RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

Size: px
Start display at page:

Download "RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013"

Transcription

1 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013

2 RNAseq overview

3 RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads Paired ends Mate-pairs Multiplexing

4 RNAseq overview

5 RNAseq workflow

6 RNAseq assembly

7 RNAseq assembly Index the reference with Bowtie2 Map the reads to the reference with tophat2 Output: BAM files for hits and unmapped reads BED files for junctions, insertions, deletions View output: Tablet ( )

8 RNAseq analysis Stats for assembly quality Check for contaminations Total length Number of contigs How many reads map?

9 RNAseq analysis Stats for assembly quality Check for contaminations Total length Number of contigs How many reads map?

10 Expression analysis Cufflinks Run cuffdiff for detection of differential expression

11 Expression analysis Cufflinks Run cuffdiff for detection of differential expression Which genes are differentially expressed $ awk 'BEGIN {OFS = \t } $14 = yes {print $0}' gene_exp.diff > significant_genes.txt cuffdiff output will be used in the R class next week

12 SNP calling SAMtools mpileup GATK File format: vcf #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT

13 SNP calling SAMtools mpileup 1. Call SNPs from bam file and convert to vcf format $ samtools mpileup -C 50 -uf reference.fa alignment.bam bcftools view -bvcg - > raw_var.bcf Can you find out what each of the above commands does?

14 SNP calling 1. Call SNPs from bam file and convert to vcf format $ samtools mpileup -C 50 -uf reference.fa alignment.bam bcftools view -bvcg - > raw_var.bcf mpileup computes the likelihood of data given each possible genotype and stores the likelihoods in the BCF format. It does not call variants.

15 SNP calling 1. Call SNPs from bam file and convert to vcf format $ samtools mpileup -C 50 -uf reference.fa alignment.bam bcftools view -bvcg - > raw_var.bcf mpileup computes the likelihood of data given each possible genotype and stores the likelihoods in the BCF format. It does not call variants. $ bcftools view raw_var.bcf vcfutils.pl varfilter -D 100 > filtered_var.vcf Can you find out what each of the above commands does?

16 SNP calling 1. Call SNPs from bam file and convert to vcf format $ samtools mpileup -C 50 -uf reference.fa alignment.bam bcftools view -bvcg - > raw_var.bcf mpileup computes the likelihood of data given each possible genotype and stores the likelihoods in the BCF format. It does not call variants. $ bcftools view raw_var.bcf vcfutils.pl varfilter -D 100 > filtered_var.vcf bcftools does the actual SNP calling, and converts the BCF to VCF

17 SNP calling 1. Call SNPs from bam file and convert to vcf format $ bcftools view raw_var.bcf vcfutils.pl varfilter -D 100 > filtered_var.vcf 2. Output is in VCF format

18 SNP calling 2. Output is in VCF format Look at your vcf output file It has a header, followed by the data How many SNPs were called? How many Indels? Read more:

19 SNP calling: effect prediction SnpEff Read the manual! SnpEff is a variant annotation and effect prediction tool. It annotates and predicts the effects of genetic variants (such as amino acid changes). 1. Build a snpeff database for the reference genome 2. Use snpeff to determine if SNPs occur in genes

20 SNP calling: effect prediction 1. Build a snpeff database for the reference genome $ cd ~/Software/snpEff $ mkdir data $ cd data $ mkdir genomes $ mkdir SL2.40ch04 $ cd SL2.40ch4 $ cp ~/Data/ch4_demo_dataset/annotation/ITAG2.3_gene_models _ch4.gtf genes.gtf $ cd../genomes/ $ cp ~/Data/ch4_demo_dataset/bwt2_index/SL2.40ch04.fa./ #add the new genome to the config file $ emacs snpeffect.congif

21 SNP calling: effect prediction 1. Build a snpeff database for the reference genome #add the new genome to the config file $ emacs snpeff.congif

22 SNP calling: effect prediction 1. Build a snpeff database for the reference genome #add the new genome to the config file $ emacs snpeff.congif #Build the database $ java -jar snpeff.jar build -gtf22 -v SL2.40ch04

23 SNP calling: effect prediction 1. Build a snpeff database for the reference genome 2. Use snpeff to determine if SNPs occur in genes Run this in the directory of the.vcf file! $ java -jar snpeff.jar eff SL2.40ch04 snps.vcf -c snpeff.config -v > snpeff.out What output did you get?

24 SNP calling: effect prediction 2. Use snpeff to determine if SNPs occur in genes Run this in the directory of the.vcf file! $ java -jar snpeff.jar eff SL2.40 snps.vcf -c snpeff.config -v > snpeff.out.out file has the snpeff stats snpeff_genes.txt : SNPs in genes (remember the genes.gtf file? ) snpeff_summary.html

25 SNP calling: effect prediction 2. Use snpeff to determine if SNPs occur in genes. $ java -jar snpeff.jar eff SL2.40 snps.vcf -c snpeff.config -v > snpeff.out.out file has the snpeff stats snpeff_genes.txt : SNPs in genes (remember the genes.gtf file? ) snpeff_summary.html Look at the output and Count the number of genes with SNPs How many synonymous SNPs? How many are non-synonymous?

