Programming in Python

Transcription

1 Programming in Python Michael Schroeder Sebas0an Salen0n Lecture 2: Sequences Slides derived from Ian Holmes, Department of Sta0s0cs, University of Oxford 1 Updates by Andreas Henschel

2 Summary: Scalars and Loops Assignment operator Arithme0c opera0ons String opera0ons Condi0onal tests Logical operators Loops Reading a file x = 5 y = x * 3 s = "Concatenating " + "strings" if y > 10: print s if y > 10 and not s == "": print s for x in range(10): print x for line in open("sequence.txt"): print line 2

3 How to sum up all the numbers in [3,7,10,4,-1,0]? print all word in [ Oranges, Bananas, Cucumbers, Apples ] star0ng with an O or A? check which element of [1,5,-1,8,7] are also inside [8,7,10,5,0,0]? check if the ra0o of two integers a and b is larger than 0.5? check for all tuples in [(3,2),(10,5),(1,-1)] if the square of the first number can be divided by the second without rest? 3

4 Overview Types of sequences and their proper0es Lists, Tuples, Strings, Iterators Building, accessing and modifying sequences List comprehensions Lambda func0ons File opera0ons 4

5 Types and Proper0es of Sequences 5

6 Lists vs tuples Both are sequences Lists should be used for storing equal elements Tuples should be used for storing different elements Lists are larger than tuples (i.e. consume more memory) mylist = [1,2,3,4] mylist2 = [ Apple, Banana, Orange ] Construc<on (Syntax) mytuple = ( sebastian, m, 28) mytuple2 = ( motif, ATTCG, E44 ) mylist[0] 1 Accessing Elements sebastian mytuple[0] Modiying Elements mylist[1] = 5 mytuple[1] = 5 immutable! mylist += [3,2] Adding Elements mytuple += ( phd, biotec ) 6

7 Iterators Iterators work (almost) like lists Save 0me and memory with larger data Can only be used once (!) range(1000) xrange(1000) Completely constructed at the beginning Everything loaded into memory Available aber looping Elements served when needed Not filling the memory Not available aber looping 07_iterators 7

8 Working with Sequences 8

9 Lists A list is a list of variables nucleotides = ['a', 'c', 'g', 't'] print "Nucleotides: ", nucleotides Nucleotides: ['a', 'c', 'g', 't'] We can think of this as a list with 4 entries element 0 a c g t the list is the set of all four elements element 1 element 2 element 3 Note that the element indices start at zero. 9

10 List literals There are several, equally valid ways to assign an en0re array at once. This is the most common: a commaseparated list, delimited by squared brackets a = [1,2,3,4,5] print "a = ",a b = ['a','c','g','t'] print "b = ",b c = range(1,6) print "c = ",c d = "a c g t".split() print "d = ", d a = [1,2,3,4,5] b = ['a','c','g','t'] c = [1,2,3,4,5] d = ['a','c','g','t'] 10

11 Accessing lists To access list elements, use square brackets e.g. x[0] means "element zero of list x" x = ['a', 'c', 'g', 't'] i=2 print x[0], x[i], x[-1] a g t Remember, element indices start at zero! Nega0ve indices refer to elements coun0ng from the end e.g. x[-1] means "last element of list x" 11

12 List opera0ons You can sort and reverse lists... x = ['a', 't', 'g', 'c'] print "x =",x x.sort() print "x =",x x.reverse() print "x =",x You can add, delete and count elements x = ['a', 't', 'g', 'c'] x = ['a', 'c', 'g', 't'] x = ['t', 'g', 'c', 'a'] nums = [2,2,5,2,6] nums.append(8) print nums print nums.count(2) nums.remove(5) print nums [2,2,5,2,6,8] 3 [2,2,2,6,8] 12

13 More list opera0ons Mul0plying lists with * pop removes the last element of a list append adds an element to the end of a list concatena0ng lists with + or += Removing the first occurrence of an element Posi0on of an element >>> x=[1,0]*5 >>> x [1, 0, 1, 0, 1, 0, 1, 0, 1, 0] >>> while 0 in x: print x.pop(), >>> x [1] >>> x.append(2) >>> x [1, 2] >>> x+=x >>> x [1, 2, 1, 2] >>> x.remove(2) >>> x [1, 1, 2] >>> x.index(2) 2 13

14 Example: Reverse complemen0ng DNA A common opera0on due to double-helix symmetry of DNA Start by making string lower case again. This is generally good prac0ce Replace 'a' with 't', 'c' with 'g', 'g' with 'c' and 't' with 'a' Reverse the list def revcomp(dna): replaced=list(dna.lower(). replace("a","x").replace("t","a"). replace("x", "t").replace("g","x"). replace("c","g").replace("x", "c")) replaced.reverse() return "".join(replaced) print revcomp("accacgttaggtct ") agacctaacgtggt 14

15 for loop revisited Finding the total of a list of numbers: for statement loops through each entry in a list val = [4, 19, 1, 100, 125, 10] total = 0 for x in val: total += x print total 259 val = [4, 19, 1, 100, 125, 10] total = 0 for i in range(len(val)): total += val[i] print total 259 val = [4, 19, 1, 100, 125, 10] Print sum(val)

16 Taking a slice of a list The syntax x[i:j] returns a list containing elements i,i+1,,j-1 of list x nucleotides = ['a', g, 'c', 't'] purines = nucleotides[0:2] # nucleotides[:2] also works pyrimidines = nucleotides[2:4]# nucleotides[2:] also works # Another way: nucleotides[-2:], i.e. last two elements print "Nucleotides:", nucleotides print "Purines:", purines print "Pyrimidines:", pyrimidines Nucleotides: ['a', 'g', 'c', 't'] Purines: ['a', 'g'] Pyrimidines: ['c', 't'] 16

