ab FirePlex mirna Panel Neurology V2

Size: px
Start display at page:

Download "ab FirePlex mirna Panel Neurology V2"

Transcription

1 Version 1 Last updated 8 March 2017 ab FirePlex mirna Panel Neurology V2 This product is for research use only and is not intended for diagnostic use. Copyright 2017 Abcam. All rights reserved. FirePlex

2 Table of Contents 1. Overview 2 2. FirePlex mirna Panel Neurology V Notes 6 ab mirna Panel Neurology V2 1

3 1. Overview The FirePlex Neurology panel has been designed to profile expression of 65 mirnas differentially regulated in normal and abnormal neurological or psychiatric health. Our multiplex mirna assays use our FirePlex particle technology to profile up to 65 mirnas per well. With the same sensitivity as PCR, they can be used either directly with 10 µl of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA. For a full list of validated sample types, and to learn more about the performance and requirements of these assays, visit These mirnas have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes. Included in the panel are general markers for multiple neurologyrelated diseases, markers specific to specific nervous system diseases and CNS cancers, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance. It is important to use the normalization procedure in the FirePlex Analysis Workbench Software to identify the mirnas that can optimally be used for normalization with your samples. Three mirnas that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel. ab mirna Panel Neurology V2 2

4 2. FirePlex mirna Panel Neurology V2 To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab for use with purified RNA or ab for use with biofluids (see these kits for the full assay protocol). FirePlex is a registered trade mark in the United States and is an unregistered trade mark elsewhere. This product is currently only supported for customers in North America, Japan and Europe, if you are outside these areas please contact us. ** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans. # mirna 21 name mirna Sequence (mirbase V21) Sequence homology ** MIMAT ID 1 hsa-let-7b-5p ugagguaguagguugugugguu Hu, Ms, Rt MIMAT hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT hsa-let-7f-5p ugagguaguagauuguauaguu Hu, Ms, Rt MIMAT hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT hsa-mir-103a-3p agcagcauuguacagggcuauga Hu, Ms, Rt MIMAT hsa-mir-107 agcagcauuguacagggcuauca Hu, Ms, Rt MIMAT hsa-mir-124-3p uaaggcacgcggugaaugcc Hu, Ms, Rt MIMAT hsa-mir-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT hsa-mir-128-3p ucacagugaaccggucucuuu Hu, Ms, Rt MIMAT hsa-mir p gaucucacuuuguugcccagg Hu MIMAT hsa-mir-132-3p uaacagucuacagccauggucg Hu, Ms, Rt MIMAT hsa-mir-134-5p ugugacugguugaccagagggg Hu, Ms, Rt MIMAT hsa-mir-142-3p uguaguguuuccuacuuuaugga Hu, Ms, Rt MIMAT hsa-mir-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT ab mirna Panel Neurology V2 3

5 17 hsa-mir-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT hsa-mir-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT hsa-mir-151a-3p cuagacugaagcuccuugagg Hu MIMAT hsa-mir-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT hsa-mir-15a-5p uagcagcacauaaugguuugug Hu, Ms MIMAT hsa-mir-15b-3p cgaaucauuauuugcugcucua Hu, Ms, Rt MIMAT hsa-mir-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT hsa-mir p ccaauauuacugugcugcuuua Hu MIMAT hsa-mir-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT hsa-mir-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT hsa-mir-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT hsa-mir-191-5p caacggaaucccaaaagcagcug Hu, Ms, Rt MIMAT hsa-mir-195-5p uagcagcacagaaauauuggc Hu, Ms, Rt MIMAT hsa-mir-197-3p uucaccaccuucuccacccagc Hu MIMAT hsa-mir-206 uggaauguaaggaagugugugg Hu, Ms, Rt MIMAT hsa-mir-20a-5p uaaagugcuuauagugcagguag Hu, Ms, Rt MIMAT hsa-mir-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT hsa-mir-214-3p acagcaggcacagacaggcagu Hu, Ms MIMAT hsa-mir-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT hsa-mir-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT hsa-mir-23a-3p aucacauugccagggauuucc Hu, Ms, Rt MIMAT hsa-mir-24-3p uggcucaguucagcaggaacag Hu, Ms, Rt MIMAT hsa-mir-26b-5p uucaaguaauucaggauaggu Hu, Ms, Rt MIMAT hsa-mir-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT hsa-mir-301a-3p cagugcaauaguauugucaaagc Hu, Ms, Rt MIMAT hsa-mir-30e-5p uguaaacauccuugacuggaag Hu, Ms, Rt MIMAT hsa-mir-323a-3p cacauuacacggucgaccucu Hu, Ms, Rt MIMAT hsa-mir-328-3p cuggcccucucugcccuuccgu Hu, Ms, Rt MIMAT hsa-mir-331-5p cuagguauggucccagggaucc Hu, Ms MIMAT hsa-mir-338-3p uccagcaucagugauuuuguug Hu, Ms MIMAT hsa-mir-342-3p ucucacacagaaaucgcacccgu Hu, Ms, Rt MIMAT hsa-mir-346 ugucugcccgcaugccugccucu Hu MIMAT hsa-mir-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT ab mirna Panel Neurology V2 4