26 SNP calling: effect prediction Read more about SnpEff output and results Other SNP calling tools GATK Freebayes Next week Introduction to R statistics

SNP Calling. Tuesday 4/21/15

SNP Calling. Tuesday 4/21/15 SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Practical exercises Day 2. Variant Calling

Practical exercises Day 2. Variant Calling Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Evaluate NimbleGen SeqCap RNA Target Enrichment Data

Evaluate NimbleGen SeqCap RNA Target Enrichment Data Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina

More information

Genomics. Nolan C. Kane

Genomics. Nolan C. Kane Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

Data Walkthrough: Background

Data Walkthrough: Background Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will

More information

RNA Sequencing with TopHat and Cufflinks

RNA Sequencing with TopHat and Cufflinks RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so

More information

RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide

RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Set Analysis Parameters TopHat 4 Analysis

More information

Read Mapping and Variant Calling

Read Mapping and Variant Calling Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within

More information

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts. Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

Manual Reference Pages samtools (1)

Manual Reference Pages samtools (1) Manual Reference Pages samtools (1) NAME CONTENTS SYNOPSIS samtools Utilities for the Sequence Alignment/Map (SAM) format bcftools Utilities for the Binary Call Format (BCF) and VCF Synopsis Description

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT

More information

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)

Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis

More information

Variant Calling and Filtering for SNPs

Variant Calling and Filtering for SNPs Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013) Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using

More information

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Falcon Accelerated Genomics Data Analysis Solutions. User Guide

Falcon Accelerated Genomics Data Analysis Solutions. User Guide Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software

More information

Introduction to GEMINI

Introduction to GEMINI Introduction to GEMINI Aaron Quinlan University of Utah! quinlanlab.org Please refer to the following Github Gist to find each command for this session. Commands should be copy/pasted from this Gist https://gist.github.com/arq5x/9e1928638397ba45da2e#file-gemini-intro-sh

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja / From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

MPG NGS workshop I: Quality assessment of SNP calls

MPG NGS workshop I: Quality assessment of SNP calls MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

Reference guided RNA-seq data analysis using BioHPC Lab computers

Reference guided RNA-seq data analysis using BioHPC Lab computers Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

TopHat, Cufflinks, Cuffdiff

TopHat, Cufflinks, Cuffdiff TopHat, Cufflinks, Cuffdiff Andreas Gisel Institute for Biomedical Technologies - CNR, Bari TopHat TopHat TopHat TopHat is a program that aligns RNA-Seq reads to a genome in order to identify exon-exon

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Isaac Enrichment v2.0 App

Isaac Enrichment v2.0 App Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December

More information

Input files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:

Input files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam: Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq

More information

A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package

A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package The following data and software resources are required for following the tutorial. Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

Phoenix Documentation

Phoenix Documentation Phoenix Documentation Release 1.0 Public Health England 04 September, 2018 Contents 1 Introduction 3 1.1 Installation................................................ 3 1.2 Overview.................................................

More information

Reads Alignment and Variant Calling

Reads Alignment and Variant Calling Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department

More information

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1 Open Your Favorite Note Taking Program TextEdit.app WordPad Connect to Your Personal Bioinformatics Server Start VirtualBox Start PG2014 Minimize window Connect via SSH using Terminal.app or PuTTY View

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

RNASeq2017 Course Salerno, September 27-29, 2017

RNASeq2017 Course Salerno, September 27-29, 2017 RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials

More information

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

Next-Generation Sequencing applied to adna

Next-Generation Sequencing applied to adna Next-Generation Sequencing applied to adna Hands-on session June 13, 2014 Ludovic Orlando - Lorlando@snm.ku.dk Mikkel Schubert - MSchubert@snm.ku.dk Aurélien Ginolhac - AGinolhac@snm.ku.dk Hákon Jónsson

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

RVD2.7 command line program (CLI) instructions

RVD2.7 command line program (CLI) instructions RVD2.7 command line program (CLI) instructions Contents I. The overall Flowchart of RVD2 program... 1 II. The overall Flow chart of Test s... 2 III. RVD2 CLI syntax... 3 IV. RVD2 CLI demo... 5 I. The overall

More information

SNP/SNV effect and annotation

SNP/SNV effect and annotation SNP/SNV effect and annotation Laurent Falquet, Oct 18 Why annotating the SNVs? Annotate the function of a mutation (change or the effect of a variant) Restrict the space of search Ultimate goal: allow

More information

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS

More information

ADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD

ADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial

More information

DNA / RNA sequencing

DNA / RNA sequencing Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using

More information

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux User's Guide to DNASTAR SeqMan NGen 12.0 For Windows, Macintosh and Linux DNASTAR, Inc. 2014 Contents SeqMan NGen Overview...7 Wizard Navigation...8 Non-English Keyboards...8 Before You Begin...9 The

More information

Genome Assembly: Preliminary Results

Genome Assembly: Preliminary Results Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information