Contents. Making Sense of Statistics 00 Getting Personal: Factors that Modify Your Risk 00 It s a Numbers Game 00
|
|
- Wendy Dawson
- 5 years ago
- Views:
Transcription
1 Recto Runninghead v Contents Foreword by Mark H. Greene, M.D. 00 Acknowledgments 00 Introduction 00 Part I. Understanding Cancer, Genetics, and Risk Chapter 1. Breast and Ovarian Cancer Basics 3 Most Cancers Aren t Hereditary 00 An Introduction to Breast Cancer 00 An Introduction to Ovarian Cancer 00 Other Hereditary Cancers 00 Chapter 2. A Peek Inside: Your Genes at Work 00 The Evolution of Genetic Discovery: From Peas to BRCA 00 Your Genetic ABCs... and a D 00 Mutations: Spelling Errors in Your DNA Cookbook 00 How Mutations Lead to Cancer 00 What s So Special about BRCA? 00 Chapter 3. Defining Risk 00 Making Sense of Statistics 00 Getting Personal: Factors that Modify Your Risk 00 It s a Numbers Game Friedman first pages 000i-0xx.indd 5 9/8/11 3:56:57 PM
2 vi verso runninghead contents Chapter 4. Hereditary Cancer: What s Swimming in Your Gene Pool? 00 Hidden Risk in the Family Tree 00 HBOC and Other Hereditary Cancer Syndromes 00 Plotting Your Genetic Pedigree 00 Part Ii. Assessing Your Risk Chapter 5. Genetic Counseling 00 The Value of Counseling 00 What to Expect from the Process 00 Why You Need an Expert to Unravel Your Genetic History 00 Deciding Who Should Test First 00 Chapter 6. Genetic Testing: Facing Your Hereditary Horoscope 00 Which Test Is Right for You? 00 Testing: Powerful, Yet Imperfect 00 Issues for Survivors and Women in Treatment 00 Chapter 7. Decoding Your Test Results 00 Life, Interrupted: It s Positive 00 Good News! You re a True Negative 00 When No Might Mean Maybe 00 Genetic Variants 00 Now What? Implications for You and Your Family 00 Part Iii. Managing Your Risk: Your DNA Doesn t Have to Be Your Destiny Chapter 8. Early Detection Strategies 00 High-Risk Surveillance for Breast Cancer 00 High-Risk Surveillance for Ovarian Cancer 00 Is It Cancer? 00 Screening for Other Hereditary Cancers Friedman first pages 000i-0xx.indd 6 9/8/11 3:56:57 PM
3 Recto Contents Runninghead vii Chapter 9. Chemoprevention 00 Risk-Reducing Medications for Breast Cancer 00 Alternatives under Study 00 Chemoprevention for Ovarian Cancer 00 Chapter 10. Mastectomy for Risk Reduction and Treatment 00 Reducing Cancer Risk by Removing the Breasts 00 Skin-Sparing Procedures 00 Treating Breast Cancer with Mastectomy 00 Who Should Perform Your Surgery? 00 Risks and Recovery 00 Chapter 11. Reconstruction: New Breasts after Mastectomy 00 Delaying Reconstruction to Complete Breast Cancer Treatment 00 Living with a Flat Chest 00 Saline and Silicone Implants 00 Options for Using Your Own Tissue 00 Optional Last Steps: Adding Nipples and Areolas 00 Great Expectations: Surgery and Recovery 00 Choosing the Right Surgeon 00 Chapter 12. Oophorectomy and Other Risk-Reducing Gynecologic Surgeries 00 Oophorectomy Procedures 00 Should You Have a Hysterectomy Too? 00 Oophorectomy, Mastectomy: Either, Neither, or Both? 00 Issues for Breast Cancer Survivors 00 Chapter 13. Dealing with Menopause and Quality-of-Life Issues 00 Symptoms of Surgical Menopause 00 Long-Term Side Effects 00 Should You Take Hormones? 00 Issues for Breast Cancer Survivors Friedman first pages 000i-0xx.indd 7 9/8/11 3:56:57 PM
4 viii verso runninghead contents Part Iv. Living with BRCA: Issues and Answers Chapter 14. Managing Lifestyle Choices 00 The Three-Legged Stool: Nutrition, Weight, and Physical Activity 00 Alcohol: An Unwise Choice 00 Other Lifestyle Risk Factors 00 Chapter 15. Sharing Information with Friends, Family, and Coworkers 00 Sharing Risk and Genetic Testing Information with Family 00 Issues for Spouses, Partners, and People You Date 00 What Should You Tell Employers and Coworkers? 00 Chapter 16. Young and at High Risk 00 Should You Consider Testing Now? 00 Diagnostic Difficulties 00 Dealing with a Diagnosis before Menopause 00 Planning Your Family, Preserving Your Fertility 00 Oophorectomy in Young Women 00 Sorting through Emotions 00 Chapter 17. How BRCA Affects Men 00 Men Get Breast Cancer Too 00 High Risk for Prostate Cancer 00 Other BRCA-Related Cancers 00 Chapter 18. Diagnosis: Hereditary Cancer 00 How Important Is a Second Opinion? 00 Treating Hereditary Cancers 00 Making Breast Cancer Treatment Decisions 00 Ovarian Cancer Issues 00 The Importance of Clinical Trials Friedman first pages 000i-0xx.indd 8 9/8/11 3:56:58 PM
