NGS Data Analysis. Roberto Preste
|
|
- Ira Ferguson
- 5 years ago
- Views:
Transcription
1 NGS Data Analysis Roberto Preste 1
2 Useful info Contacts: Slides: 2
3 NGS data analysis Overview 3
4 NGS Data Analysis: the basic idea 4
5 NGS Data Analysis: the actual workflow Preprocessing & Mapping Variant discovery Functional annotation 5
6 NGS data analysis Quality check & preprocessing 6
7 Fasta files >J Homo sapiens mitochondrion, complete genome GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATC ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA Both human- and machine-readable Can store multiple sequences ID can contain details or comments Usually contains full genomes or long sequence chunks Sequence ID Sequence 7
8 Fastq Sequence ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + Sequence Spacer!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCC420 Both human- and machine-readable Can store multiple sequences ID can contain sequencing details and technical info Usually contains short sequence chunks (sequencing reads) Quality Score 8
9 Quality score Phred quality score: estimated probability of an error in base calling Probability that the base call is incorrect usually [0-40] Encoded using ASCII characters in fastq files: Quality score Probability of errors ASCII encoding 0-9 1! #$%& ()* /10 +,-./ / :;<=> /10000 I 9
10 Quality GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCC Quality score Probability of errors ASCII encoding 0-9 1! #$%& ()* /10 +,-./ / :;<=> /1000?@ABCDEFGH 40 1/10000 I
11 Quality check FastQC: visual report of several quality checks for NGS data, useful for further processing Different modules = different checks Pass Warning Fail 11
12 FastQC modules 12
13 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters 13
14 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters cut low quality bases from both ends 14
15 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters cut low quality bases from both ends drop short reads 15
16 Preprocessing Cleansing of reads to solve several issues: remove adapters Common tools: cut low quality bases from both ends drop short reads Trimmomatic Trim Galore! FASTX 16
17 Post-processing quality check Was the processing effective? Are these data ready to be aligned? 17
18 NGS data analysis Alignment 18
19 Alignment vs Assembly Alignment (reference-based) reference genome available reads aligned on it Assembly (de-novo) reference genome not available reads aligned with each other..gtgacttagtcgtagctagctagtagctcgatctaga.. GTGACTTAGT GCTAGCTAGT AGTTAGTCGT GTGACTTAGT GAGTTAGTCG CTTAGTCGTA TAGTCGTAGC TAGTAGCTCG GTAGCTCGAT GTAGCTCGAT TCGTAGCTAG TGAGTTAGCC CGATCTAGA AGCTCGACCT AGCTAGTAGC AGCTCGACCT CTCGACCTAG..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. 19
20 Alignment..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. GTGACTTAGT GAGTTAGTCG Reference genome TAGTAGCTCG GTAGCTCGAT CTTAGTCGTA TAGTCGTAGC Reads AGCTCGACCT CTCGACCTAG Common aligners: BWA Bowtie GMAP/GSNAP 20
21 Assembly GTGACTTAGT GCTAGCTAGT AGTTAGTCGT CGATCTAGA GTAGCTCGAT Reads TCGTAGCTAG TGAGTTAGCC AGCTCGACCT AGCTAGTAGC..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. Common approaches: greedy algorithm graph method Consensus sequence Common assemblers: Newbler SPAdes MaSuRCA 21
22 Paired-end vs single-end reads Suitable for most applications Cheaper Faster Easy to identify read position in genome High accuracy for structural rearrangements and assembly of repetitive regions More expensive 22
23 SAM/BAM files Text-based format used to store aligned reads (to a reference genome) Header Alignments SAM (Sequence Alignment Map) Both human- and machine-readable Header section contains TAG:VALUE pairs Alignment section contains 11 mandatory fields BAM (Binary Alignment Map) Compressed version of SAM Binary format Only machine-readable 23
24 SAM files TAG:VALUE pairs Record type header line reference sequence VN: version number SN: reference sequence name SO: alignments sorting order LN: reference sequence length 24
25 SAM files QNAME MAPQ POS SEQ CIGAR 25
26 Alignment quality check Integrative Genomics Viewer (IGV) Interactive visualization of NGS data from Fasta, SAM, BAM, VCF files Additional features are organized in tracks (gene expression, methylation, copy number variations...) 26
27 NGS data analysis Variant calling 27
28 Variations Aligned data can be used to assess the presence of mutations: somatic germline 28
29 Variations Most common variations searched for: Variation type Reference ACTGACGCATGCATCATGCATGC SNP ACTGACGCATGCATCATTCATGC Insertion ACTGACGCATGGTACATCATGCATGC Deletion ACTGACGC--GCATCATGCATGC Variation effect 29
30 Variant callers A plethora of different tools, each with its own peculiarities: variation type (SNV vs structural variation) source (somatic vs cancer mutations) only detect variants vs also predict their effect Variant Call Format (VCF) 30
31 VCF files Header (information and metadata) Variants Variant annotations Genotype annotations 31
32 VCF files Mandatory fields: ALT: alternative base(s) #CHROM: chromosome or contig QUAL: Phred quality score for each ALT POS: variant position (1-based) FILTER: variant call filter status ID: variant identifier (usually dbsnp ID) REF: reference base(s) INFO: key-value pairs with additional information (described in header) Optional fields: FORMAT: genotype information fields SAMPLE1 SAMPLEn: values for fields listed in FORMAT 32
33 NGS data analysis Functional annotation 33
34 Functional annotation small variants (SNP/indels) per genome ATCATGCATGC ATCATTCATGC Which ones are most interesting for our purpose? 34
35 Annovar Identify variants and flag those with detrimental effects Gene-based annotations identify variants that can cause protein coding changes detect the amino acids that are affected 35
36 Annovar Identify variants and flag those with detrimental effects Region-based annotations identify variants in specific genomic regions: conserved regions predicted transcription factor binding sites segmental duplication regions etc 36
37 Annovar Identify variants and flag those with detrimental effects Filter-based annotations identify variants that are documented in specific databases: dbsnp 1000 Genome Project etc 37
