Topic 4: Grep, Find & Sed

Size: px
Start display at page:

Download "Topic 4: Grep, Find & Sed"

Transcription

1 Topic 4: Grep, Find & Sed grep: a tool for searching for strings within files find: a tool for examining a directory tree sed: a tool for "batch editing" Associated topic: regular expressions 1

2 Motivation (Scenarios) I have a file called (something)220(something).java which contains the phrase "final exam" in a comment. Where is it? I need to find all the files in a directory tree containing "2010" and change to "2011". I need to find all the files and directories in a directory tree whose names contain "220" and change to "220A" I want to delete all files in a directory tree whose names end in "~" or start and end with "#" Style changes in large multi-file C program: change header comment and names of some functions. 2

3 Use to search files for strings grep grep <pattern> <files> Searches files and prints all lines containing the pattern Example: grep Frost * Flags: -i: case-insensitive match -w: string must appear as an entire word, not part of a word -num: num lines of context around each match 3

4 Displaying File Names Default behavior: shows file names only if searching >1 file. Flags: -h: never show file names -H: always show file names -l: show only the file names (not the matches) 4

5 No file arguments: grep reads standard input (useful for pipes!) Example: history grep cd Grep as a filter 5

6 Using grep in a conditional exit status: 0 = at least one match was found 1 = no matches found 2 = error useful flag: -q: no output (quiet) Example: if grep -q $word $filename then... 6

7 Regular Expressions Pattern to grep in previous examples: literal value For more complex searches: use a regular expression In this course: using exended regular expression syntax much easier than the default syntax! use -E flag (or egrep command) put patterns inside single quotes Regular expressions not to be confused with wildcards in file names! 7

8 Match A Single Character. in pattern: matches any single character Example: grep -E 'n.t' * Matches: not, nat, nit, etc. Does not match: nt or naut 8

9 Optional Items?: Preceeding item is optional Example: grep -Ew 'loved?' * Matches love or loved 9

10 Grouping Items Can group items into one using parenthesis Example: grep -Ew 'love(ly)?' * Matches love or lovely 10

11 Repeated Items *: Match preceding item zero or more times +: Match preceding item one or more times {n}: Match preceding item exactly n times Examples: grep -E 'a(bc)*d' * matches ad, abcd, abcbcd, etc. grep -E 'a(bc)+d' * matches abcd, abcbcd, etc., but not ad grep -E 'a(bc){2}d' * matches abcbcd and nothing else 11

12 Alternatives Two regular expressions joined with matches either expression. Example: grep -E 'red black' * Matches red or black Precedence: highest: repetition (* or +) next: concatenation (two items in a row) lowest: alternation ( ) When in doubt, use parenthesis 12

13 Bracket Expressions Sequence of characters in brackets: matches any one of those characters. Example: grep -E 'n[aeiou]t' * Maches nat, net, nit, not, nut Use dash to specify a character range: [b-d] matches b, c or d [b-dr-t] matches b,c,d,r,s or t ^ at the beginning of a bracket expression: matches any character except the characters in the bracket [^b-dr-t] matches any character that is not b,c,d,r,s or t 13

14 Character Classes Special notation for matching common groups of characters [:digit:] [:alpha:] - any letter (upper or lower case) & more on summary sheet These may used only inside bracket expressions Examples: egrep -w '[[:alpha:]]{4}' egrep 'linux[[:digit:]]\.[[:digit:]]+' egrep -w '[[:alpha:]3]+' 14

15 Matching Word & Line Positions \<: matches beginning of word (letters, digits, underscores) \>: matches end of word ^: matches start of line $: matches end of line These are not characters! They match positions only. 15

16 Quoting Special Characters \ before any character that normally has a special meaning means match the character literally Example:. matches any single character \. matches a period. 16

17 Reminder For Grep Grep matches any line with with a substring that matches the pattern. Example: grep 'cat' Matches any line containing cat. Not necessary to write egrep '^.*cat.*$' 17

18 find (1) Searches directory trees for files having particular properties. General form: find [dir...] [test...] [action...] Default action: print name of file Simplest way to use: find files based on their names. find the file called podcast.xml find all CSS files (names ending with.css) Searches directory and its sub-directories no limit on depth case-insensitive name match: find web220 iname '*.html' Note: find includes hidden files and directories (names starting 18

19 find (2): finding files by type find web220 type f shows names of all regular files in web220 find web220 type d shows names of all directories in web220 find web220 type l shows names of all symbolic links in web220 Can combine tests: all must be true find web220 type d name 's*' shows names of all directories whose names start with s 19

20 find (3): finding files by size find web220 size 4157c prints name of all files whose size is exactly 4157 bytes find web220 size +4157c prints name of all files in web220 whose size is > 4157 bytes find web220 size -4157c prints name of all files in web220 whose size is < 4157 bytes size modifiers: c = bytes k = kilobytes M = megabytes G = gigabytes Sizes are rounded up! 20