5 Contents Recto Runninghead ix Chapter 19. Putting the Pieces Together to Make Difficult Decisions 00 Start at the Beginning: Should You Be Tested? 00 Making Decisions to Reduce Your Risk 00 Making Decisions about Treatment 00 From Confused to Clear in Fifteen Steps 00 Notes 00 Index Friedman first pages 000i-0xx.indd 9 9/8/11 3:56:58 PM
Breast Curvature of the Upper and Lower Breast Mound: 3D Analysis of Patients who Underwent Breast Reconstruction
Breast Curvature of the Upper and Lower Breast Mound: 3D Analysis of Patients who Underwent Breast Reconstruction Juhun LEE a,b, Gregory P. REECE b, Mia K. MARKEY a,b* a The University of Texas at Austin,
More informationMR-Guided Mixed Reality for Breast Conserving Surgical Planning
MR-Guided Mixed Reality for Breast Conserving Surgical Planning Suba Srinivasan (subashini7@gmail.com) March 30 th 2017 Mentors: Prof. Brian A. Hargreaves, Prof. Bruce L. Daniel MEDICINE MRI Guided Mixed
More informationGuide for New Us TOO Prostate Cancer Support Community Members
Guide for New Us TOO Prostate Cancer Support Community Members Why the option? Inspire is a leader in building safe and secure online health communities and does so at no charge when they partner with
More information2. Take a few minutes to look around the site. The goal is to familiarize yourself with a few key components of the NCBI.
2 Navigating the NCBI Instructions Aim: To become familiar with the resources available at the National Center for Bioinformatics (NCBI) and the search engine Entrez. Instructions: Write the answers to
More informationThis study is brought to you courtesy of.
This study is brought to you courtesy of www.google.com/think/insights Health Consumer Study The Role of Digital in Patients Healthcare Actions & Decisions Google/OTX U.S., December 2009 Background Demonstrate
More informationQUICK START GUIDE. A Publication of
QUICK START GUIDE Quickly identify patients in less than 30 seconds Available on all devices Immediately provides a result when one red flag is indicated in the patient s history Links to clinical guidelines
More informationDONE! You can now close the browser.
Visit My Doctor Online at kp.org/mydoctor. Prepare for your visit This form will help you prepare for your upcoming visit with your doctor. You can complete it on your computer (Mac or PC) and e-mail it
More informationTowards a Case-Based Reasoning System for Predicting Aesthetic Outcomes of Breast Reconstruction
Abstract Towards a Case-Based Reasoning System for Predicting Aesthetic Outcomes of Breast Reconstruction Juhun LEE a,b, Clement S. SUN a,b, Gregory P. REECE b, Michelle C. FINGERET b, Mia K. MARKEY a,b*
More informationSimulation Studies for Predicting Surgical Outcomes in Breast Reconstructive Surgery
Simulation Studies for Predicting Surgical Outcomes in Breast Reconstructive Surgery Celeste Williams 1, Ioannis A. Kakadaris 1, K. Ravi-Chandar 2, Michael J. Miller 3, and Charles W. Patrick 3 1 Visual
More informationThe Chest Wall Center at Cincinnati Children s Patient Questionnaire
Today s Date Patient Name First Middle Last Date of Birth Age Home Phone Cell Work Email(s) Address(es) Primary Care Doctor (PCP) PCP S Address Street Address City State Zip PCP S Phone Number Which surgeon
More informationA fast breast nonlinear elastography reconstruction technique using the Veronda-Westman model
A fast breast nonlinear elastography reconstruction technique using the Veronda-Westman model Mohammadhosein Amooshahi a and Abbas Samani abc a Department of Electrical & Computer Engineering, University
More informationModules. This chapter lists and describes the major modules or applications that aggregate specific functionality and all together compose the System.