6 51 hsa-mir-34b-3p caaucacuaacuccacugccau Hu MIMAT hsa-mir-34c-5p aggcaguguaguuagcugauugc Hu, Ms, Rt MIMAT hsa-mir-370-3p gccugcugggguggaaccuggu Hu, Ms, Rt MIMAT hsa-mir-382-5p gaaguuguucgugguggauucg Hu, Ms, Rt MIMAT hsa-mir-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT hsa-mir-483-3p ucacuccucuccucccgucuu Hu MIMAT hsa-mir-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT hsa-mir-491-5p aguggggaacccuuccaugagg Hu, Ms MIMAT hsa-mir-497-5p cagcagcacacugugguuugu Hu MIMAT hsa-mir p uuuugugucucccauuccccag Hu MIMAT hsa-mir-532-5p caugccuugaguguaggaccgu Hu, Ms MIMAT hsa-mir-545-3p ucagcaaacauuuauugugugc Hu, Ms, Rt MIMAT hsa-mir-7-5p uggaagacuagugauuuuguugu Hu, Ms, Rt MIMAT oan-mir p uuccccacucugagcacacagc Oan MIMAT hsa-mir-885-5p uccauuacacuacccugccucu Hu MIMAT hsa-mir-92a-1-5p agguugggaucgguugcaaugcu Hu MIMAT hsa-mir-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT hsa-mir-98-5p ugagguaguaaguuguauuguu Hu, Ms, Rt MIMAT x-control x-control N/A 70 blank blank N/A ab mirna Panel Neurology V2 5

7 3. Notes ab mirna Panel Neurology V2 6

8 Technical Support Copyright 2017 Abcam, All Rights Reserved. The Abcam logo is a registered trademark. All information / detail is correct at time of going to print. Austria wissenschaftlicherdienst@abcam.com France supportscientifique@abcam.com Germany wissenschaftlicherdienst@abcam.com Spain soportecientifico@abcam.com Switzerland technical@abcam.com Deutsch: Français: UK, EU and ROW technical@abcam.com +44(0) Canada ca.technical@abcam.com US and Latin America us.technical@abcam.com Asia Pacific hk.technical@abcam.com (852) China cn.technical@abcam.com Japan technical@abcam.co.jp +81-(0) Singapore sg.technical@abcam.com Australia au.technical@abcam.com +61-(0) New Zealand nz.technical@abcam.com +64-(0) Copyright 2017 Abcam. All rights reserved. FirePlex

ab FirePlex mirna Panel Immunology V2

ab FirePlex mirna Panel Immunology V2 Version 1 Last updated 8 March 2017 ab218369 FirePlex mirna Panel Immunology V2 This product is for research use only and is not intended for diagnostic use. Copyright 2017 Abcam. All rights reserved.

More information

BCA protein assay kit for low concentrations. For measuring total protein concentration of pure proteins, extracts or lysates.

BCA protein assay kit for low concentrations. For measuring total protein concentration of pure proteins, extracts or lysates. ab207002 BCA protein assay kit for low concentrations Instructions for use: For measuring total protein concentration of pure proteins, extracts or lysates. This product is for research use only and is

More information

ab BCA protein assay kit reducing agent compatible (test tube)

ab BCA protein assay kit reducing agent compatible (test tube) ab207004 BCA protein assay kit reducing agent compatible (test tube) Instructions for use: For measuring total protein concentration of pure proteins, extracts or lysates in the presence of reducing agents.