38 Annovar VCF files Extensive number of new annotations added to the initial VCF file 38
39 MToolBox Human mtdna reconstruction, analysis and annotation from NGS data Haplogroup predictions Both command-line and web-based versions available 39
40 HmtDB Over human mitochondrial sequences Healthy/patient and continent-specific subsets Genome-centric 40
41 HmtVar Over human mitochondrial variants Pathogenicity predictions available for most variants Variant-centric 41
42 NGS Data Analysis: pipelines General-purpose programming language Easy to learn Very powerful (libraries available for anything you can think of) Biopython: specific module for bioinformatics 42
43 NGS Data Analysis: pipelines Originally suited for statistics Particularly used for data analysis and visualization Gained a lot of traction for many different disciplines Bioconductor: specific package for bioinformatics 43
44 Useful info Contacts: Slides: 44
INTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationData Walkthrough: Background
Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationNGS : reads quality control
NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationFalcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationFrom fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /
From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationBriefly: Bioinformatics File Formats. J Fass September 2018
Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationAnalyzing massive genomics datasets using Databricks Frank Austin Nothaft,
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationData Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationRead Mapping and Variant Calling
Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within
More informationMapping reads to a reference genome
Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationBaseSpace Variant Interpreter Release Notes
Document ID: EHAD_RN_010220118_0 Release Notes External v.2.4.1 (KN:v1.2.24) Release Date: Page 1 of 7 BaseSpace Variant Interpreter Release Notes BaseSpace Variant Interpreter v2.4.1 FOR RESEARCH USE
More informationIntro to NGS Tutorial
Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................
More informationTP RNA-seq : Differential expression analysis
TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2
More informationQuality assessment of NGS data
Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:
More informationData Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis
Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationPerforming whole genome SNP analysis with mapping performed locally
BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation
More informationGenome Assembly: Preliminary Results
Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.
More informationTumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual
Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1
More informationdiscosnp++ Reference-free detection of SNPs and small indels v2.2.2
discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationThe SAM Format Specification (v1.3-r837)
The SAM Format Specification (v1.3-r837) The SAM Format Specification Working Group November 18, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More informationAssignment 7: Single-cell genomics. Bio /02/2018
Assignment 7: Single-cell genomics Bio5488 03/02/2018 Assignment 7: Single-cell genomics Input Genotypes called from several exome-sequencing datasets derived from either bulk or small pools of cells (VCF
More informationv0.3.0 May 18, 2016 SNPsplit operates in two stages:
May 18, 2016 v0.3.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationMPG NGS workshop I: Quality assessment of SNP calls
MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationQuality Control of Sequencing Data
Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY ss2489@cornell.edu // Twitter:@SahaSurya BTI Plant Bioinformatics Course 2017 3/27/2017 BTI
More informationTCGA Variant Call Format (VCF) 1.0 Specification
TCGA Variant Call Format (VCF) 1.0 Specification Document Information Specification for TCGA Variant Call Format (VCF) Version 1.0 1 About TCGA VCF specification 2 TCGA-specific customizations 3 File format
More informationCycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)
Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationMinimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis
More informationAnalysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationIsaac Enrichment v2.0 App
Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationmageri Documentation Release Mikhail Shugay
mageri Documentation Release 1.0.0 Mikhail Shugay May 08, 2017 Contents 1 Terminology 3 2 Table of contents 5 2.1 Installation and running......................................... 5 2.2 Input...................................................
More informationThe SAM Format Specification (v1.3 draft)
The SAM Format Specification (v1.3 draft) The SAM Format Specification Working Group July 15, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text
More informationMetaStorm: User Manual
MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To
More informationTutorial. Variant Detection. Sample to Insight. November 21, 2017
Resequencing: Variant Detection November 21, 2017 Map Reads to Reference and Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationBiomedical Genomics Workbench APPLICATION BASED MANUAL
Biomedical Genomics Workbench APPLICATION BASED MANUAL Manual for Biomedical Genomics Workbench 4.0 Windows, Mac OS X and Linux January 23, 2017 This software is for research purposes only. QIAGEN Aarhus
More informationBaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationarxiv: v2 [q-bio.gn] 13 May 2014
BIOINFORMATICS Vol. 00 no. 00 2005 Pages 1 2 Fast and accurate alignment of long bisulfite-seq reads Brent S. Pedersen 1,, Kenneth Eyring 1, Subhajyoti De 1,2, Ivana V. Yang 1 and David A. Schwartz 1 1
More informationTutorial: Resequencing Analysis using Tracks
: Resequencing Analysis using Tracks September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : Resequencing
More information