21 find (4): finding files by age find mydir mtime 4 prints names of all files modified 4 days ago (number of days rounded down) find mydir mtime +4 prints names of all files modified more than 4 days ago -4 for less than 4 days ago 21

22 find (5): finding files by age, continued -mtime asks about time in days -mmin asks about time in minutes Example: find mydir mmin -120 shows names of files modified less than 2 hours ago -atime and amin ask about access times, not modification times Example: find mydir amin -120 shows names of files looked at less than 2 hours ago 22

23 find (6): actions Default action: -print (print the name of the file) Another possible action: -delete Handy for cleaning up. (Careful: no confirmation!) Example: emacs creates backup files ending in ~ find mydir name '*~' delete Deletes all emacs backup files Suppose you'd like to see the names of the files that are deleted. Use print action first. find mydir name '*~' print delete 23

24 find (7): Combining with other Programs Goal: use find to identify files and then run other programs on those files. FILES=$(find...) for FILE in $FILES do... commands using $FILE done or: for FILE in $(find...) do... commands using $FILE done Caution:file names containing spaces are a problem! 24

25 Examples clean-up script Use find to write-protect a directory tree Show just the base names of all files in directory Find all files in web site containing the word "quiz" 25

26 sed sed = a "stream editor" editing in batch mode automates repetitive edits Scenario: CISC 123 last offered in winter 2006 Offering CISC 123 again in fall 2011, need a new web site To start web site: copy all files, make some global changes (winter to fall, 2006 to 2011, instructor's name, etc) Options: 1. Open each file by hand and make the edits. 2. Write a Java/C/Python program to make the edits 3. Write a script using find & sed to run program on all files Which option sounds like less work? Which option is more error-prone? 26

27 Simple Ways To Run Sed To run a single sed command on one or more files: sed -r -e 'command' filename1 filename2... Output goes to standard output (can redirect or pipe) -r means use extended regular expression syntax (like -E for grep) -e means next argument will be a sed command Can combine, but e must come last: sed -re 's/mary/martha/' myfile > newfile No file name: apply command to standard input (useful for pipes or experiments) 27

28 Simple Substitute Command in sed s/pattern/replacement/ pattern = regular expression replacement: string to substitute for the match Example: s/mary/martha/ First occurrence of Mary in each line replaced by Martha. 28

29 Global Substitutions s/pattern/replacement/g means replace all non-overlapping instances of pattern s/pattern/replacement/2 means replace second instance of pattern 29

30 Regular Expressions in Sed Substitution patterns in sed can be regular expressions. sed -re 's/[0-9]+/number/' Question: What will the following command do sed -re 's/[0-9]*/number/' to this input line: My cat is 16 years old. 30

31 Which Match? (1) Sometimes input line matches pattern in more than one way. 1. Non-overlapping matches sed -re 's/one/two/' Input line: one three one sed uses the first match Output: two three one 31

32 Which Match? (2) Sometimes input line matches pattern in more than one way. 2. Two matches starting at the same spot sed -re 's/a.+b/z/' Input line: axxbxxb Two possible matches: axxbxxb or: axxbxxb sed uses the longer match output is: Z 32

33 Which Match? (3) Sometimes input line matches pattern in more than one way. 3. Overlapping matches sed -re 's/a[a-z]{5}/z/' Input line: abcabcdefg Two possible matches: abcabcdefg or: abcabcdefg sed uses the first match output is: Zdefg 33

34 Advice Try to make your regular expressions as specific as possible Example: If you want a 6-letter word starting with 't' Possible patterns: t.{5} \<t.{5}\> \<t[[:alpha:]]{5}\> 34

35 Using File of Commands For more than simple one-time edits, put commands in file. Why? only have to type them once easy to include multiple commands sed -rf scriptfile inputfile Applies all commands in scriptfile to inputfile. 35

36 Multiple Commands Suppose script contains these two lines: s/tuesday/wednesday/ s/tues/thurs/ And testfile contains just one line: Today is Tuesday. Command: sed -rf script testfile What will the output be?? 36

37 Sed's Execution Cycle For every line in the input: 1. Read the next line of input into the "pattern space" 2. Execute all commands in order. Each command operates on the pattern space, not the original line Commands may change the pattern space 3. When all commands are finished for this line, print the pattern space to the standard output. Some commands change this loop we'll see examples later. 37

Motivation (Scenarios) Topic 4: Grep, Find & Sed. Displaying File Names. grep

Motivation (Scenarios) Topic 4: Grep, Find & Sed. Displaying File Names. grep Topic 4: Grep, Find & Sed grep: a tool for searching for strings within files find: a tool for examining a directory tree sed: a tool for "batch editing" Associated topic: regular expressions Motivation

