Linux + Galaxy Server Tutorial
|
|
|
- Whitney Joseph
- 6 years ago
- Views:
Transcription
1 Linux + Galaxy Server Tutorial Pei-Chen Peng Linux+Galaxy Pei-Chen Peng
2 Introduction Exercise 1. Download lab data to flash drive. 2. Run a simple bioinformatics program on linux.. 3. Learn Galaxy server interface. Linux+Galaxy Pei-Chen Peng
3 . Download lab data Downloading data to flash drive and creating an account file Linux+Galaxy Pei-Chen Peng
4 Step 1A: Accessing lab files Go to Move Flash_Drive_Data.zip to your flash drive Decompress the zip file: Right click > Extract All Now you are all set! Linux+Galaxy Pei-Chen Peng
5 Step 1A: Save login credential For viewing and manipulating the files needed for this laboratory exercise, insert your flash drive. Denote the path to the flash drive as the following: We will use the files found in: [course_directory] [course_directory]/password.txt Enter login credentials assigned to you, and save the file. We will use this account to login for lab sessions this week. Linux+Galaxy Pei-Chen Peng
6 . Linux commands Using ClustW to align two sequences Linux+Galaxy Pei-Chen Peng
7 Step 1A: Accessing the IGB Biocluster Open Putty.exe In the hostname textbox type: biologin.igb.illinois.edu Click Open If popup appears, Click Yes Enter login credentials assigned to you; example, user mayo_stud00. You will not see any characters on screen when typing in password. Just type it. Now you are all set! Linux+Galaxy Pei-Chen Peng
8 Step 1B: Listing files and directories (ls) $ ls # listing files in your current directory. When you first login, your directory is your home directory. Linux+Galaxy Pei-Chen Peng
9 Step 1C: Making Directories (mkdir) $ mkdir ~/01_Linux_Galaxy # create a subdirectory in your home directory. The tilde ~ character refers to your home directory. $ ls # to see the directory you just created. Linux+Galaxy Pei-Chen Peng
10 Step 1D: Changing directory (cd) The lab is located in the following directory: /home/classroom/mayo/2017/01_linux_galaxy $ cd /home/classroom/mayo/2017/01_linux_galaxy # tip: use tab for autocompletetion for path $ ls # to see the contents. You should see seqs.fa Step 1E: Print working directory (pwd) $ pwd # to see the full pathname. You should see /home/classroom/mayo/ 2017/01_Linux_Galaxy Linux+Galaxy Pei-Chen Peng
11 Step 1F: Copying files (cp) Copy seqs.fa from the data directory to your working directory. $ cp /home/classroom/mayo/2017/01_linux_galaxy/seqs.fa ~/01_Linux_Galaxy/ # tip: use tab for autocompletetion for path $ cd ~/01_Linux_Galaxy/ Step 1G: Displaying the contents of a file on the screen (more) $ more seqs.fa # you should see two sequences on your screen >seq1 GATCGAGCGATCGTGCAGC GCAGAATGCGCGCTAG >seq2 Linux+Galaxy Pei-Chen Peng
12 Commands Summary Command Meaning ls mkdir directory cd directory cd ~ cd.. pwd cp file1 file2 more file list files and directories make a directory change to named directory change to home directory change to parent directory display the path of the current directory cp file1 and call it file2 display the contents of a file Linux+Galaxy Pei-Chen Peng
13 Useful tips Command Meaning tab é auto-comple path retrieve previous commands Linux+Galaxy Pei-Chen Peng
14 Step 1H: Run sequence alignment program Accessing the IGB Biocluster Linux+Galaxy Pei-Chen Peng
15 Step 1H: Run sequence alignment program $ srun - p classroom - c mem pty bash # SKIP IF DONE # Open interactive session on biocluster with 2 cpus and 8G memory. $ module load ClustalW2 # Load sequence aligner into the shell environment. $ module list #See loaded tools $ clustalw2 - INFILE=seqs.fa # Run the clustalw sequence aligner. Linux+Galaxy Pei-Chen Peng
16 Step 1H: Run sequence alignment program You will see this on your screen, when the program is done. CLUSTAL 2.1 Multiple Sequence Alignments Sequence format is Pearson Sequence 1: seq1 35 bp Sequence 2: seq2 32 bp Start of Pairwise alignments Aligning... Sequences (1:2) Aligned. Score: 21 Guide tree file created: [seqs.dnd] There are 1 groups Start of Multiple Alignment Aligning... Group 1: Alignment Score 47 Delayed CLUSTAL- Alignment file created [seqs.aln] Linux+Galaxy Pei-Chen Peng