More information

Power Analyzer Firmware Update Utility Version Software Release Notes

Power Analyzer Firmware Update Utility Version Software Release Notes Power Analyzer Firmware Update Utility Version 3.1.0 Software Release Notes Contents General Information... 2... 2 Supported models... 2 Minimum system requirements... 2 Installation instructions... 2

More information

Agilent N8300A Wireless Networking Test Set N630XA Measurement Applications and N7300 Series Chipset Software

Agilent N8300A Wireless Networking Test Set N630XA Measurement Applications and N7300 Series Chipset Software Agilent N8300A Wireless Networking Test Set N630XA Measurement Applications and N7300 Series Chipset Software Configuration Guide Introduction The Agilent N8300A wireless networking test set is a one-box

More information

Safety. Introduction

Safety. Introduction KickStart Guide Safety Introduction Safety precautions Before using this product, see the safety precautions associated with your instrument. The instrumentation associated with this software is intended

More information

Step 1: New Portal User User ID Created Using IdentityIQ (IIQ)

Step 1: New Portal User User ID Created Using IdentityIQ (IIQ) Rockwell Automation PartnerNetwork Portal Single Sign-on (SSO) Login to Rockwell Automation PartnerNewtork Portal for Commercial Programs Participants Scope: This job aid provides instructions on how to

More information

I 2 C and SPI Protocol Triggering and Decode for Infiniium 8000 and Series Oscilloscopes

I 2 C and SPI Protocol Triggering and Decode for Infiniium 8000 and Series Oscilloscopes I 2 C and SPI Protocol Triggering and Decode for Infiniium 8000 and 90000 Series Oscilloscopes Data sheet This application is available in the following license variations. Order N5391A for a user-installed

More information

Thermo Scientific Samco Transfer Pipettes. Precisely what you need

Thermo Scientific Samco Transfer Pipettes. Precisely what you need Thermo Scientific Samco Transfer Pipettes Precisely what you need Application Guide LIFE SCIENCE APPLICATIONS INDUSTRIAL, RESEARCH AND TESTING CLINICAL APPLICATIONS Top 9 Pipettes: 6, 3, 5, 20, 23, 24,

More information

Uploading protocols and Assay Control Sets to the QIAsymphony SP via the USB stick

Uploading protocols and Assay Control Sets to the QIAsymphony SP via the USB stick Uploading protocols and Assay Control Sets to the QIAsymphony SP via the USB stick This document describes how to upload protocols and Assay Control Sets to the QIAsymphony SP using the USB stick supplied

More information

UK's Chartered Civil Engineers and their recognition in Europe and beyond. David Lloyd-Roach Director of Membership

UK's Chartered Civil Engineers and their recognition in Europe and beyond. David Lloyd-Roach Director of Membership UK's Chartered Civil Engineers and their recognition in Europe and beyond David Lloyd-Roach Director of Membership INSTITUTION OF CIVIL ENGINEERS Founded in 1818, ICE has become recognised worldwide for

More information

Agilent E5061B Network Analyzer. Configuration Guide

Agilent E5061B Network Analyzer. Configuration Guide Agilent E5061B Network Analyzer Configuration Guide Ordering guide The following steps will guide you through configuring your E5061B. Standard furnished item Description Installation guide CD ROM IO libraries

More information

Agilent Noise Source Calibration Using the Agilent N8975A Noise Figure Analyzer and the N2002A Noise Source Test Set. Product Note

Agilent Noise Source Calibration Using the Agilent N8975A Noise Figure Analyzer and the N2002A Noise Source Test Set. Product Note Agilent Noise Source Calibration Using the Agilent N8975A Noise Figure Analyzer and the N2002A Noise Source Test Set Product Note Table of Contents Introduction.....................................................................................