More information

ITST Searching, Extracting & Archiving Data

ITST Searching, Extracting & Archiving Data ITST 1136 - Searching, Extracting & Archiving Data Name: Step 1 Sign into a Pi UN = pi PW = raspberry Step 2 - Grep - One of the most useful and versatile commands in a Linux terminal environment is the

More information

Lecture 18 Regular Expressions

Lecture 18 Regular Expressions Lecture 18 Regular Expressions In this lecture Background Text processing languages Pattern searches with grep Formal Languages and regular expressions Finite State Machines Regular Expression Grammer

More information

Essentials for Scientific Computing: Stream editing with sed and awk

Essentials for Scientific Computing: Stream editing with sed and awk Essentials for Scientific Computing: Stream editing with sed and awk Ershaad Ahamed TUE-CMS, JNCASR May 2012 1 Stream Editing sed and awk are stream processing commands. What this means is that they are

More information

Common File System Commands

Common File System Commands Common File System Commands ls! List names of all files in current directory ls filenames! List only the named files ls -t! List in time order, most recent first ls -l! Long listing, more information.

More information

Lecture 5. Essential skills for bioinformatics: Unix/Linux

Lecture 5. Essential skills for bioinformatics: Unix/Linux Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular

More information

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

CS 307: UNIX PROGRAMMING ENVIRONMENT FIND COMMAND

CS 307: UNIX PROGRAMMING ENVIRONMENT FIND COMMAND CS 307: UNIX PROGRAMMING ENVIRONMENT FIND COMMAND Prof. Michael J. Reale Fall 2014 Finding Files in a Directory Tree Suppose you want to find a file with a certain filename (or with a filename matching

More information

Regular Expressions 1

Regular Expressions 1 Regular Expressions 1 Basic Regular Expression Examples Extended Regular Expressions Extended Regular Expression Examples 2 phone number 3 digits, dash, 4 digits [[:digit:]][[:digit:]][[:digit:]]-[[:digit:]][[:digit:]][[:digit:]][[:digit:]]

More information

Regular Expressions. Regular expressions match input within a line Regular expressions are very different than shell meta-characters.

Regular Expressions. Regular expressions match input within a line Regular expressions are very different than shell meta-characters. ULI101 Week 09 Week Overview Regular expressions basics Literal matching.wildcard Delimiters Character classes * repetition symbol Grouping Anchoring Search Search and replace in vi Regular Expressions

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Stephen Pauwels Regular Expressions Academic Year 2018-2019 Outline What is a Regular Expression? Tools Anchors, Character sets and Modifiers Advanced Regular Expressions

More information

Systems Programming/ C and UNIX

Systems Programming/ C and UNIX Systems Programming/ C and UNIX December 7-10, 2017 1/17 December 7-10, 2017 1 / 17 Outline 1 2 Using find 2/17 December 7-10, 2017 2 / 17 String Pattern Matching Tools Regular Expressions Simple Examples

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Regular Expressions Bart Meyers University of Antwerp August 29, 2012 Outline What? Tools Anchors, character sets and modifiers Advanced Regular expressions Exercises

More information

Appendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc.

Appendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc. Appendix B WORKSHOP SYS-ED/ Computer Education Techniques, Inc. 1 Introduction There are no workshops for this chapter. The instructor will provide demonstrations and examples. SYS-ED/COMPUTER EDUCATION

More information

My Favorite bash Tips and Tricks

My Favorite bash Tips and Tricks 1 of 6 6/18/2006 7:44 PM My Favorite bash Tips and Tricks Prentice Bisbal Abstract Save a lot of typing with these handy bash features you won't find in an old-fashioned UNIX shell. bash, or the Bourne

More information

Scripting Languages Course 1. Diana Trandabăț

Scripting Languages Course 1. Diana Trandabăț Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language

More information

Basic Linux (Bash) Commands

Basic Linux (Bash) Commands Basic Linux (Bash) Commands Hint: Run commands in the emacs shell (emacs -nw, then M-x shell) instead of the terminal. It eases searching for and revising commands and navigating and copying-and-pasting

More information

Getting to grips with Unix and the Linux family

Getting to grips with Unix and the Linux family Getting to grips with Unix and the Linux family David Chiappini, Giulio Pasqualetti, Tommaso Redaelli Torino, International Conference of Physics Students August 10, 2017 According to the booklet At this

More information

COMS 6100 Class Notes 3

COMS 6100 Class Notes 3 COMS 6100 Class Notes 3 Daniel Solus September 1, 2016 1 General Remarks The class was split into two main sections. We finished our introduction to Linux commands by reviewing Linux commands I and II

More information

5/8/2012. Exploring Utilities Chapter 5

5/8/2012. Exploring Utilities Chapter 5 Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.