17 Step 1H: Run sequence alignment program The alignment result is in seqs.aln. Use more command to see the result. $ more seqs.aln # You should see the following on your screen. CLUSTAL 2.1 multiple sequence alignment seq1 seq2 GATCGAGCGA- TCGTGCAGCGCAGAATGCGCGCTAG GGTAGGGTAAATTGCCTACCGTCGATCGAGTA * * * * * * * * ** ** * * Linux+Galaxy Pei-Chen Peng
18 . Galaxy Server Interface Learning Galaxy Interface through an interactive tour. Linux+Galaxy Pei-Chen Peng
19 Step 1A: Logging into Galaxy Go to: galaxy.knowhub.org Click Enter Click Login Input your login credentials. Click Login. Linux+Galaxy Pei-Chen Peng
20 Step 1B: Galaxy Start Screen The resulting screen should look like the figure below: Linux+Galaxy Pei-Chen Peng
21 Step 1C: Galaxy interface tutorial Go to Linux+Galaxy Pei-Chen Peng
UNIX Tutorial One
1.1 Listing files and directories ls (list) When you first login, your current working directory is your home directory. Your home directory has the same name as your user-name, for example, ee91ab, and
Helsinki 19 Jan Practical course in genome bioinformatics DAY 0
Helsinki 19 Jan 2017 529028 Practical course in genome bioinformatics DAY 0 This document can be downloaded at: http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/exercises_day0.pdf The
1 Getting Started with Linux.
PHYS-4007/5007: omputational Physics Tutorial #1 Using Linux for the First Time 1 Getting Started with Linux. The information of logging in on the Linux side of the computers in Brown Hall 264 can be found
Unix background. COMP9021, Session 2, Using the Terminal application, open an x-term window. You type your commands in an x-term window.
Unix background COMP9021, Session 2, 2016 1 Introduction Using the Terminal application, open an x-term window. You type your commands in an x-term window. Many commands take one or more arguments. Many
CSCI 161: Introduction to Programming I Lab 1a: Programming Environment: Linux and Eclipse
CSCI 161: Introduction to Programming I Lab 1a: Programming Environment: Linux and Eclipse Goals - to become acquainted with the Linux/Gnome environment Overview For this lab, you will login to a workstation
CS CS Tutorial 2 2 Winter 2018
CS CS 230 - Tutorial 2 2 Winter 2018 Sections 1. Unix Basics and connecting to CS environment 2. MIPS Introduction & CS230 Interface 3. Connecting Remotely If you haven t set up a CS environment password,
Introduction to Linux. Fundamentals of Computer Science
Introduction to Linux Fundamentals of Computer Science Outline Operating Systems Linux History Linux Architecture Logging in to Linux Command Format Linux Filesystem Directory and File Commands Wildcard
Chapter Two. Lesson A. Objectives. Exploring the UNIX File System and File Security. Understanding Files and Directories
Chapter Two Exploring the UNIX File System and File Security Lesson A Understanding Files and Directories 2 Objectives Discuss and explain the UNIX file system Define a UNIX file system partition Use the
Commands are in black
Starting From the Shell Prompt (Terminal) Commands are in black / +--------+---------+-------+---------+---------+------ +------ +------ +------ +------ +------ +-- Bin boot dev etc home media sbin bin
Working with Basic Linux. Daniel Balagué
Working with Basic Linux Daniel Balagué How Linux Works? Everything in Linux is either a file or a process. A process is an executing program identified with a PID number. It runs in short or long duration
Short Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 2 Learning the Linux Compute Environment In-class Slides Matt Hynes-Grace Manager of IT Operations, BioFrontiers Institute Review of Day 2 Videos Video 1 Introduction
Getting Started With UNIX Lab Exercises
Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.