Modules COM. Common Functionality EXS. Expert System IMA. Image Archive SCS. Skin Cancer Tools This chapter lists and describes the major modules or applications that aggregate specific functionality and
More informationMHealth - The Future of Mental Health Care
MHealth - The Future of Mental Health Care MHealth - The future of mental health care Technology is becoming more pervasive According to Gartner: In 2015 smartphone sales reached [2] 1.4 billion units
More informationincludes the archived video and post test.
Updated on 11.13.2018 *Please note for these archived webinars you have to complete the curriculum ( includes the archived video and post test. ) to get CEU accreditation. The curriculum Assertive Community
More informationIVDR Breakout. Copyright 2017 BSI. All rights reserved.
IVDR Breakout 1 IVDR Classification and conformity assessment 2 Classification- IVDR 3 Classification of IVDs Re-classification of IVDs will mean 80-90 % will no longer be able to self certify conformity
More informationUsability Testing. November 9, 2016
Usability Testing November 9, 2016 Announcements Milestone III Average: 77/90 (86%) Most marks lost for not following instructions (e.g. missing sections) 2 Questions? 3 Today More analytical evaluation
More informationSpecialty Services Requests. Referrals
Referral Submission Specialty Services Requests Referrals Request Categories Specialty Outpatient Admission ALL physician office services Clinic Visits, Consults, Follow Up Visits, Testing Procedures,
More informationHematology Oncology Associate of Central New York Medical History
Hematology Oncology Associate of Central New York Medical History Name: Date: Male Female Age: Consult Date: Reason for today s visit: Referring Doctor: Primary Care Doctor: Surgeon & Other Doctors: Medical
More informationPlease complete this colorectal cancer test kit! You do the kit in your own home.
Please complete this colorectal cancer test kit! You do the kit in your own home. What is Colorectal Cancer? Colorectal cancer is cancer in the colon or rectum. In most people, colon cancer develops slowly
More informationClassification and regulation of software
Classification and regulation of software Ciara Farrell, Arthur Cox 5 October 2017 Medtec Ireland 2017 2 Law cannot keep up! 3 Legal issues Regulation as medical devices Privacy and cybersecurity Licensing
More informationincludes the archived video and post-test.
Updated on 9.08.2017 *Please note for these archived webinars - you have to complete the curriculum ( includes the archived video and post-test. ) to get CEU accreditation. The curriculum CPI ONLINE COURSES-
More informationincludes the archived video and post test.
Updated on 10.02.2017 *Please note for these archived webinars you have to complete the curriculum ( includes the archived video and post test. ) to get CEU accreditation. The curriculum CPI ONLINE COURSES
More informationAre mobile phones dangerous?
Are mobile phones dangerous? All the independently-funded studies that included long term users have found an association between mobile phone use and an increased risk of brain tumours amongst adults
More informationHEALTH HISTORY QUESTIONNAIRE
L 3/11 Page 1 HEALTH HISTORY QUESTIONNAIRE NAME: DATE: HOME ADDRESS: HOME PHONE: WORK PHONE: CELL PHONE: OTHER PHONE: EMPLOYER: OCCUPATION: EXPLAIN YOUR JOB DUTIES: DATE OF BIRTH: SEX: MALE /FEMALE SS#
More informationHEREDITARY COLORECTAL CANCER: INFORMATION-BASED APPROACH. Elena Manilich. Submitted in partial fulfillment of the requirements
!!!! HEREDITARY COLORECTAL CANCER: INFORMATION-BASED APPROACH By Elena Manilich Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Adviser: Dr. Z.