More information

Bash Script. CIRC Summer School 2015 Baowei Liu

Bash Script. CIRC Summer School 2015 Baowei Liu Bash Script CIRC Summer School 2015 Baowei Liu Filename Expansion / Globbing Expanding filenames containing special characters Wild cards *?, not include... Square brackets [set]: - Special characters:!

More information

Answers to AWK problems. Shell-Programming. Future: Using loops to automate tasks. Download and Install: Python (Windows only.) R

Answers to AWK problems. Shell-Programming. Future: Using loops to automate tasks. Download and Install: Python (Windows only.) R Today s Class Answers to AWK problems Shell-Programming Using loops to automate tasks Future: Download and Install: Python (Windows only.) R Awk basics From the command line: $ awk '$1>20' filename Command

More information

Session: Shell Programming Topic: Advanced Commands

Session: Shell Programming Topic: Advanced Commands Lecture Session: Shell Programming Topic: Advanced Commands Daniel Chang Text File Processing Reading and filtering text files cut - Print specific columns from a text file awk - Print specific lines from

More information

BNF, EBNF Regular Expressions. Programming Languages,

BNF, EBNF Regular Expressions. Programming Languages, BNF, EBNF Regular Expressions Programming Languages, 234319 1 Reminder - (E)BNF A notation for describing the grammar of a language The notation consists of: Terminals: the actual legal strings, written

More information

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University

22-Sep CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control. Faculty of Computer Science, Dalhousie University Lecture 8 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 8: Shells, Processes, and Job Control 22-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor:

More information

Sub-Topic 1: Quoting. Topic 2: More Shell Skills. Sub-Topic 2: Shell Variables. Referring to Shell Variables: More

Sub-Topic 1: Quoting. Topic 2: More Shell Skills. Sub-Topic 2: Shell Variables. Referring to Shell Variables: More Topic 2: More Shell Skills Plan: about 3 lectures on this topic Sub-topics: 1 quoting 2 shell variables 3 sub-shells 4 simple shell scripts (no ifs or loops yet) 5 bash initialization files 6 I/O redirection

More information

UNIX files searching, and other interrogation techniques

UNIX files searching, and other interrogation techniques UNIX files searching, and other interrogation techniques Ways to examine the contents of files. How to find files when you don't know how their exact location. Ways of searching files for text patterns.

More information

History. Terminology. Opening a Terminal. Introduction to the Unix command line GNOME

History. Terminology. Opening a Terminal. Introduction to the Unix command line GNOME Introduction to the Unix command line History Many contemporary computer operating systems, like Microsoft Windows and Mac OS X, offer primarily (but not exclusively) graphical user interfaces. The user

More information

Topic 2: More Shell Skills

Topic 2: More Shell Skills Topic 2: More Shell Skills Sub-topics: 1 quoting 2 shell variables 3 sub-shells 4 simple shell scripts (no ifs or loops yet) 5 bash initialization files 6 I/O redirection & pipes 7 aliases 8 text file

More information

User Commands sed ( 1 )

User Commands sed ( 1 ) NAME sed stream editor SYNOPSIS /usr/bin/sed [-n] script [file...] /usr/bin/sed [-n] [-e script]... [-f script_file]... [file...] /usr/xpg4/bin/sed [-n] script [file...] /usr/xpg4/bin/sed [-n] [-e script]...

More information

CSCI 2132 Software Development. Lecture 7: Wildcards and Regular Expressions

CSCI 2132 Software Development. Lecture 7: Wildcards and Regular Expressions CSCI 2132 Software Development Lecture 7: Wildcards and Regular Expressions Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 20-Sep-2017 (7) CSCI 2132 1 Previous Lecture Pipes

More information

NAME sgrep - search a file for a structured pattern

NAME sgrep - search a file for a structured pattern NAME sgrep - search a file for a structured pattern SYNOPSIS sgrep [-accddhilnnpqssttv] [-O filename] [-o "format"] [-p preprocessor] [-e] expression [filename...] sgrep [-accddhilnnpqssttv] [-O filename]

More information

Module 8 Pipes, Redirection and REGEX

Module 8 Pipes, Redirection and REGEX Module 8 Pipes, Redirection and REGEX Exam Objective 3.2 Searching and Extracting Data from Files Objective Summary Piping and redirection Partial POSIX Command Line and Redirection Command Line Pipes

More information

CSE 374 Programming Concepts & Tools. Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup

CSE 374 Programming Concepts & Tools. Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup CSE 374 Programming Concepts & Tools Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup Where we are Learned how to use the shell to run, combine, and write programs

More information

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26,

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26, Part III Shell Config Compact Course @ Max-Planck, February 16-26, 2015 33 Special Directories. current directory.. parent directory ~ own home directory ~user home directory of user ~- previous directory

More information

PESIT Bangalore South Campus

PESIT Bangalore South Campus INTERNAL ASSESSMENT TEST - III Date : 09-11-2015 Marks : 0 Subject & Code : USP & 15CS36 Class : III ISE A & B Name of faculty : Prof. Ajoy Kumar Note: Solutions to ALL Questions Questions 1 a. Explain

More information

Regular Expressions. Todd Kelley CST8207 Todd Kelley 1

Regular Expressions. Todd Kelley CST8207 Todd Kelley 1 Regular Expressions Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 POSIX character classes Some Regular Expression gotchas Regular Expression Resources Assignment 3 on Regular Expressions

More information

Windshield. Language Reference Manual. Columbia University COMS W4115 Programming Languages and Translators Spring Prof. Stephen A.

