NGS Data Analysis. Roberto Preste

Size: px
Start display at page:

Download "NGS Data Analysis. Roberto Preste"

Transcription

1 NGS Data Analysis Roberto Preste 1

2 Useful info Contacts: Slides: 2

3 NGS data analysis Overview 3

4 NGS Data Analysis: the basic idea 4

5 NGS Data Analysis: the actual workflow Preprocessing & Mapping Variant discovery Functional annotation 5

6 NGS data analysis Quality check & preprocessing 6

7 Fasta files >J Homo sapiens mitochondrion, complete genome GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATC ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA Both human- and machine-readable Can store multiple sequences ID can contain details or comments Usually contains full genomes or long sequence chunks Sequence ID Sequence 7

8 Fastq Sequence ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + Sequence Spacer!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCC420 Both human- and machine-readable Can store multiple sequences ID can contain sequencing details and technical info Usually contains short sequence chunks (sequencing reads) Quality Score 8

9 Quality score Phred quality score: estimated probability of an error in base calling Probability that the base call is incorrect usually [0-40] Encoded using ASCII characters in fastq files: Quality score Probability of errors ASCII encoding 0-9 1! #$%& ()* /10 +,-./ / :;<=> /10000 I 9

10 Quality GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCC Quality score Probability of errors ASCII encoding 0-9 1! #$%& ()* /10 +,-./ / :;<=> /1000?@ABCDEFGH 40 1/10000 I

11 Quality check FastQC: visual report of several quality checks for NGS data, useful for further processing Different modules = different checks Pass Warning Fail 11

12 FastQC modules 12

13 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters 13

14 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters cut low quality bases from both ends 14

15 Preprocessing Cleansing of reads to solve several issues: Good quality Bad quality Adapter remove adapters cut low quality bases from both ends drop short reads 15

16 Preprocessing Cleansing of reads to solve several issues: remove adapters Common tools: cut low quality bases from both ends drop short reads Trimmomatic Trim Galore! FASTX 16

17 Post-processing quality check Was the processing effective? Are these data ready to be aligned? 17

18 NGS data analysis Alignment 18

19 Alignment vs Assembly Alignment (reference-based) reference genome available reads aligned on it Assembly (de-novo) reference genome not available reads aligned with each other..gtgacttagtcgtagctagctagtagctcgatctaga.. GTGACTTAGT GCTAGCTAGT AGTTAGTCGT GTGACTTAGT GAGTTAGTCG CTTAGTCGTA TAGTCGTAGC TAGTAGCTCG GTAGCTCGAT GTAGCTCGAT TCGTAGCTAG TGAGTTAGCC CGATCTAGA AGCTCGACCT AGCTAGTAGC AGCTCGACCT CTCGACCTAG..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. 19

20 Alignment..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. GTGACTTAGT GAGTTAGTCG Reference genome TAGTAGCTCG GTAGCTCGAT CTTAGTCGTA TAGTCGTAGC Reads AGCTCGACCT CTCGACCTAG Common aligners: BWA Bowtie GMAP/GSNAP 20

21 Assembly GTGACTTAGT GCTAGCTAGT AGTTAGTCGT CGATCTAGA GTAGCTCGAT Reads TCGTAGCTAG TGAGTTAGCC AGCTCGACCT AGCTAGTAGC..GTGACTTAGTCGTAGCTAGCTAGTAGCTCGATCTAGA.. Common approaches: greedy algorithm graph method Consensus sequence Common assemblers: Newbler SPAdes MaSuRCA 21

22 Paired-end vs single-end reads Suitable for most applications Cheaper Faster Easy to identify read position in genome High accuracy for structural rearrangements and assembly of repetitive regions More expensive 22

23 SAM/BAM files Text-based format used to store aligned reads (to a reference genome) Header Alignments SAM (Sequence Alignment Map) Both human- and machine-readable Header section contains TAG:VALUE pairs Alignment section contains 11 mandatory fields BAM (Binary Alignment Map) Compressed version of SAM Binary format Only machine-readable 23