More informationBARD CLOSED WOUND DRAINAGE
BARD CLOSED WOUND DRAINAGE CLOSED WOUND SUCTION GRAVITY DRAINS SUMP DRAINS Reference Guide - Advancing Lives and the Delivery of Healthcare What Is a Wound? A wound drain is typically a plastic tube that
More informationBreast NSSG Leads Meeting. Effective MDT Work Programme & Going Further On Cancer Waits. 26 April 2010
Breast NSSG Leads Meeting Effective MDT Work Programme & Going Further On Cancer Waits 26 April 2010 Cheryl Cavanagh National Cancer Action Team MDT Development Work Programme What Will Be Covered? Brief
More informationRegulatory Aspects of Digital Healthcare Solutions
Regulatory Aspects of Digital Healthcare Solutions TÜV SÜD Product Service GmbH Dr. Markus Siebert Rev. 02 / 2017 02.05.2017 TÜV SÜD Product Service GmbH Slide 1 Contents Digital solutions as Medical Device
More informationCochrane Database of Systematic Reviews (Cochrane Reviews)
WHAT IS THE COCHRANE LIBRARY?... 1 MAIN DATABASES... 1 ACCESS... 1 SEARCH... 1 ADVANCED SEARCH TIPS... 2 COMPOSE A SEARCH... 3 SEARCH USING KEYWORDS... 3 SEARCH USING THESAURUS (MESH)... 3 SEARCH MANAGER...
More informationPlease print all information in the spaces provided. Be sure to complete and sign the statement on the bottom of this form. Last Name First Name M.I.
916-423-2124 916-423-2127 fax gastroconsultantsmedgrp.com Patient Information Form Thomas J. Imperato, M.D. John T. Hata, M.D. Rekha Cheruvattath, M.D. Please print all information in the spaces provided.
More informationWhere Did My Files Go? How to find your files using Windows 10
Where Did My Files Go? How to find your files using Windows 10 Have you just upgraded to Windows 10? Are you finding it difficult to find your files? Are you asking yourself Where did My Computer or My
More informationVenn Diagrams and Boolean Operations
Venn Diagrams and Boolean Operations Historical Notes: George Boole and John Venn were 19th century mathematicians. George Boole developed what became known as Boolean algebra or Boolean logic. Boole's
More informationCell Phones: Do Concerns Outweigh the Benefits? As cell phone usage rates continue to sky-rocket higher and higher each year, more concerns are
Student s Last Name 1 Student Name Mrs. Gosselin/Mr. Palin Introduction to Computers November 10, 2010 Cell Phones: Do Concerns Outweigh the Benefits? As cell phone usage rates continue to sky-rocket higher
More informationCopyright 2018 by Boston Scientific, Inc.. Permission granted to INCOSE to publish and use. #hwgsec
Balancing Safety, Security and Usability in the Design of Secure Medical Devices Ken Hoyme Director, Product Security Boston Scientific Ken.hoyme@bsci.com Copyright 2018 by Boston Scientific, Inc.. Permission
More informationAxis Three Guide. Torso Scan and Simulation Steps. Instructions to torso scans and simulations
Axis Three Guide Torso Scan and Simulation Steps Instructions to torso scans and simulations Axis Three Torso Scan Guide I. Open Axis Three software icon to Home Screen II. Open Patient s Tab from Menu
More informationNEW PATIENT HISTORY FORM. Name: Main Reasons for coming to the office: Duration of Problem (when did it first start?):
NEW PATIENT HISTORY FORM Main Reasons for coming to the office: Location of Problem(s): Please briefly describe the problem(s): How severe is your problem (please circle): Duration of Problem (when did
More informationk-nn Disgnosing Breast Cancer
k-nn Disgnosing Breast Cancer Prof. Eric A. Suess February 4, 2019 Example Breast cancer screening allows the disease to be diagnosed and treated prior to it causing noticeable symptoms. The process of
More informationEBSCO Publishing Health Library Editorial Policy
EBSCO Publishing Health Library Editorial Policy Introduction EBSCO Publishing is a leader in publishing health and medical information on the Internet. While we make every effort to ensure that our content
More informationCAMERA DRIVING SYSTEMS, OPTIMAL FEATURES AND EVOLUTIONS
CAMERA DRIVING SYSTEMS, OPTIMAL FEATURES AND EVOLUTIONS Marco Maria Lirici EAES Technology Symposium Basic and Advanced Instrument for Daily Laparoscopic Practice Athens, July 4, 2007 RATIONALE Shortage
More informationDouble Sort Algorithm Resulting in Reference Set of the Desired Size
Biocybernetics and Biomedical Engineering 2008, Volume 28, Number 4, pp. 43 50 Double Sort Algorithm Resulting in Reference Set of the Desired Size MARCIN RANISZEWSKI* Technical University of Łódź, Computer
More informationPrivacy Notice. General Information Protection Regulation ( GDPR )
Privacy Notice General Information Protection Regulation ( GDPR ) Please read the following information carefully. This privacy notice contains information about the information collected, stored and otherwise
More informationPlease do not leave anything blank. If something does not apply please put N/A.