Introduction to the UNIX command line
Introduction to the UNIX command line Steven Abreu Introduction to Computer Science (ICS) Tutorial Jacobs University s.abreu@jacobs-university.de September 19, 2017 Overview What is UNIX? UNIX Shell Commands
5/8/2012. Creating and Changing Directories Chapter 7
Creating and Changing Directories Chapter 7 Types of files File systems concepts Using directories to create order. Managing files in directories. Using pathnames to manage files in directories. Managing
15-122: Principles of Imperative Computation
15-122: Principles of Imperative Computation Lab 0 Navigating your account in Linux Tom Cortina, Rob Simmons Unlike typical graphical interfaces for operating systems, here you are entering commands directly
CMSC 201 Spring 2017 Lab 01 Hello World
CMSC 201 Spring 2017 Lab 01 Hello World Assignment: Lab 01 Hello World Due Date: Sunday, February 5th by 8:59:59 PM Value: 10 points At UMBC, our General Lab (GL) system is designed to grant students the
CENG 334 Computer Networks. Laboratory I Linux Tutorial
CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction
Perl and R Scripting for Biologists
Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications
Systems Programming and Computer Architecture ( ) Exercise Session 01 Data Lab
Systems Programming and Computer Architecture (252-0061-00) Exercise Session 01 Data Lab 1 Goal Get familiar with bit level representations, C and Linux Thursday, September 22, 2016 Systems Programming
Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...
Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing
Introduction. Overview of 201 Lab and Linux Tutorials. Stef Nychka. September 10, Department of Computing Science University of Alberta
1 / 12 Introduction Overview of 201 Lab and Linux Tutorials Stef Nychka Department of Computing Science University of Alberta September 10, 2007 2 / 12 Can you Log In? Should be same login and password
Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University
Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )
Operating Systems. Copyleft 2005, Binnur Kurt
3 Operating Systems Copyleft 2005, Binnur Kurt Content The concept of an operating system. The internal architecture of an operating system. The architecture of the Linux operating system in more detail.
EE516: Embedded Software Project 1. Setting Up Environment for Projects
EE516: Embedded Software Project 1. Setting Up Environment for Projects By Dong Jae Shin 2015. 09. 01. Contents Introduction to Projects of EE516 Tasks Setting Up Environment Virtual Machine Environment
Introduction: What is Unix?
Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix
Operating Systems 3. Operating Systems. Content. What is an Operating System? What is an Operating System? Resource Abstraction and Sharing
Content 3 Operating Systems The concept of an operating system. The internal architecture of an operating system. The architecture of the Linux operating system in more detail. How to log into (and out
User Guide Version 2.0
User Guide Version 2.0 Page 2 of 8 Summary Contents 1 INTRODUCTION... 3 2 SECURESHELL (SSH)... 4 2.1 ENABLING SSH... 4 2.2 DISABLING SSH... 4 2.2.1 Change Password... 4 2.2.2 Secure Shell Connection Information...
CS 2400 Laboratory Assignment #1: Exercises in Compilation and the UNIX Programming Environment (100 pts.)
1 Introduction 1 CS 2400 Laboratory Assignment #1: Exercises in Compilation and the UNIX Programming Environment (100 pts.) This laboratory is intended to give you some brief experience using the editing/compiling/file
Linux/Unix Filesystems
Linux/Unix Filesystems Objectives: The lab exercise is designed to introduce you to the linux operating system and environment employed in the Geography Department's Lab. This exercise covers: - How to
CSN08101 Digital Forensics. Module Leader: Dr Gordon Russell Lecturers: Robert Ludwiniak
CSN08101 Digital Forensics Lecture 1B: Essential Linux and Caine Module Leader: Dr Gordon Russell Lecturers: Robert Ludwiniak Essential Linux and Caine You will learn in this lecture: Essential Command
Linux & Shell Programming 2014
Unit -1: Introduction to UNIX/LINUX Operating System Practical Practice Questions: Find errors (if any) otherwise write output or interpretation of following commands. (Consider default shell is bash shell.)