Windshield. Language Reference Manual. Columbia University COMS W4115 Programming Languages and Translators Spring Prof. Stephen A. Windshield Language Reference Manual Columbia University COMS W4115 Programming Languages and Translators Spring 2007 Prof. Stephen A. Edwards Team members Wei-Yun Ma wm2174 wm2174@columbia.edu Tony Wang

More information

Topic 6: A Quick Intro To C

Topic 6: A Quick Intro To C Topic 6: A Quick Intro To C Assumption: All of you know Java. Much of C syntax is the same. Also: Many of you have used C or C++. Goal for this topic: you can write & run a simple C program basic functions

More information

- c list The list specifies character positions.

- c list The list specifies character positions. CUT(1) BSD General Commands Manual CUT(1)... 1 PASTE(1) BSD General Commands Manual PASTE(1)... 3 UNIQ(1) BSD General Commands Manual UNIQ(1)... 5 HEAD(1) BSD General Commands Manual HEAD(1)... 7 TAIL(1)

More information

CSE 303 Lecture 7. Regular expressions, egrep, and sed. read Linux Pocket Guide pp , 73-74, 81

CSE 303 Lecture 7. Regular expressions, egrep, and sed. read Linux Pocket Guide pp , 73-74, 81 CSE 303 Lecture 7 Regular expressions, egrep, and sed read Linux Pocket Guide pp. 66-67, 73-74, 81 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 discuss reading #2 Lecture summary regular

More information

Advanced Linux Commands & Shell Scripting

Advanced Linux Commands & Shell Scripting Advanced Linux Commands & Shell Scripting Advanced Genomics & Bioinformatics Workshop James Oguya Nairobi, Kenya August, 2016 Man pages Most Linux commands are shipped with their reference manuals To view

More information

Regular expressions: Text editing and Advanced manipulation. HORT Lecture 4 Instructor: Kranthi Varala

Regular expressions: Text editing and Advanced manipulation. HORT Lecture 4 Instructor: Kranthi Varala Regular expressions: Text editing and Advanced manipulation HORT 59000 Lecture 4 Instructor: Kranthi Varala Simple manipulations Tabular data files can be manipulated at a columnlevel. cut: Divide file

More information

Table Of Contents. 1. Zoo Information a. Logging in b. Transferring files 2. Unix Basics 3. Homework Commands

Table Of Contents. 1. Zoo Information a. Logging in b. Transferring files 2. Unix Basics 3. Homework Commands Table Of Contents 1. Zoo Information a. Logging in b. Transferring files 2. Unix Basics 3. Homework Commands Getting onto the Zoo Type ssh @node.zoo.cs.yale.edu, and enter your netid pass when prompted.

More information

Understanding Regular Expressions, Special Characters, and Patterns

Understanding Regular Expressions, Special Characters, and Patterns APPENDIXA Understanding Regular Expressions, Special Characters, and Patterns This appendix describes the regular expressions, special or wildcard characters, and patterns that can be used with filters

More information

Grep and Shell Programming

Grep and Shell Programming Grep and Shell Programming Comp-206 : Introduction to Software Systems Lecture 7 Alexandre Denault Computer Science McGill University Fall 2006 Teacher's Assistants Michael Hawker Monday, 14h30 to 16h30

More information

Command Line Interface The basics

Command Line Interface The basics Command Line Interface The basics Marco Berghoff, SCC, KIT Steinbuch Centre for Computing (SCC) Funding: www.bwhpc-c5.de Motivation In the Beginning was the Command Line by Neal Stephenson In contrast

More information

CSE 390a Lecture 7. Regular expressions, egrep, and sed

CSE 390a Lecture 7. Regular expressions, egrep, and sed CSE 390a Lecture 7 Regular expressions, egrep, and sed slides created by Marty Stepp, modified by Jessica Miller and Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture summary regular expression

More information

File Commands. Objectives

File Commands. Objectives File Commands Chapter 2 SYS-ED/Computer Education Techniques, Inc. 2: 1 Objectives You will learn: Purpose and function of file commands. Interrelated usage of commands. SYS-ED/Computer Education Techniques,