Name: _ Date of Birth Date Please describe the reason for your visit. Include Symptoms, duration, location, and severity: Select any of the following medical conditions that you currently have: Anxiety
More informationSystem Requirements: Safari Android Web Browser
System Requirements: American College of Osteopathic Obstetricians andgynecologists (Back to Links) The SCS elogs App can run on any handheld device with a web browser that supports HTML5 local database
More informationThe default search covers title, abstract and keywords, but click on the drop down box to choose other criteria including author or source.
Library Guide How to use the Cochrane Library The Cochrane library is the main output of the Cochrane Collaboration and aims to bring together in one place reliable information about the effects of health
More informationConsultation document: Summary of Clinical Trial Results for Laypersons
SANTE-B4-GL-results-laypersons@ec.europa.eu Consultation document: Summary of Clinical Trial Results for Laypersons Professor DK Theo Raynor, University of Leeds d.k.raynor@leeds.ac.uk This is my response
More informationSemen fertility prediction based on lifestyle factors
Koskas Florence CS 229 Guyon Axel 12/12/2014 Buratti Yoann Semen fertility prediction based on lifestyle factors 1 Introduction Although many people still think of infertility as a "woman s problem," in
More informationSCCAP. User Guide: Version 198
SCCAP User Guide: Version 198 Table of Contents Introduction 3 CHAPTER 1 I. The Welcome Screen 4 II. The Load or Create Case Screen 5 III. Logging onto a Server 6 IV. Creating the Code Template 7 V. Creating
More informationModeling for Plastic and Reconstructive Breast Surgery
Modeling for Plastic and Reconstructive Breast Surgery David T. Chen 1, Ioannis A. Kakadiaris 1, Michael J. Miller 2, R. Bowen Loftin 1, and Charles Patrick 2 1 Virtual Environments Research Institute
More informationEvolutionary Robotics. CSCI 250 Spring 2017
Evolutionary Robotics CSCI 250 Spring 2017 Why Is Robotics So Difficult? Why Is Robotics So Difficult? Pollack, Lipson, Hornby, & Funes (2001): We propose that both the morphology and the controller should
More informationGCA Comfort Guarantee
GCA Comfort Guarantee Introduction Nagor is a world leader in the manufacture of breast implants. We are committed to innovation and scientific research. Our breast implants are manufactured entirely in
More informationApple Heart Study. e PATCH QUICK START GUIDE
Apple Heart Study e PATCH QUICK START GUIDE KIT CONTENTS 1. 2. 3. 1. Sensor 2. Electrode Patch 3. Quick Start Guide 4. Skin Prep Kit 5. Return Mailer 4. 5. ABOUT THE APPLE HEART STUDY The Apple Heart Study
More informationGUADALUPE ENT, P.A. JENNIFER G. HENNESSEE, M.D. MAANSI DOSHI, D.O. LISA M. WRIGHT, PA
GUADALUPE ENT, P.A. JENNIFER G. HENNESSEE, M.D. MAANSI DOSHI, D.O. LISA M. WRIGHT, PA Patient Profile Last Name First Name Middle Name of Birth Gender Social Security Number Marital Status Email Race Ethnic
More informationMass Classification Method in Mammogram Using Fuzzy K-Nearest Neighbour Equality
Mass Classification Method in Mammogram Using Fuzzy K-Nearest Neighbour Equality Abstract: Mass classification of objects is an important area of research and application in a variety of fields. In this
More informationTITLE: Electrical Impedance Imaging for Early Detection of Breast Cancer for Young Women
AD Award Number: W81XWH-12-C-0236 TITLE: Electrical Impedance Imaging for Early Detection of Breast Cancer for Young Women PRINCIPAL INVESTIGATOR: Alexander Stojadinovic CONTRACTING ORGANIZATION: The Henry
More informationEHR Go Guide: The Problems Tab
EHR Go Guide: The Problems Tab Introduction The Problems tab in the EHR is where the patient s problems, procedures, and diagnosis are documented and can provide a quick summary of the patient s history
More informationIntelligent Automation Can You Trust Robots to Perform Your Surgery?