17 Lists and Strings A string can be converted into a list of strings and Using the split method: string.split(separator) A list of strings can be converted into one string Using the join method: separator.join(list) sentence = This is a complete sentence. print sentence.split() [ This, is, a, complete, sentence ] datarow = Apples,Bananas,Oranges Print datarow.split(, ) [ Apples, Bananas, Oranges ] cities = [ Dresden, Munich, Hamburg, Cologne ] print -->.join(cities) Dresden --> Munich --> Hamburg --> Cologne 17

18 List Comprehensions 18

19 What are list comprehensions? Easy way to construct sequences, especially lists Oben replaces a for loop and an if-construc0on Is used very oben in Python Syntax: [expr(var) for var in sequence if condi<on] Squares of all odd numbers between 1 and 10 [1,9,25,49,81] newlist = [] for x in range(1,11): if x % 2: newlist.append(x**2) Naïve construc<on of list newlist = [x**2 for x in range(1,11) if x % 2] Construc<on with list comprehension 19

20 Examples: List comprehensions sentence = I like MySQL but not Python print [(w.lower(), len(w)) for w in sentence.split()] [(i, 1), (like, 4), (mysql, 5), (but, 3), (not, 3), (python, 6)] generator = ((x-2)*3 for x in range(10)) Constructs a generator (iterator) with the sequence of numbers my_numbers = (1,0,-1,6,3,-2,3,4) my_sum = sum([x for x in my_numbers if x >0]) print my_sum Add up all posi<ve integers in my tuple 17 20

21 Lambda Func0ons 21

22 Lambda Func0ons Kind of anonymous func0ons Equivalent to normal func0ons Not bound to a name Different syntax def f(x): return (x-3)**2 f(5) f = lambda x: (x-3)**2 f(5) Normal func<on defini<on Lambda func<on

23 Map, filter, and reduce Lambda func0ons can be used anywhere where a func0on is expected Powerful in combina0on with map, filter, and reduce map filter reduce (lambda_function, sequence) Func0on applied to each element...of the given sequence Decides what to to with the result: map -> apply to each element, return modified list filter -> return list with element tested True reduce -> returns one element resulting from computation 23

24 Examples map(lambda x: x*3, [1,2,3]) [3,6,9] filter(lambda x: x>=1.0, [1.2,0.5,0.7,1.3]) [1.2,1.3] filter(lambda x: x!=0, map(lambda x: x-2, [4,2,5])) [2,3] reduce(lambda x,y: x+y if x<=2 else x*y, (1,2,3)) x y 1, 2 3 x y 3,

25 File IO 25

26 Opening, reading and wri0ng a file Returns file handler f = open( myfile.txt, r ) for line in f: if not line.startswith( # ): print line f.close() Loop variable File mode (r, w, a,...) Linewise itera<on over file! with open( myfile.txt, r ) as f: for line in f: if not line.startswith( # ): print line File is closed aber block! Shorter and bener form #Old number 1234 # New number 5555 # Test

27 Example: FASTA format A format for storing mul0ple named sequences This file contains 3' UTRs for Drosophila genes CG11604 CG11455 CG11488 Name of sequence is preceded by > symbol NB sequences can span mul0ple lines >CG11604 TAGTTATAGCGTGAGTTAGT TGTAAAGGAACGTGAAAGAT AAATACATTTTCAATACC >CG11455 TAGACGGAGACCCGTTTTTC TTGGTTAGTTTCACATTGTA AAACTGCAAATTGTGTAAAA ATAAAATGAGAAACAATTCT GGT >CG11488 TAGAAGTCAAAAAAGTCAAG TTTGTTATATAACAAGAAAT CAAAAATTATATAATTGTTT TTCACTCT fly3utr.txt 27

28 Example: FASTA format with open( fly3utr.txt, r ) as f: for line in f: if line.startswith( > ): print line What if we want to show the length of sequence for each record? >CG11604 >CG11455 >CG11488 >CG11604 TAGTTATAGCGTGAGTTAGT TGTAAAGGAACGTGAAAGAT AAATACATTTTCAATACC >CG11455 TAGACGGAGACCCGTTTTTC TTGGTTAGTTTCACATTGTA AAACTGCAAATTGTGTAAAA ATAAAATGAGAAACAATTCT GGT >CG11488 TAGAAGTCAAAAAAGTCAAG TTTGTTATATAACAAGAAAT CAAAAATTATATAATTGTTT TTCACTCT 28

29 Example: FASTA format >CG11604 TAGTTATAGCGTGAGTTAGT TGTAAAGGAACGTGAAAGAT AAATACATTTTCAATACC >CG11455 TAGACGGAGACCCGTTTTTC TTGGTTAGTTTCACATTGTA AAACTGCAAATTGTGTAAAA ATAAAATGAGAAACAATTCT GGT >CG11488 TAGAAGTCAAAAAAGTCAAG TTTGTTATATAACAAGAAAT CAAAAATTATATAATTGTTT TTCACTCT name = '' with open('fly3utr.txt', 'r') as f: for line in f: line = line.rstrip() if line.startswith('>'): if name: # Empty str is False print name, length name = line[1:] length = 0 else: length += len(line) print name, length CG CG CG _fasta 29

30 Summary Strings, lists, iterators, and tuples are all sequences Lists for storage of element of equal elements More flexible, more memory consump0on Tuples for storage of different elements Immutable, less memory consump0on Iterators for fast itera0on Least memory consump0on, can be only used once! Oben, a list comprehension can replace a for loop with an if-construc0on Convert strings into lists and vice versa with join and split Lambda func<on with map, filter, and reduce for efficient list processing File object provides line-wise itera0on 30