More information

Linux Bootcamp Fall 2015

Linux Bootcamp Fall 2015 Linux Bootcamp Fall 2015 UWB CSS Based on: http://swcarpentry.github.io/shell-novice "Software Carpentry" and the Software Carpentry logo are registered trademarks of NumFOCUS. What this bootcamp is: A

More information

Shell Programming Overview

Shell Programming Overview Overview Shell programming is a way of taking several command line instructions that you would use in a Unix command prompt and incorporating them into one program. There are many versions of Unix. Some

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

CS Advanced Unix Tools & Scripting

CS Advanced Unix Tools & Scripting & Scripting Spring 2011 Hussam Abu-Libdeh Today s slides are from David Slater February 25, 2011 Hussam Abu-Libdeh Today s slides are from David Slater & Scripting Random Bash Tip of the Day The more you

More information

Perl Regular Expressions. Perl Patterns. Character Class Shortcuts. Examples of Perl Patterns

Perl Regular Expressions. Perl Patterns. Character Class Shortcuts. Examples of Perl Patterns Perl Regular Expressions Unlike most programming languages, Perl has builtin support for matching strings using regular expressions called patterns, which are similar to the regular expressions used in

More information

Fundamentals of Programming Session 4

Fundamentals of Programming Session 4 Fundamentals of Programming Session 4 Instructor: Reza Entezari-Maleki Email: entezari@ce.sharif.edu 1 Fall 2011 These slides are created using Deitel s slides, ( 1992-2010 by Pearson Education, Inc).

More information

UNIX II:grep, awk, sed. October 30, 2017

UNIX II:grep, awk, sed. October 30, 2017 UNIX II:grep, awk, sed October 30, 2017 File searching and manipulation In many cases, you might have a file in which you need to find specific entries (want to find each case of NaN in your datafile for

More information

System & Network Engineering. Regular Expressions ESA 2008/2009. Mark v/d Zwaag, Eelco Schatborn 22 september 2008

System & Network Engineering. Regular Expressions ESA 2008/2009. Mark v/d Zwaag, Eelco Schatborn 22 september 2008 1 Regular Expressions ESA 2008/2009 Mark v/d Zwaag, Eelco Schatborn eelco@os3.nl 22 september 2008 Today: Regular1 Expressions and Grammars Formal Languages Context-free grammars; BNF, ABNF Unix Regular

More information

Vi & Shell Scripting

Vi & Shell Scripting Vi & Shell Scripting Comp-206 : Introduction to Week 3 Joseph Vybihal Computer Science McGill University Announcements Sina Meraji's office hours Trottier 3rd floor open area Tuesday 1:30 2:30 PM Thursday

More information

Wildcards and Regular Expressions

Wildcards and Regular Expressions CSCI 2132: Software Development Wildcards and Regular Expressions Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Searching Problem: Find all files whose names match a certain

More information

CSE 374 Midterm Exam 11/2/15 Sample Solution. Question 1. (10 points) Suppose the following files and subdirectories exist in a directory:

CSE 374 Midterm Exam 11/2/15 Sample Solution. Question 1. (10 points) Suppose the following files and subdirectories exist in a directory: Question 1. (10 points) Suppose the following files and subdirectories exist in a directory:.bashrc.emacs.bash_profile proj proj/data proj/data/dict.txt proj/data/smalldict.txt proj/notes proj/notes/todo.txt

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011

Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Last time Compiling software and the three-step procedure (./configure && make && make install). Dependency hell and

More information

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP Unix Guide Meher Krishna Patel Created on : Octorber, 2017 Last updated : December, 2017 More documents are freely available at PythonDSP Table of contents Table of contents i 1 Unix commands 1 1.1 Unix

More information

CS/IT 114 Introduction to Java, Part 1 FALL 2016 CLASS 3: SEP. 13TH INSTRUCTOR: JIAYIN WANG

CS/IT 114 Introduction to Java, Part 1 FALL 2016 CLASS 3: SEP. 13TH INSTRUCTOR: JIAYIN WANG CS/IT 114 Introduction to Java, Part 1 FALL 2016 CLASS 3: SEP. 13TH INSTRUCTOR: JIAYIN WANG 1 Notice Reading Assignment Chapter 1: Introduction to Java Programming Homework 1 It is due this coming Sunday

More information

UNIX, GNU/Linux and simple tools for data manipulation

UNIX, GNU/Linux and simple tools for data manipulation UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka

More information

Access Intermediate

Access Intermediate Access 2013 - Intermediate 103-134 Advanced Queries Quick Links Overview Pages AC124 AC125 Selecting Fields Pages AC125 AC128 AC129 AC131 AC238 Sorting Results Pages AC131 AC136 Specifying Criteria Pages

More information

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking

More information

UNIX / LINUX - REGULAR EXPRESSIONS WITH SED

UNIX / LINUX - REGULAR EXPRESSIONS WITH SED UNIX / LINUX - REGULAR EXPRESSIONS WITH SED http://www.tutorialspoint.com/unix/unix-regular-expressions.htm Copyright tutorialspoint.com Advertisements In this chapter, we will discuss in detail about

More information

CSC UNIX System, Spring 2015

CSC UNIX System, Spring 2015 CSC 352 - UNIX System, Spring 2015 Study guide for the CSC352 midterm exam (20% of grade). Dr. Dale E. Parson, http://faculty.kutztown.edu/parson We will have a midterm on March 19 on material we have

More information

Advanced training. Linux components Command shell. LiLux a.s.b.l.