More information

Agilent E363xA Series Programmable DC Power Supplies. Data Sheet

Agilent E363xA Series Programmable DC Power Supplies. Data Sheet Agilent E363xA Series Programmable DC Power Supplies Data Sheet Reliable Power, Repeatable Results Single and triple output 80 W to 200 W output power Dual range output Low noise and excellent regulation

More information

Traffic Offload. Cisco 7200/Cisco 7500 APPLICATION NOTE

Traffic Offload. Cisco 7200/Cisco 7500 APPLICATION NOTE APPLICATION NOTE Cisco 700/Cisco 700 Traffic offload allows exchange carriers to offload their telephony traffic to a packet network from the Public Switched Telephone Network (PSTN). By doing so, carriers

More information

Agilent U8000 Series Single Output DC Power Supplies. Data Sheet

Agilent U8000 Series Single Output DC Power Supplies. Data Sheet Agilent U8000 Series Single Output DC Power Supplies Data Sheet Key Features Excellent load and line regulation: (CV:

More information

PCI Express Protocol Triggering and Decode for Infiniium 9000 Series Oscilloscopes

PCI Express Protocol Triggering and Decode for Infiniium 9000 Series Oscilloscopes PCI Express Protocol Triggering and Decode for Infiniium 9000 Series Oscilloscopes Data sheet This application is available in the following license variations. Order N5463B for a user-installed license

More information

International Business Mail Rate Card

International Business Mail Rate Card International Business Mail Rate Card Effective from 3rd January 2017 International Business Mail International Business Mail is a service with a range of sorting and delivery options which covers Letters,

More information

Agilent U2751A USB Modular Switch Matrix. Data Sheet

Agilent U2751A USB Modular Switch Matrix. Data Sheet Agilent U2751A USB Modular Switch Matrix Data Sheet Features and capabilities 32 two-wire crosspoints in 4x8 configuration Minimal crosstalk at up to 45 MHz Bandwidth of 45 MHz without the terminal block

More information

Keysight E5063A ENA Series Network Analyzer

Keysight E5063A ENA Series Network Analyzer Keysight E5063A ENA Series Network Analyzer 100 khz to 500 M/1.5 G/3 G/4.5 G/6.5 G/8.5 G/14 G/18 GHz Configuration Guide 02 Keysight E5063A ENA Series Network Analyzer - Configuration Guide Ordering Guide

More information

U85026A Detector 40 to 60 GHz

U85026A Detector 40 to 60 GHz Operating and Service Manual U85026A Detector 40 to 60 GHz Serial Numbers This manual applies directly to U85026A detectors with serial numbers 100 and above. For additional information on serial numbers,

More information

Content Delivery Network (CDN) - Global Market Outlook ( )

Content Delivery Network (CDN) - Global Market Outlook ( ) Published on Market Research Reports Inc. (https://www.marketresearchreports.com) Home > Content Delivery Network (CDN) - Global Market Outlook (2015-2022) Content Delivery Network (CDN) - Global Market

More information

Items exceeding one or more of the maximum weight and dimensions of a flat. For maximum dimensions please see the service user guide.

Items exceeding one or more of the maximum weight and dimensions of a flat. For maximum dimensions please see the service user guide. Rate Card International Flats Effective from 2 April 2013 Pricing your mail Once you have selected the service you wish to use, calculate the price using the tables on the following pages. For more information

More information

International Packets

International Packets Rate Card International Packets Effective from 2 April 2013 Pricing your mail Once you have selected the service you wish to use, calculate the price using the tables on the following pages. For more information

More information

END-OF-SALE AND END-OF-LIFE ANNOUNCEMENT FOR THE CISCO MEDIA CONVERGENCE SERVER 7845H-2400

END-OF-SALE AND END-OF-LIFE ANNOUNCEMENT FOR THE CISCO MEDIA CONVERGENCE SERVER 7845H-2400 END-OF-LIFE NOTICE, NO. 2566 END-OF-SALE AND END-OF-LIFE ANNOUNCEMENT FOR THE CISCO MEDIA CONVERGENCE SERVER 7845H-2400 Cisco Systems announces the end of life of the Cisco Media Convergence Server 7845H-2400.

More information

Keysight N2753A and N2754A Windows XP to Windows 7 Upgrade Kits For Infiniium 9000, 90000, and X-Series Oscilloscopes. Configuration Guide

Keysight N2753A and N2754A Windows XP to Windows 7 Upgrade Kits For Infiniium 9000, 90000, and X-Series Oscilloscopes. Configuration Guide Keysight N2753A and N2754A Windows XP to Windows 7 Upgrade Kits For Infiniium 9000, 90000, and 90000 X-Series Oscilloscopes Configuration Guide 02 Keysight N2753A and N2754A Windows XP to Windows 7 Upgrade