24 SAM files TAG:VALUE pairs Record type header line reference sequence VN: version number SN: reference sequence name SO: alignments sorting order LN: reference sequence length 24

25 SAM files QNAME MAPQ POS SEQ CIGAR 25

26 Alignment quality check Integrative Genomics Viewer (IGV) Interactive visualization of NGS data from Fasta, SAM, BAM, VCF files Additional features are organized in tracks (gene expression, methylation, copy number variations...) 26

27 NGS data analysis Variant calling 27

28 Variations Aligned data can be used to assess the presence of mutations: somatic germline 28

29 Variations Most common variations searched for: Variation type Reference ACTGACGCATGCATCATGCATGC SNP ACTGACGCATGCATCATTCATGC Insertion ACTGACGCATGGTACATCATGCATGC Deletion ACTGACGC--GCATCATGCATGC Variation effect 29

30 Variant callers A plethora of different tools, each with its own peculiarities: variation type (SNV vs structural variation) source (somatic vs cancer mutations) only detect variants vs also predict their effect Variant Call Format (VCF) 30

31 VCF files Header (information and metadata) Variants Variant annotations Genotype annotations 31

32 VCF files Mandatory fields: ALT: alternative base(s) #CHROM: chromosome or contig QUAL: Phred quality score for each ALT POS: variant position (1-based) FILTER: variant call filter status ID: variant identifier (usually dbsnp ID) REF: reference base(s) INFO: key-value pairs with additional information (described in header) Optional fields: FORMAT: genotype information fields SAMPLE1 SAMPLEn: values for fields listed in FORMAT 32

33 NGS data analysis Functional annotation 33

34 Functional annotation small variants (SNP/indels) per genome ATCATGCATGC ATCATTCATGC Which ones are most interesting for our purpose? 34

35 Annovar Identify variants and flag those with detrimental effects Gene-based annotations identify variants that can cause protein coding changes detect the amino acids that are affected 35

36 Annovar Identify variants and flag those with detrimental effects Region-based annotations identify variants in specific genomic regions: conserved regions predicted transcription factor binding sites segmental duplication regions etc 36

37 Annovar Identify variants and flag those with detrimental effects Filter-based annotations identify variants that are documented in specific databases: dbsnp 1000 Genome Project etc 37

38 Annovar VCF files Extensive number of new annotations added to the initial VCF file 38

39 MToolBox Human mtdna reconstruction, analysis and annotation from NGS data Haplogroup predictions Both command-line and web-based versions available 39

40 HmtDB Over human mitochondrial sequences Healthy/patient and continent-specific subsets Genome-centric 40

41 HmtVar Over human mitochondrial variants Pathogenicity predictions available for most variants Variant-centric 41

42 NGS Data Analysis: pipelines General-purpose programming language Easy to learn Very powerful (libraries available for anything you can think of) Biopython: specific module for bioinformatics 42

43 NGS Data Analysis: pipelines Originally suited for statistics Particularly used for data analysis and visualization Gained a lot of traction for many different disciplines Bioconductor: specific package for bioinformatics 43

44 Useful info Contacts: Slides: 44

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Data Walkthrough: Background

Data Walkthrough: Background Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

Sentieon Documentation

Sentieon Documentation Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................

More information

NGS : reads quality control

NGS : reads quality control NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Falcon Accelerated Genomics Data Analysis Solutions. User Guide

Falcon Accelerated Genomics Data Analysis Solutions. User Guide Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja / From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013) Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

MiSeq Reporter TruSight Tumor 15 Workflow Guide

MiSeq Reporter TruSight Tumor 15 Workflow Guide MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

Read Mapping and Variant Calling

Read Mapping and Variant Calling Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within

More information

Mapping reads to a reference genome

Mapping reads to a reference genome Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

BaseSpace Variant Interpreter Release Notes

BaseSpace Variant Interpreter Release Notes Document ID: EHAD_RN_010220118_0 Release Notes External v.2.4.1 (KN:v1.2.24) Release Date: Page 1 of 7 BaseSpace Variant Interpreter Release Notes BaseSpace Variant Interpreter v2.4.1 FOR RESEARCH USE

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

TP RNA-seq : Differential expression analysis

TP RNA-seq : Differential expression analysis TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

More information

Quality assessment of NGS data

Quality assessment of NGS data Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:

More information

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Performing whole genome SNP analysis with mapping performed locally

Performing whole genome SNP analysis with mapping performed locally BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation

More information

Genome Assembly: Preliminary Results

Genome Assembly: Preliminary Results Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.