Advanced training. Linux components Command shell. LiLux a.s.b.l. Advanced training Linux components Command shell LiLux a.s.b.l. alexw@linux.lu Kernel Interface between devices and hardware Monolithic kernel Micro kernel Supports dynamics loading of modules Support

More information

CST Lab #5. Student Name: Student Number: Lab section:

CST Lab #5. Student Name: Student Number: Lab section: CST8177 - Lab #5 Student Name: Student Number: Lab section: Working with Regular Expressions (aka regex or RE) In-Lab Demo - List all the non-user accounts in /etc/passwd that use /sbin as their home directory.

More information

Useful Unix Commands Cheat Sheet

Useful Unix Commands Cheat Sheet Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List

More information

Python allows variables to hold string values, just like any other type (Boolean, int, float). So, the following assignment statements are valid:

Python allows variables to hold string values, just like any other type (Boolean, int, float). So, the following assignment statements are valid: 1 STRINGS Objectives: How text data is internally represented as a string Accessing individual characters by a positive or negative index String slices Operations on strings: concatenation, comparison,

More information

Mineração de Dados Aplicada

Mineração de Dados Aplicada Simple but Powerful Text-Processing Commands August, 29 th 2018 DCC ICEx UFMG Unix philosophy Unix philosophy Doug McIlroy (inventor of Unix pipes). In A Quarter-Century of Unix (1994): Write programs

More information

Open up a terminal, make sure you are in your home directory, and run the command.

Open up a terminal, make sure you are in your home directory, and run the command. More Linux Commands 0.1 wc The Linux command for acquiring size statistics on a file is wc. This command can provide information from line count, to bytes in a file. Open up a terminal, make sure you are

More information

Module 3: New types of data

Module 3: New types of data Module 3: New types of data Readings: Sections 4 and 5 of HtDP. A Racket program applies functions to values to compute new values. These new values may in turn be supplied as arguments to other functions.

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

Understanding bash. Prof. Chris GauthierDickey COMP 2400, Fall 2008

Understanding bash. Prof. Chris GauthierDickey COMP 2400, Fall 2008 Understanding bash Prof. Chris GauthierDickey COMP 2400, Fall 2008 How does bash start? It begins by reading your configuration files: If it s an interactive login-shell, first /etc/profile is executed,

More information

Essentials for Scientific Computing: Bash Shell Scripting Day 3

Essentials for Scientific Computing: Bash Shell Scripting Day 3 Essentials for Scientific Computing: Bash Shell Scripting Day 3 Ershaad Ahamed TUE-CMS, JNCASR May 2012 1 Introduction In the previous sessions, you have been using basic commands in the shell. The bash

More information

CSE II-Sem)

CSE II-Sem) 1 2 a) Login to the system b) Use the appropriate command to determine your login shell c) Use the /etc/passwd file to verify the result of step b. d) Use the who command and redirect the result to a file

More information

Unix for Developers grep, sed, awk

Unix for Developers grep, sed, awk Unix for Developers grep, sed, Benedict Reuschling November 30, 2017 1 / 56 Overview In this part of the lecture we will look at grep, sed, and as tools for processing and analyzing of data. 2 / 56 grep

More information

CpSc 1011 Lab 5 Conditional Statements, Loops, ASCII code, and Redirecting Input Characters and Hurricanes

CpSc 1011 Lab 5 Conditional Statements, Loops, ASCII code, and Redirecting Input Characters and Hurricanes CpSc 1011 Lab 5 Conditional Statements, Loops, ASCII code, and Redirecting Input Characters and Hurricanes Overview For this lab, you will use: one or more of the conditional statements explained below

More information

Lecture 5. Additional useful commands. COP 3353 Introduction to UNIX

Lecture 5. Additional useful commands. COP 3353 Introduction to UNIX Lecture 5 Additional useful commands COP 3353 Introduction to UNIX diff diff compares two text files ( can also be used on directories) and prints the lines for which the files differ. The format is as

More information

More Scripting and Regular Expressions. Todd Kelley CST8207 Todd Kelley 1

More Scripting and Regular Expressions. Todd Kelley CST8207 Todd Kelley 1 More Scripting and Regular Expressions Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 Regular Expression Summary Regular Expression Examples Shell Scripting 2 Do not confuse filename globbing