Intelligent Automation Can You Trust Robots to Perform Your Surgery? Copyright 2016 Axiomtek Co., Ltd. All Rights Reserved Background Will you be receptive to having a robot perform a surgery on you? The
More informationi2b2 User Guide University of Minnesota Clinical and Translational Science Institute
Clinical and Translational Science Institute i2b2 User Guide i2b2 is a tool for discovering research cohorts using existing, de-identified, clinical data This guide is provided by the Office of Biomedical
More informationIEC-I Re-registration. ECR/229/lnst./MH/2013/RR-16,IEC-II registration. If additional collaborators attach details and letter of consent by the collab
IEC-I Re-registration. ECR/229/lnst./MH/2013/RR-16,IEC-II registration. Please fill in the details in legible hand writing Annexure 1-B AX 1-B/SOP 05/V5 Project submission application form for initial
More informationFrequently Asked Questions
Frequently Asked Questions What is FollowMyHealth? FollowMyHealth offers you personalized and secure online access to important information in your electronic medical record. FollowMyHealth is available
More informationMed-Info. Council Directive 93/42/EEC on Medical Devices. TÜV SÜD Product Service GmbH
Med-Info International expert information for the Medical Device industry Council Directive 93/42/E on Medical Devices Practice-oriented summary of the most important aspects and requirements contained
More informationQuestionnaire 3. (only to be filled out when submitting blood and stool sample) This box will be filled out by the practice team
Questionnaire 3 (only to be filled out when submitting blood and stool sample) Date This box will be filled out by the practice team Patient-ID Barcode on labels Dear participant, We are pleased that you
More informationEye (or eyes) to be treated: Right eye Left eye
YAG laser capsulotomy surgery Informed consent document This is a legal document. You need to sign it to give the surgeon written permisson to treat you. It is important that you bring this document with
More informationTrees & Tree-Based Data Structures. Part 4: Heaps. Definition. Example. Properties. Example Min-Heap. Definition
Trees & Tree-Based Data Structures Dr. Christopher M. Bourke cbourke@cse.unl.edu Part 4: Heaps Definition Definition A (max) heap is a binary tree of depth d that satisfies the following properties. 1.
More informationNAACCR Standards for Cancer Registries, Volume II Version 13
RX Text-BRM [2660], RX Text-Chemo [2640], RX Text-Hormone [2650], RX Text-Other [2670], RX Text-Radiation (Beam) [2620], RX Text-Radiation Other [2630], and RX Text- Surgery [2610] RX TEXT--BRM Alternate
More informationFEATURE EXTRACTION FROM MAMMOGRAPHIC MASS SHAPES AND DEVELOPMENT OF A MAMMOGRAM DATABASE
FEATURE EXTRACTION FROM MAMMOGRAPHIC MASS SHAPES AND DEVELOPMENT OF A MAMMOGRAM DATABASE G. ERTAŞ 1, H. Ö. GÜLÇÜR 1, E. ARIBAL, A. SEMİZ 1 Institute of Biomedical Engineering, Bogazici University, Istanbul,
More informationMed-Info. Council Directive 93/42/EEC on medical devices. TÜV SÜD Product Service GmbH
Med-Info International expert information for the medical device industry Council Directive 93/42/E on medical devices Practice-oriented summary of the most important aspects and requirements contained
More informationFEATURE EXTRACTION TECHNIQUES USING SUPPORT VECTOR MACHINES IN DISEASE PREDICTION
FEATURE EXTRACTION TECHNIQUES USING SUPPORT VECTOR MACHINES IN DISEASE PREDICTION Sandeep Kaur 1, Dr. Sheetal Kalra 2 1,2 Computer Science Department, Guru Nanak Dev University RC, Jalandhar(India) ABSTRACT
More informationBreast volume calculation using a low-cost scanning system
Breast volume calculation using a low-cost scanning system Simon B. CHOPPIN* a, Heidi PROBST b, Amit GOYAL c, Sean CLARKSON a, Jonathan WHEAT a a Centre for Sports Engineering Research, Sheffield Hallam
More informationG-TACT User Guide Ensuring Accurate Classification of BRCA Variants Module: RUN 1
G-TACT User Guide Ensuring Accurate Classification of BRCA Variants Module: RUN 1 Description The G-TACT User Guide provides assistance to users in all aspects of using the Ensuring Accurate Classification
More informationSalman Ahmed.G* et al. /International Journal of Pharmacy & Technology
