGCTAGCCACACACT ACGCGGCTATCGCGCTATCAGCATGCTAG ACGGCGGCTTTTGCGGCGCGCTAAAATTG NCBI!11

6 The war of the OS and the conflict of the V Mac Linux Windows!12

7 A graphical user interface (GUI) - often pronounced gooey - an interface that allows the user (you) to interact with programs in more ways than typing. GUIs are nice but don t be afraid of the terminal!!13

8 GUIs were introduced in reaction to the steep learning curve of command-line interfaces (CLI), which require commands to be typed on the keyboard. Since the commands available in command line interfaces can be numerous, complicated operations can be completed using a short sequence of words and symbols. This allows for greater efficiency and productivity once many commands are learned.!14

9 Shell - Terminal X Shell is a UNIX term for the interactive user interface with an operating system. The shell is the layer of programming that understands and executes the commands a user enters. Bourne-Shell (sh) Korn-Shell (ksh) C-Shell (csh) TC-Shell (tcsh) Bourne-Again-Shell (bash) Debian Almquist Shell (dash) Z-Shell (zsh) A-Shell (ash) PowerShell / cmd.exe # What do I have? > echo ${SHELL}!15

10 Find the terminal on your computer!16

11 / bin etc users tmp var UserA ME UserC TMP UniBas Privat FS17 HS17 ebooks Music!17

12 Prompt Command > ls -lh Options / Arguments!18

13 Get Help > info <command> > info ls > man <command> > man ls * press Q to leave info or help!19

14 pwd - print name of current/working directory / bin etc users tmp var directory with users homes UserA ME UserC > pwd /home/me user homes (~) TMP UniBas Privat FS17 HS18 ebooks Music!20

15 cd - change directory / users ME TMP UniBas Privat > cd UniBas FS17 HS18 ebooks Music > cd UniBas/HS18 21

16 mkdir - creating directories / users ME > mkdir ME/UniBas/HS18/exercises > mkdir -p ME/UniBas/HS18/exercises TMP UniBas Privat FS17 HS18 ebooks Music > mkdir exercises exercises 22

17 cd - change directory (going up) / users ME TMP UniBas Privat FS17 HS18 ebooks Music > cd.. > cd../.. > cd /home/me/unibas > cd /home/me 23

18 > open /Volumes/MacBook/Applications/Firefox.app > edit /TMP/test.txt 24

19 Science? Reproducible Science?!25

20 Reproducible Science?!26

21 !27

22 !28

23 !29

24 !30

25 => The mtdna code thus has four Stops. Slightly different mtdna codes are found in Drosophila and other invertebrate groups. Differences between the vertebrate mtdna code and the "Universal" code: - AUA and AUG are both Met codons - UGA codes for Trp and not a Stop codon - AGA and AGG codons are read as Stops instead of Arg!31

26 Question - Aim Input file(s) - original and parsed Program & Version (& Link) Parameters (& References) Output file(s) / Log-file(s) Interpretation / Disscusion!32

27 Aim Find differences between two nucleotide sequences. Date: XX.YY.ZZ Input my file: Pram_sequence_A0021.fasta NCBI file: AY (AY fasta) Pairwise alignment: LALIGN (Online Version 3.2.1) Option: default Results Waterman-Eggert score: 682; bits; E(1) < 1e % identity (98.6% similar) in 140 nt overlap (1-140:1-140) A0021 ACACGTGCTACAATGGCCGTTACAGAGGGAAGCGAAACCGCGAGGTGGAGCCAATCTCAG... :::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::... AY76091 ACACGTGCTACAATGGCCGTTACAGAGGGATTCGAAACCGCGAGGTGGAGCCAATCTCAG !33 Discussion My sequence (Pram sequence) aligns nicely with AY from the NCBI database. There are, however, two nucleotide changes (red box).

28 # comments code 34

29 Syntax colouring Line numbers Text encodings Find and replace Translation for line breaks >Most Fonts WWWWWWWWWW IIIIIIIIII AXAXAXAXAX >Courier WWWWWWWWWW IIIIIIIIII AXAXAXAXAX!35

30 Markdown!36

31 PROGRAMMING IN BIOINFORMATICS R Python - BioPython Perl - BioPerl SQL C and C++ Ruby PHP and JavaScript Java Go Linux!37