More information

Regular Expressions. with a brief intro to FSM Systems Skills in C and Unix

Regular Expressions. with a brief intro to FSM Systems Skills in C and Unix Regular Expressions with a brief intro to FSM 15-123 Systems Skills in C and Unix Case for regular expressions Many web applications require pattern matching look for tag for links Token search

More information

A Big Step. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers

A Big Step. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers A Big Step Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers Copyright 2006 2009 Stewart Weiss What a shell really does Here is the scoop on shells. A shell is a program

More information

Introduction to Scripting using bash

Introduction to Scripting using bash Introduction to Scripting using bash Scripting versus Programming (from COMP10120) You may be wondering what the difference is between a script and a program, or between the idea of scripting languages

More information

CSE 374 Midterm Exam 11/2/15. Name Id #

CSE 374 Midterm Exam 11/2/15. Name Id # Name Id # There are 8 questions worth a total of 100 points. Please budget your time so you get to all of the questions. Keep your answers brief and to the point. The exam is closed book, closed notes,

More information

Regular Expressions. Regular Expression Syntax in Python. Achtung!

Regular Expressions. Regular Expression Syntax in Python. Achtung! 1 Regular Expressions Lab Objective: Cleaning and formatting data are fundamental problems in data science. Regular expressions are an important tool for working with text carefully and eciently, and are

More information

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words More Linux Commands 1 wc The Linux command for acquiring size statistics on a file is wc. This command provides the line count, word count and number of bytes in a file. Open up a terminal, make sure you

More information

IB047. Unix Text Tools. Pavel Rychlý Mar 3.

IB047. Unix Text Tools. Pavel Rychlý Mar 3. Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):

More information

CSE 15L Winter Midterm :) Review

CSE 15L Winter Midterm :) Review CSE 15L Winter 2015 Midterm :) Review Makefiles Makefiles - The Overview Questions you should be able to answer What is the point of a Makefile Why don t we just compile it again? Why don t we just use

More information

Introduction to Linux Spring 2014, Section 02, Lecture 3 Jason Tang

Introduction to Linux Spring 2014, Section 02, Lecture 3 Jason Tang Introduction to Linux Spring 2014, Section 02, Lecture 3 Jason Tang Topics What is an Operating System Overview of Linux Linux commands Shell Submit system What is an Operating System? Special type of

More information

Lecture 3 Tonight we dine in shell. Hands-On Unix System Administration DeCal

Lecture 3 Tonight we dine in shell. Hands-On Unix System Administration DeCal Lecture 3 Tonight we dine in shell Hands-On Unix System Administration DeCal 2012-09-17 Review $1, $2,...; $@, $*, $#, $0, $? environment variables env, export $HOME, $PATH $PS1=n\[\e[0;31m\]\u\[\e[m\]@\[\e[1;34m\]\w

More information

Scripting. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers

Scripting. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers Scripting Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers Adapted from Practical Unix and Programming Hunter College Copyright 2006 2009 Stewart Weiss What a shell

More information

Std: XI CHAPTER-3 LINUX

Std: XI CHAPTER-3 LINUX Commands: General format: Command Option Argument Command: ls - Lists the contents of a file. Option: Begins with minus sign (-) ls a Lists including the hidden files. Argument refers to the name of a

More information

CSE 303, Winter 2007, Midterm Examination 9 February Please do not turn the page until everyone is ready.

CSE 303, Winter 2007, Midterm Examination 9 February Please do not turn the page until everyone is ready. CSE 303, Winter 2007, Midterm Examination 9 February 2007 Please do not turn the page until everyone is ready. Rules: The exam is closed-book, closed-note, except for one 8.5x11in piece of paper (both

More information

Access Intermediate

Access Intermediate Access 2010 - Intermediate 103-134 Advanced Queries Quick Links Overview Pages AC116 AC117 Selecting Fields Pages AC118 AC119 AC122 Sorting Results Pages AC125 AC126 Specifying Criteria Pages AC132 AC134

More information

Regex, Sed, Awk. Arindam Fadikar. December 12, 2017

Regex, Sed, Awk. Arindam Fadikar. December 12, 2017 Regex, Sed, Awk Arindam Fadikar December 12, 2017 Why Regex Lots of text data. twitter data (social network data) government records web scrapping many more... Regex Regular Expressions or regex or regexp

More information

psed [-an] script [file...] psed [-an] [-e script] [-f script-file] [file...]

psed [-an] script [file...] psed [-an] [-e script] [-f script-file] [file...] NAME SYNOPSIS DESCRIPTION OPTIONS psed - a stream editor psed [-an] script [file...] psed [-an] [-e script] [-f script-file] [file...] s2p [-an] [-e script] [-f script-file] A stream editor reads the input

More information