ISSN: 0975-766X CODEN: IJPTFI Available Online through Research Article www.ijptonline.com A FRAMEWORK FOR CLASSIFICATION OF MEDICAL DATA USING BIJECTIVE SOFT SET Salman Ahmed.G* Research Scholar M. Tech
More informationComputer Aided Diagnosis Based on Medical Image Processing and Artificial Intelligence Methods
International Journal of Information and Computation Technology. ISSN 0974-2239 Volume 3, Number 9 (2013), pp. 887-892 International Research Publications House http://www. irphouse.com /ijict.htm Computer
More informationOptimization in Brachytherapy. Gary A. Ezzell, Ph.D. Mayo Clinic Scottsdale
Optimization in Brachytherapy Gary A. Ezzell, Ph.D. Mayo Clinic Scottsdale Outline General concepts of optimization Classes of optimization techniques Concepts underlying some commonly available methods
More informationYOU MUST COMPLETE THE FOLLOWING FORM IN ITS ENTIRETY PRIOR TO YOUR APPOINTMENT. VIA OUR SECURE 2. FAX:
North Shore Gastroenterology Associates, P.C. 233 E. Shore Rd., Suite 101 Great Neck, NY 11023 Phone: 516-487-2444 Fax: 516-487-2446 www.northshoregastro.com YOU MUST COMPLETE THE FOLLOWING FORM IN ITS
More informationJoint CI-JAI advanced accelerator lecture series Imaging and detectors for medical physics Lecture 1: Medical imaging
Joint CI-JAI advanced accelerator lecture series Imaging and detectors for medical physics Lecture 1: Medical imaging Dr Barbara Camanzi barbara.camanzi@stfc.ac.uk Course layout Day AM 09.30 11.00 PM 15.30
More informationOlympia Family Medicine 5949 Harbour Park Drive Midlothian, VA 23112
Olympia Family Medicine 5949 Harbour Park Drive Midlothian, VA 23112 Patient Registration Date Name DOB Age SSN Sex: M F Address City State Zip Code Home Phone # Cell Phone # Work Phone Occupation Employer
More informationMed-Info. Council Directive 93/42/EEC on medical devices. TÜV SÜD Product Service GmbH
Med-Info International expert information for the medical device industry Council Directive 93/42/E on medical devices Practice-oriented summary of the most important aspects and requirements contained
More informationBiomet PMI. Patient-Matched Implants. CT Protocols
CT Protocols One Surgeon. One Patient. Over 1 million times per year, Biomet helps one surgeon provide personalized care to one patient. The science and art of medical care is to provide the right solution
More informationhydrogel competence self-inflating tissue expander
hydrogel competence self-inflating tissue expander One concept for various indications Head Eye Mouth Trunk Extremity Indications for use Alopecia Anophthalmia Breast reconstruction Breast deformities
More informationHIPAA For Assisted Living WALA iii
Table of Contents The Wisconsin Assisted Living Association... ix Mission... ix Vision... ix Values... ix Acknowledgments... ix Who Should Use This Manual... x How to Use This Manual... x Updates and Forms...
More informationSearching PubMed. Enter your concepts into the search box and click Search. Your results are displayed below the search box.
Searching PubMed UCL Library Services, Gower St., London WC1E 6BT 020 7679 7700 E-mail: library@ucl.ac.uk http://www.ucl.ac.uk/library/ 1. What is PubMed? http://www.pubmed.gov PubMed is a free interface
More informationSkyware Systems Release Notes 8/9/16 Page 1 of 6
System Release Notes Release Date: Aug, 2016 Skyware Release Notes Here are the MANY great ideas you ve given us to make the system better! I. New Quick Quote Screen! Skyware has a new Quick Quote screen
More informationClassification by Support Vector Machines
Classification by Support Vector Machines Florian Markowetz Max-Planck-Institute for Molecular Genetics Computational Molecular Biology Berlin Practical DNA Microarray Analysis 2003 1 Overview I II III
More informationMessage Over the Medium: Communication Loops in the CMMI
Message Over the Medium: Communication Loops in the CMMI First Things First Elements of communication Elements of Communication ping acknowledge/non-acknowledge media Sender context Receiver context Elements
More informationCures from your Kitchen Cupboards: Better Health at your Fingertips
Module One Cures from your Kitchen Cupboards: Better Health at your Fingertips Herbcraft Academy www.herbcraft.info www.melaniecardwell.com Module One Workbook This module we have taken a look at the Basics