More information

Agilent E36XXA Series Non-Programmable DC Power Supplies. Data Sheet

Agilent E36XXA Series Non-Programmable DC Power Supplies. Data Sheet Agilent E36XXA Series Non-Programmable DC Power Supplies Data Sheet Reliable Power, Repeatable Results Linear power supply Single, dual or triple output 10-turn voltage and current control Low noise and

More information

N7624B Signal Studio for LTE Technical Overview

N7624B Signal Studio for LTE Technical Overview N7624B Signal Studio for LTE Technical Overview Easily Create Sophisticated LTE Test Waveforms 3GPP Long Term Evolution (LTE) defines improvements to UMTS to provide increased system efficiency, including

More information

Programming Note. Agilent Technologies Quick Reference Guide For the 8757D/E Scalar Network Analyzer

Programming Note. Agilent Technologies Quick Reference Guide For the 8757D/E Scalar Network Analyzer Programming Note Agilent Technologies Quick Reference Guide For the 8757D/E Scalar Network Analyzer Manufacturing Part Number: 08757-90130 Printed in USA Print Date: July 1992 Agilent Technologies, Inc.

More information

Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes

Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes N5395B Ethernet Electrical Conformance Test Fixture N5396A Gigabit Ethernet Jitter

More information

Software Capabilities

Software Capabilities pickering Software Capabilities Reliability Diversity Compatibility In test system development, the best hardware is only usable if its software control environment is robust and easy to use. If you are

More information

The Economist rate card 2017 (GBP)

The Economist rate card 2017 (GBP) The Economist rate card 2017 (GBP) The Economist newspaper, Digital Editions app, Snapchat, and Global Business Review The Economist allows you to reach our influential audience through print and our award

More information

Troubleshooting Ethernet Problems with Your Oscilloscope APPLICATION NOTE

Troubleshooting Ethernet Problems with Your Oscilloscope APPLICATION NOTE Troubleshooting Ethernet Problems with Your Oscilloscope Introduction Ethernet is a family of frame-based computer networking technologies for local area networks (LANs), initially developed at Xerox PARC

More information

Investing in Japan Speech by Shuichi Hirano Managing Director, JETRO Sydney. Copyright (C) 2015 JETRO. All rights reserved.

Investing in Japan Speech by Shuichi Hirano Managing Director, JETRO Sydney. Copyright (C) 2015 JETRO. All rights reserved. Investing in Japan Speech by Shuichi Hirano Managing Director, JETRO Sydney Copyright (C) 2015 JETRO. All rights reserved. Australian companies in Japan 2 Copyright (C) 2015 JETRO. All rights reserved.

More information

Bio-Rad Laboratories AUTOIMMUNE TESTING. System. PhD. IFA and EIA Instrumentation. One revolutionary platform, two technologies

Bio-Rad Laboratories AUTOIMMUNE TESTING. System. PhD. IFA and EIA Instrumentation. One revolutionary platform, two technologies Bio-Rad Laboratories AUTOIMMUNE TESTING IFA and EIA Instrumentation One revolutionary platform, two technologies Bio-Rad Laboratories AUTOIMMUNE TESTING Autoimmune IFA and EIA testing Flexibility, efficiency

More information

MEXICO (52) NETHERLANDS (31) SINGAPORE (65) SOUTH AFRICA (27) / 5 SPAIN (34)

MEXICO (52) NETHERLANDS (31) SINGAPORE (65) SOUTH AFRICA (27) / 5 SPAIN (34) WORLDCLASS GLOBAL SUPPORT AUSTRALIA (61) 2 9844 6000 GERMANY (49) 2151 333 625 MEXICO (52) 5 559 1635 SWEDEN (46) 8 564 85900 CANADA (1) 905 819 1234 HONG KONG (852) 2814 7431 NETHERLANDS (31) 2972 30630

More information

Indexed Sequencing. Overview Guide

Indexed Sequencing. Overview Guide Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read

More information

Keysight Technologies RS232/UART Protocol Triggering and Decode for Infiniium Series Oscilloscopes. Data Sheet

Keysight Technologies RS232/UART Protocol Triggering and Decode for Infiniium Series Oscilloscopes. Data Sheet Keysight Technologies RS232/UART Protocol Triggering and Decode for Infiniium 90000 Series Oscilloscopes Data Sheet This application is available in the following license variations. Order N5462A for a