LAB #5 Intro to Linux and Python on ENGR
LAB #5 Intro to Linux and Python on ENGR 1. Pre-Lab: In this lab, we are going to download some useful tools needed throughout your CS career. First, you need to download a secure shell (ssh) client for
No Food or Drink in this room. Logon to Windows machine
While you are waiting No Food or Drink in this room Logon to Windows machine Username/password on right-hand monitor Not the username/password I gave you earlier We will walk through connecting to the
CMSC 201 Spring 2018 Lab 01 Hello World
CMSC 201 Spring 2018 Lab 01 Hello World Assignment: Lab 01 Hello World Due Date: Sunday, February 4th by 8:59:59 PM Value: 10 points At UMBC, the GL system is designed to grant students the privileges
High Performance Computing Cluster Basic course
High Performance Computing Cluster Basic course Jeremie Vandenplas, Gwen Dawes 30 October 2017 Outline Introduction to the Agrogenomics HPC Connecting with Secure Shell to the HPC Introduction to the Unix/Linux
The Command Shell. Fundamentals of Computer Science
The Command Shell Fundamentals of Computer Science Outline Starting the Command Shell Locally Remote Host Directory Structure Moving around the directories Displaying File Contents Compiling and Running
Using the Zoo Workstations
Using the Zoo Workstations Version 1.86: January 16, 2014 If you ve used Linux before, you can probably skip many of these instructions, but skim just in case. Please direct corrections and suggestions
COSC UNIX. Textbook. Grading Scheme
COSC 2306 - UNIX Education has failed in a very serious way to convey the most important lesson science can teach: skepticism. - David Suzuki Fall 2008 Aaron Langille Textbook Linux for Programmers and
First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings Linux Commands 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material
The Unix Shell & Shell Scripts
The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises
History. Terminology. Opening a Terminal. Introduction to the Unix command line GNOME
Introduction to the Unix command line History Many contemporary computer operating systems, like Microsoft Windows and Mac OS X, offer primarily (but not exclusively) graphical user interfaces. The user
Linux Exercise. pwd answer: We call this directory (into which you get when you log in) your home directory.
Linux Exercise The following steps will guide you through the most common Linux commands. If you are using windows (Library and any Windows lab on campus), then start with step 1. If you are using a linux
Guided Tour (Version 3.3) By Steven Castellucci as Modified by Brandon Haworth
Guided Tour (Version 3.3) By Steven Castellucci as Modified by Brandon Haworth This document was inspired by the Guided Tour written by Professor H. Roumani. His version of the tour can be accessed at
Unix Tutorial Haverford Astronomy 2014/2015
Unix Tutorial Haverford Astronomy 2014/2015 Overview of Haverford astronomy computing resources This tutorial is intended for use on computers running the Linux operating system, including those in the
Linux at the Command Line Don Johnson of BU IS&T
Linux at the Command Line Don Johnson of BU IS&T We ll start with a sign in sheet. We ll end with a class evaluation. We ll cover as much as we can in the time allowed; if we don t cover everything, you
CSC111 Computer Science II
CSC111 Computer Science II Lab 1 Getting to know Linux Introduction The purpose of this lab is to introduce you to the command line interface in Linux. Getting started In our labs If you are in one of
CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80
CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure
Introduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
Introduction to Unix: Fundamental Commands
Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating
Chapter-3. Introduction to Unix: Fundamental Commands
Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system
Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/
Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux
Intermediate Programming, Spring Misha Kazhdan
600.120 Intermediate Programming, Spring 2017 Misha Kazhdan Outline Unix/Linux command line Basics of the Emacs editor Compiling and running a simple C program Cloning a repository Connecting to ugrad
CSCE 212H, Spring 2008, Matthews Lab Assignment 1: Representation of Integers Assigned: January 17 Due: January 22
CSCE 212H, Spring 2008, Matthews Lab Assignment 1: Representation of Integers Assigned: January 17 Due: January 22 Manton Matthews January 29, 2008 1 Overview The purpose of this assignment is to become
Tutorial 1: Unix Basics