More informationFIGURE 1. The updated PubMed format displays the Features bar as file tabs. A default Review limit is applied to all searches of PubMed. Select Englis
CONCISE NEW TOOLS AND REVIEW FEATURES OF FOR PUBMED CLINICIANS Clinicians Guide to New Tools and Features of PubMed DENISE M. DUPRAS, MD, PHD, AND JON O. EBBERT, MD, MSC Practicing clinicians need to have
More informationLife Sensing Technology LIFELOG. v1.0 EN Effective From 5 October 2016
Life Sensing Technology LIFELOG v1.0 EN Effective From 5 October 2016 1 LIFELOG Everyday thousands and thousands of locations, itineraries, heart rates, blood pressure values, breath rates, ecg videos,
More informationPROSTATE CANCER SUPPORT GROUP - ACT REGION INC. OUR WEB SITE
PROSTATE CANCER SUPPORT GROUP - ACT REGION INC. OUR WEB SITE 1 GROUP'S OBJECTIVES / MISSION -1 Promote awareness, testing and early detection of PCa Provide information and information sources for: risk
More informationProgeny 10. Patients Dashboard Quick Start Guide
Progeny 10 Patients Dashboard Quick Start Guide This quick start guide will allow users to follow a list of topics to learn how to use Progeny Clinical application through your web browser. The Table of
More information810 nm. 980 nm FOX nm 12 W VERSATILE FOX 810/980/ 1064/1470 nm IDEAL FOR: DENTAL ENT DERMATOLOGY GYNECOLOGY SURGERY / VET.
810 1064 980 12 W 980 VERSATILE 810/980/ 1064/1470 IDEAL FOR: DENTAL ENT DERMATOLOGY GYNECOLOGY SURGERY / VET www.arclaser.com PRECISION & PERFECTION CALIBRATION at the distal tip of the fiber = safe and
More informationWebsite:
Kizlon Medical Email: info@kizlonmedical.com Website: www.kizlonmedical.com Digital Video Colposcope KDC-A1 series KDC-A100 colposcope with its software specifically designed to take high resolution pictures
More informationMachine Learning. Computational biology: Sequence alignment and profile HMMs
10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth
More informationSoftware Development and Usability Testing
Software Development and Usability Testing Shneiderman, Chapter 4 Preece et al, Ch 9, 11-15 Krug, Rocket Surgery Made Easy Rubin, Handbook of Usability Testing Norman Neilsen Group www HCI in Software
More informationLast updated May 2018
Last updated May 2018 All inpatient stays require authorization All provided by non-contracted providers require pre-authorization SoCO/NoCO (POS 11) - For contracted providers in office specialty do not
More informationSoftware Vulnerability
Software Vulnerability Refers to a weakness in a system allowing an attacker to violate the integrity, confidentiality, access control, availability, consistency or audit mechanism of the system or the
More information2006 Community Connection and MO Go Local Statistics Report date: 04/15/06
2006 Community Connection and MO Go Local Statistics Statistic Apr May Jun (visits) 19,042 27,675 32,730 Community Connection unique visitors 8,489 14,054 18,920 Page views from MedlinePlus (visits) 1,194
More information"MATERIAL SAFETY DATA SHEETS: THE ANSI STANDARD"
MAJOR PROGRAM POINTS "MATERIAL SAFETY DATA SHEETS: THE ANSI STANDARD" Part of the "GENERAL SAFETY SERIES" Quality Safety and Health Products, for Today... and Tomorrow Outline of Major Points Covered in
More informationLast updated March 2019
Last updated March 2019 All inpatient stays require authorization All provided by non-contracted providers require pre-authorization SoCO/NoCO (POS 11) - For contracted providers in office specialty do
More informationHigh Throughput Computing and Sampling Issues for Optimization in Radiotherapy
High Throughput Computing and Sampling Issues for Optimization in Radiotherapy Michael C. Ferris, University of Wisconsin Alexander Meeraus, GAMS Development Corporation Optimization Days, Montreal, May
More informationUsability Testing. November 14, 2016
Usability Testing November 14, 2016 Announcements Wednesday: HCI in industry VW: December 1 (no matter what) 2 Questions? 3 Today Usability testing Data collection and analysis 4 Usability test A usability
More informationVisualizing NCI Seer Cancer Data
Visualizing NCI Seer Cancer Data Sandro Fouché Thursday, March 3, 2005 CMSC 838s Introduction I chose to use the National Cancer Institute s Surveillance, Epidemiology and End Results (NCI SEER) database
More information