More information

The Economist rate card 2017 (USD)

The Economist rate card 2017 (USD) The Economist rate card 2017 (USD) The Economist newspaper, Digital Editions app, Snapchat, and Global Business Review The Economist allows you to reach our influential audience through print and our award

More information

N4010A Wireless Connectivity Test Set and N4011A MIMO/ Multi-port Adapter

N4010A Wireless Connectivity Test Set and N4011A MIMO/ Multi-port Adapter N4010A Wireless Connectivity Test Set and N4011A MIMO/ Multi-port Adapter Configuration Guide Introduction The Agilent N4010A Wireless Connectivity Test Set is a measurement solution that enables low cost

More information

Configuring LATITUDE NXT Wave Communicators. Bottom View

Configuring LATITUDE NXT Wave Communicators. Bottom View A Closer Look SUMMARY Boston Scientific s LATITUDE NXT Patient Management System enables a clinician to periodically monitor patient and device information remotely via a LATITUDE NXT Wave Communicator

More information

EVA1 grip redesign allows greater production flexibility

EVA1 grip redesign allows greater production flexibility EVA1 grip redesign allows greater production flexibility Panasonic has redesigned the hand grip of its new AU-EVA1 compact cinema camera, to allow users greater flexibility to add accessories and larger

More information

Keysight Technologies 8163B Lightwave Multimeter 8164B Lightwave Measurement System 8166B Lightwave Multichannel System.

Keysight Technologies 8163B Lightwave Multimeter 8164B Lightwave Measurement System 8166B Lightwave Multichannel System. Keysight Technologies 8163B Lightwave Multimeter 8164B Lightwave Measurement System 8166B Lightwave Multichannel System Data Sheet 02 Keysight 8163B Lightwave Multimeter, 8164B Lightwave Measurement System,

More information

Technical Note. Programming the SST-PB3-VME-x for a Master or Slave in a VME Controller. Version: 1.1 Document #:

Technical Note. Programming the SST-PB3-VME-x for a Master or Slave in a VME Controller. Version: 1.1 Document #: Technical Programming the SST-PB3-VME-x for a Master or Slave in a VME Controller Version: 1.1 Document #: 716-0014 Version: 1.1 Date: June 4, 2010 This document applies to the SST-PB3-VME-x interface

More information

Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes

Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes Agilent Technologies N5392A Ethernet Electrical Performance Validation and Conformance Software for Infiniium Oscilloscopes N5395B Ethernet Electrical Conformance Test Fixture N5396A Gigabit Ethernet Jitter

More information

Indexed Sequencing. Overview Guide

Indexed Sequencing. Overview Guide Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read

More information

Supplier Invoice Submission Guide. English

Supplier Invoice Submission Guide. English Supplier Invoice Submission Guide English Date: May 2 nd, 2017 1 Table of Contents How to submit an invoice through the SWIM... 3 How to access the SWIM... 3 Submitting a PO invoice... 4 Creating an invoice...

More information

Demo Guide. Keysight Multi-Operator with M937xA PXIe Vector Network Analyzers

Demo Guide. Keysight Multi-Operator with M937xA PXIe Vector Network Analyzers Demo Guide Keysight Multi-Operator with M937xA PXIe Vector Network Analyzers Table of Contents Preparation for Demo... 3 Equipment Requirements... 3 Setup Four Operators Configuration Using 4 x 4-Ports

More information

Global entertainment and media outlook Explore the content and tools

Global entertainment and media outlook Explore the content and tools www.pwc.com/outlook Global entertainment and media outlook Explore the content and tools A comprehensive online source of global analysis for consumer/ end-user and advertising spending 5-year forecasts

More information

Innovative Fastening Technologies

Innovative Fastening Technologies Innovative Fastening Technologies Corporate Overview 2011 Update Infastech is one of the world s largest producers of engineered mechanical fasteners with revenues exceeding USD500 million and an industry

More information

Sequence Genotyper Reference Guide

Sequence Genotyper Reference Guide Sequence Genotyper Reference Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Installation 4 Dashboard Overview 5 Projects 6 Targets 7 Samples 9 Reports 12 Revision History

More information

International Business Parcels Rate card

International Business Parcels Rate card International Business Parcels Rate card Effective from 2nd January 2018 Tracked Standard Tracked Tracked Signed Standard 1 Contents International Business Parcels services...3 International Business Tracked...4