Tutorial 1: Unix Basics To log in to your ece account, enter your ece username and password in the space provided in the login screen. Note that when you type your password, nothing will show up in the
CS 215 Fundamentals of Programming II Spring 2019 Very Basic UNIX
CS 215 Fundamentals of Programming II Spring 2019 Very Basic UNIX This handout very briefly describes how to use Unix and how to use the Linux server and client machines in the EECS labs that dual boot
Operating Systems and Using Linux. Topics What is an Operating System? Linux Overview Frequently Used Linux Commands
Operating Systems and Using Linux Topics What is an Operating System? Linux Overview Frequently Used Linux Commands 1 What is an Operating System? A computer program that: Controls how the CPU, memory
First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
Some Linux (Unix) Commands that might help you in ENSC351
Some Linux (Unix) Commands that might help you in ENSC351 First, like Windows, Linux and Unix (for our purposes, they are the basically the same) use a hierarchical directory structure. What would be called
Lab 1: Introduction to Linux Networking
CMPE 150: Introduction to Computer Networks Fall 2011 http://courses.soe.ucsc.edu/courses/cmpe150/fall11/01/ Lab 1: Introduction to Linux Networking Materials: Please bring a USB drive to each lab section.
Mills HPC Tutorial Series. Linux Basics I
Mills HPC Tutorial Series Linux Basics I Objectives Command Line Window Anatomy Command Structure Command Examples Help Files and Directories Permissions Wildcards and Home (~) Redirection and Pipe Create
Examples: Directory pathname: File pathname: /home/username/ics124/assignments/ /home/username/ops224/assignments/assn1.txt
ULI101 Week 03 Week Overview Absolute and relative pathnames File name expansion Shell basics Command execution in detail Recalling and editing previous commands Quoting Pathnames A pathname is a list
CS4023 Week04 Lab Exercise
CS4023 Week04 Lab Exercise Lab Objective: We will use this lab to log in to our Linux accounts and to look at some simple programs that perform a few elementary system calls. By the end of the lab we will
Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades Q2
Linux Operating System Environment Computadors Grau en Ciència i Enginyeria de Dades 2017-2018 Q2 Facultat d Informàtica de Barcelona This first lab session is focused on getting experience in working
Lecture 01 - Working with Linux Servers and Git
Jan. 9, 2018 Working with Linux Servers: SSH SSH (named for Secure SHell) is a protocol commonly used for remote login. You can use it from a command line interface with the following syntax ssh username@server_url
Oregon State University School of Electrical Engineering and Computer Science. CS 261 Recitation 1. Spring 2011
Oregon State University School of Electrical Engineering and Computer Science CS 261 Recitation 1 Spring 2011 Outline Using Secure Shell Clients GCC Some Examples Intro to C * * Windows File transfer client:
1Z Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions
1Z0-409 Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions Table of Contents Introduction to 1Z0-409 Exam on Oracle Linux Fundamentals (Oracle Partner Network)... 2 Oracle
Laboratory 1 Semester 1 11/12
CS2106 National University of Singapore School of Computing Laboratory 1 Semester 1 11/12 MATRICULATION NUMBER: In this lab exercise, you will get familiarize with some basic UNIX commands, editing and
Introduction to Linux and Cluster Computing Environments for Bioinformatics
Introduction to Linux and Cluster Computing Environments for Bioinformatics Doug Crabill Senior Academic IT Specialist Department of Statistics Purdue University dgc@purdue.edu What you will learn Linux
Maize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
Introduction to Supercomputing
Introduction to Supercomputing TMA4280 Introduction to UNIX environment and tools 0.1 Getting started with the environment and the bash shell interpreter Desktop computers are usually operated from a graphical
Introduction to the Linux Command Line
Introduction to the Linux Command Line May, 2015 How to Connect (securely) ssh sftp scp Basic Unix or Linux Commands Files & directories Environment variables Not necessarily in this order.? Getting Connected
Robert Bukowski Jaroslaw Pillardy 6/27/2011
COMPUTATIONAL BIOLOGY SERVICE UNIT, 3CPG RNA Seq CBSU Computational Resources for the Workshop Robert Bukowski (bukowski@cornell.edu); Jaroslaw Pillardy (jp86@cornell.edu) 6/27/2011 In this edition of
You should see something like this, called the prompt :
CSE 1030 Lab 1 Basic Use of the Command Line PLEASE NOTE this lab will not be graded and does not count towards your final grade. However, all of these techniques are considered testable in a labtest.