More information

Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual

Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1

More information

discosnp++ Reference-free detection of SNPs and small indels v2.2.2

discosnp++ Reference-free detection of SNPs and small indels v2.2.2 discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

The SAM Format Specification (v1.3-r837)

The SAM Format Specification (v1.3-r837) The SAM Format Specification (v1.3-r837) The SAM Format Specification Working Group November 18, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

Assignment 7: Single-cell genomics. Bio /02/2018

Assignment 7: Single-cell genomics. Bio /02/2018 Assignment 7: Single-cell genomics Bio5488 03/02/2018 Assignment 7: Single-cell genomics Input Genotypes called from several exome-sequencing datasets derived from either bulk or small pools of cells (VCF

More information

v0.3.0 May 18, 2016 SNPsplit operates in two stages:

v0.3.0 May 18, 2016 SNPsplit operates in two stages: May 18, 2016 v0.3.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.

More information

MPG NGS workshop I: Quality assessment of SNP calls

MPG NGS workshop I: Quality assessment of SNP calls MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

Quality Control of Sequencing Data

Quality Control of Sequencing Data Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY ss2489@cornell.edu // Twitter:@SahaSurya BTI Plant Bioinformatics Course 2017 3/27/2017 BTI

More information

TCGA Variant Call Format (VCF) 1.0 Specification

TCGA Variant Call Format (VCF) 1.0 Specification TCGA Variant Call Format (VCF) 1.0 Specification Document Information Specification for TCGA Variant Call Format (VCF) Version 1.0 1 About TCGA VCF specification 2 TCGA-specific customizations 3 File format

More information

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP) Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

DNA / RNA sequencing

DNA / RNA sequencing Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using

More information

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis

More information

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

Isaac Enrichment v2.0 App

Isaac Enrichment v2.0 App Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

mageri Documentation Release Mikhail Shugay

mageri Documentation Release Mikhail Shugay mageri Documentation Release 1.0.0 Mikhail Shugay May 08, 2017 Contents 1 Terminology 3 2 Table of contents 5 2.1 Installation and running......................................... 5 2.2 Input...................................................

More information

The SAM Format Specification (v1.3 draft)

The SAM Format Specification (v1.3 draft) The SAM Format Specification (v1.3 draft) The SAM Format Specification Working Group July 15, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text

More information

MetaStorm: User Manual

MetaStorm: User Manual MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To

More information

Tutorial. Variant Detection. Sample to Insight. November 21, 2017

Tutorial. Variant Detection. Sample to Insight. November 21, 2017 Resequencing: Variant Detection November 21, 2017 Map Reads to Reference and Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

Biomedical Genomics Workbench APPLICATION BASED MANUAL

Biomedical Genomics Workbench APPLICATION BASED MANUAL Biomedical Genomics Workbench APPLICATION BASED MANUAL Manual for Biomedical Genomics Workbench 4.0 Windows, Mac OS X and Linux January 23, 2017 This software is for research purposes only. QIAGEN Aarhus

More information

BaseSpace - MiSeq Reporter Software v2.4 Release Notes

BaseSpace - MiSeq Reporter Software v2.4 Release Notes Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

arxiv: v2 [q-bio.gn] 13 May 2014

arxiv: v2 [q-bio.gn] 13 May 2014 BIOINFORMATICS Vol. 00 no. 00 2005 Pages 1 2 Fast and accurate alignment of long bisulfite-seq reads Brent S. Pedersen 1,, Kenneth Eyring 1, Subhajyoti De 1,2, Ivana V. Yang 1 and David A. Schwartz 1 1

More information

Tutorial: Resequencing Analysis using Tracks

Tutorial: Resequencing Analysis using Tracks : Resequencing Analysis using Tracks September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : Resequencing

More information