More information

Agilent Technologies InfiniiVision MSO N5406A FPGA Dynamic Probe for Xilinx

Agilent Technologies InfiniiVision MSO N5406A FPGA Dynamic Probe for Xilinx Agilent Technologies InfiniiVision MSO N5406A FPGA Dynamic Probe for Xilinx Data Sheet Figure 1. FPGA dynamic probe for Xilinx used in conjunction with an Agilent InfiniiVision 6000 or 7000 Series MSO

More information

MarketsandMarkets. Publisher Sample

MarketsandMarkets.  Publisher Sample MarketsandMarkets http://www.marketresearch.com/marketsandmarkets-v3719/ Publisher Sample Phone: 800.298.5699 (US) or +1.240.747.3093 or +1.240.747.3093 (Int'l) Hours: Monday - Thursday: 5:30am - 6:30pm

More information

Cisco Aironet In-Building Wireless Solutions International Power Compliance Chart

Cisco Aironet In-Building Wireless Solutions International Power Compliance Chart Cisco Aironet In-Building Wireless Solutions International Power Compliance Chart ADDITIONAL INFORMATION It is important to Cisco Systems that its resellers comply with and recognize all applicable regulations

More information

Agilent Technologies Infiniium MSO8000 and MSO9000 Series N5397A FPGA Dynamic Probe for Xilinx

Agilent Technologies Infiniium MSO8000 and MSO9000 Series N5397A FPGA Dynamic Probe for Xilinx Agilent Technologies Infiniium MSO8000 and MSO9000 Series N5397A FPGA Dynamic Probe for Xilinx Data Sheet The challenge You rely on the insight a MSO (mixed-signal oscilloscope) provides to understand

More information

BD Accuri C6 with single tube loader protocol. For multiplex assays

BD Accuri C6 with single tube loader protocol. For multiplex assays BD Accuri C6 with single tube loader protocol For multiplex assays BD Accuri C6 with single tube loader protocol This protocol contains instructions for setting up an Accuri C6 with Tube Loader. If you

More information

Fast 3D EMC/EMI Scan with Detectus Scanning System and Tektronix Real Time Spectrum Analyzers CASE STUDY

Fast 3D EMC/EMI Scan with Detectus Scanning System and Tektronix Real Time Spectrum Analyzers CASE STUDY Fast 3D EMC/EMI Scan with Detectus Scanning System and Tektronix Real Time Spectrum Analyzers Fast 3D EMC/EMI Scan with Detectus Scanning System and Tektronix Real Time Spectrum Analyzers Customer Solution

More information

Keysight Technologies E4982A LCR Meter

Keysight Technologies E4982A LCR Meter Keysight Technologies E4982A LCR Meter 1 MHz to 300 MHz/500 MHz/1 GHz/3 GHz Coniguration Guide 2 Keysight E4982A LCR Meter 1 MHz to 300 MHz/500 MHz/1 GHz/3 GHz - Coniguration Guide Ordering guide The following

More information

Phone: +44 (0) or BioPortfolio Limited

Phone: +44 (0) or   BioPortfolio Limited Immunoassay Market by Technology (ELISA, Fluorescence, Colorimetric, Chemiluminescence, Rapid Test, Western Blot, ELISPOT, PCR), Application (Infectious Disease, Endocrinology, Cardiology, Oncology, Hematology),

More information

FPGA Circuit Design: Overcoming Power-Related Challenges

FPGA Circuit Design: Overcoming Power-Related Challenges FPGA Circuit Design: Overcoming Power-Related Challenges Application Note Introduction When you are designing, field-programmable gate array (FPGA) circuits, it is important to pay attention to power issues

More information

RTPA2A. TekConnect probe adapter for real-time spectrum analyzers. Tektronix high-performance probing solutions. Applications. Notice to EU customers

RTPA2A. TekConnect probe adapter for real-time spectrum analyzers. Tektronix high-performance probing solutions. Applications. Notice to EU customers RTPA2A Extends the troubleshooting capabilities of Tektronix real-time spectrum analyzers with the world s best probes Troubleshoot and determine RF faults directly on circuit boards where no coaxial connection

More information

Keysight N8843A I3CSM Protocol Trigger and Decode for Infiniium Oscilloscope. Data Sheet