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
Introduction to Linux (Part I) BUPT/QMUL 2018/03/14
Introduction to Linux (Part I) BUPT/QMUL 2018/03/14 Contents 1. Background on Linux 2. Starting / Finishing 3. Typing Linux Commands 4. Commands to Use Right Away 5. Linux help continued 2 Contents 6.
Embedded Linux Systems. Bin Li Assistant Professor Dept. of Electrical, Computer and Biomedical Engineering University of Rhode Island
Embedded Linux Systems Bin Li Assistant Professor Dept. of Electrical, Computer and Biomedical Engineering University of Rhode Island Generic Embedded Systems Structure User Sensors ADC microcontroller
Operating systems fundamentals - B02
Operating systems fundamentals - B02 David Kendall Northumbria University David Kendall (Northumbria University) Operating systems fundamentals - B02 1 / 1 Introduction Getting started with Linux How the
CSCE UVM Hands-on Session-1 Pre-Work
CSCE489-689 UVM Hands-on Session-1 Pre-Work Please complete the following steps before the lecture on Feb-16. These steps will help set-up the environment and tools necessary for the hands-on session.
CS Fundamentals of Programming II Fall Very Basic UNIX
CS 215 - Fundamentals of Programming II Fall 2012 - Very Basic UNIX This handout very briefly describes how to use Unix and how to use the Linux server and client machines in the CS (Project) Lab (KC-265)
CST Lab 2 Review #1
CST8177 - Lab 2 Review #1 Student Name Student number Section Objectives To review command line features, file system access, and permissions Lab Outcome A review of working with the command line A review
INTRODUCTION TO BIOINFORMATICS
Introducing the LINUX Operating System BecA-ILRI INTRODUCTION TO BIOINFORMATICS Mark Wamalwa BecA- ILRI Hub, Nairobi, Kenya h"p://hub.africabiosciences.org/ h"p://www.ilri.org/ m.wamalwa@cgiar.org 1 What
Introduction to Linux Environment. Yun-Wen Chen
Introduction to Linux Environment Yun-Wen Chen 1 The Text (Command) Mode in Linux Environment 2 The Main Operating Systems We May Meet 1. Windows 2. Mac 3. Linux (Unix) 3 Windows Command Mode and DOS Type
Introduction to Linux Workshop 1
Introduction to Linux Workshop 1 The George Washington University SEAS Computing Facility Created by Jason Hurlburt, Hadi Mohammadi, Marco Suarez hurlburj@gwu.edu Logging In The lab computers will authenticate
EECS 211 Lab 2. Getting Started. Getting the code. Windows. Mac/Linux
EECS 211 Lab 2 Control Statements, Functions and Structures Winter 2017 Today we are going to practice navigating in the shell and writing basic C++ code. Getting Started Let s get started by logging into
Parts of this tutorial has been adapted from M. Stonebank s UNIX Tutorial for Beginners (http://www.ee.surrey.ac.uk/teaching/unix/).
Ubuntu tutorial Parts of this tutorial has been adapted from M. Stonebank s UNIX Tutorial for Beginners (http://www.ee.surrey.ac.uk/teaching/unix/). 1 Installing Ubuntu About Ubuntu For our lab sessions
Linux Introduction Martin Dahlö Valentin Georgiev
Linux Introduction 2018-02-12 Martin Dahlö martin.dahlo@scilifelab.uu.se Valentin Georgiev valentin.georgiev@icm.uu.se Objectives What is CLI, shell, terminal What is directory tree How to use simple commands
5/8/2012. Encryption-based Protection. Protection based on Access Permission (Contd) File Security, Setting and Using Permissions Chapter 9
File Security, Setting and Using Permissions Chapter 9 To show the three protection and security mechanisms that UNIX provides To describe the types of users of a UNIX file To discuss the basic operations
Session 1: Accessing MUGrid and Command Line Basics
Session 1: Accessing MUGrid and Command Line Basics Craig A. Struble, Ph.D. July 14, 2010 1 Introduction The Marquette University Grid (MUGrid) is a collection of dedicated and opportunistic resources
Introduction to Linux Spring 2014, Section 02, Lecture 3 Jason Tang
Introduction to Linux Spring 2014, Section 02, Lecture 3 Jason Tang Topics What is an Operating System Overview of Linux Linux commands Shell Submit system What is an Operating System? Special type of
Introduction to Cuda Visualization. Graphical Application Tunnelling on Palmetto
Introduction to Cuda Visualization The CUDA programming paradigm is NVidia's development tool which is used to enable advanced computer processing on their GPGPU (General Purpose graphics Processing Units)
Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny.
Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny stefano.gaiarsa@unimi.it Linux and the command line PART 1 Survival kit for the bash environment Purpose of the
Once you have installed MobaXterm, open MobaXterm. Go to Sessions -> New Session, and click on the SSH icon.
Lab 1 In order to get credit for the lab, you need to be checked off by the end of lab. For nonzero labs, you can earn a maximum of 3 points for lab work completed outside of lab time, but you must finish
CMSC 104 Lecture 2 by S Lupoli adapted by C Grasso
CMSC 104 Lecture 2 by S Lupoli adapted by C Grasso A layer of software that runs between the hardware and the user. Controls how the CPU, memory and I/O devices work together to execute programs Keeps
02. At the command prompt, type usermod -l bozo bozo2 and press Enter to change the login name for the user bozo2 back to bozo. => steps 03.
Laboratory Exercises: ===================== Complete the following laboratory exercises. All steps are numbered but not every step includes a question. You only need to record answers for those steps that
Using Linux as a Virtual Machine
Intro to UNIX Using Linux as a Virtual Machine We will use the VMware Player to run a Virtual Machine which is a way of having more than one Operating System (OS) running at once. Your Virtual OS (Linux)
THE HONG KONG POLYTECHNIC UNIVERSITY Department of Electronic and Information Engineering
THE HONG KONG POLYTECHNIC UNIVERSITY Department of Electronic and Information Engineering ENG224 Information Technology Part I: Computers and the Internet Laboratory 2 Linux Shell Commands and vi Editor
An Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
Lab Working with Linux Command Line
Introduction In this lab, you will use the Linux command line to manage files and folders and perform some basic administrative tasks. Recommended Equipment A computer with a Linux OS, either installed
Linux Command Line Primer. By: Scott Marshall
Linux Command Line Primer By: Scott Marshall Draft: 10/21/2007 Table of Contents Topic Page(s) Preface 1 General Filesystem Background Information 2 General Filesystem Commands 2 Working with Files and
On successful completion of the course, the students will be able to attain CO: Experiment linked. 2 to 4. 5 to 8. 9 to 12.
CIE- 25 Marks Government of Karnataka Department of Technical Education Bengaluru Course Title: Linux Lab Scheme (L:T:P) : 0:2:4 Total Contact Hours: 78 Type of Course: Tutorial, Practical s & Student