Keysight N8843A I3CSM Protocol Trigger and Decode for Infiniium Oscilloscope. Data Sheet Keysight N8843A I3CSM Protocol Trigger and Decode for Infiniium Oscilloscope Data Sheet 02 Keysight N8843A I3C SM Protocol Trigger and Decode for Infiniium Oscilloscope - Data Sheet This application is

More information

ALL-IN-ONE PRESENTATION SYSTEMS

ALL-IN-ONE PRESENTATION SYSTEMS ALL-IN-ONE PRESENTATION SYSTEMS VS-88UT VS-622DT KramerAV.com WHEN KRAMER SET OUT TO BUILD THE AV INDUSTRIES MOST VERSATILE FAMILY OF ALL-IN-ONE PRESENTATION SYSTEMS THE GOAL WAS SIMPLE, CREATE A LINE

More information

Keysight Technologies I 2 C and SPI Protocol Triggering and Decode

Keysight Technologies I 2 C and SPI Protocol Triggering and Decode Keysight Technologies I 2 C and SPI Protocol Triggering and Decode For Infiniium 9000 and S-Series Oscilloscopes Data Sheet This application is available in the following license variations. Fixed to an

More information

A 3/25/99 4:23 PM Page 23 APC Global Services 1999 Al Specificat

A 3/25/99 4:23 PM Page 23 APC Global Services 1999 Al Specificat APC Global Services 1 Boston Edison Testimonial I now have peace of mind knowing that our facility is protected by the professionals from APC s Global Services Group and the APC Silcon DP300E. Franco Pasquale

More information

Keysight Technologies DSOX4USBSQ USB 2.0 Signal Quality Test Option for 4000 X-Series. Data Sheet

Keysight Technologies DSOX4USBSQ USB 2.0 Signal Quality Test Option for 4000 X-Series. Data Sheet Keysight Technologies DSOX4USBSQ USB 2.0 Signal Quality Test Option for 4000 X-Series Data Sheet 02 Keysight DSOX4USBSQ USB 2.0 Signal Quality Test Option for 4000 X-Series - Data Sheet Introduction The

More information

Training Notes Unity Real Time 2

Training Notes Unity Real Time 2 Training Notes Unity Real Time 2 For Customers Using SPC (Westgard) Rules Log on to Unity Real Time 2 1 Double-click the Unity Real Time 2 shortcut located on your computer desktop. 2 Select your user

More information

Keysight B2980A Series Femto/Picoammeter Electrometer/High Resistance Meter

Keysight B2980A Series Femto/Picoammeter Electrometer/High Resistance Meter Keysight B2980A Series Femto/Picoammeter Electrometer/High Resistance Meter Configuration Guide The world s only graphical Picoammeter/Electrometer that can confidently measure down to 0.01 fa and up to

More information

The Role of SANAS in Support of South African Regulatory Objectives. Mr. Mpho Phaloane South African National Accreditation System

The Role of SANAS in Support of South African Regulatory Objectives. Mr. Mpho Phaloane South African National Accreditation System The Role of SANAS in Support of South African Regulatory Objectives Mr. Mpho Phaloane South African National Accreditation System Outline of Presentation INTRODUCTION STATUS OF SANAS TECHNICAL INFRASTRUCTURE

More information

DataKom Vodafone Mobile Tariff Minimum 30 day end of month notice cancellation - Subject to contract. DataKom O2 Mobile Tariff. All prices exclude VAT

DataKom Vodafone Mobile Tariff Minimum 30 day end of month notice cancellation - Subject to contract. DataKom O2 Mobile Tariff. All prices exclude VAT DataKom Vodafone Mobile Tariff Minimum 30 day end of month notice cancellation - Subject to contract Data Bolt-Ons 3GB Data Bolt-on Voda Vodafone - 3Gb data 5GB Data Bolt-on Voda Vodafone - 5Gb data 7.00

More information

ICNDT WG1 on qualification and certification efforts on global harmonization of the process of personnel certification

ICNDT WG1 on qualification and certification efforts on global harmonization of the process of personnel certification 19 th World Conference on Non-Destructive Testing 2016 ICNDT WG1 on qualification and certification efforts on global harmonization of the process of personnel certification Alexander MULLIN 1 1 RTC Testing

More information

HeadSetup Pro Manager

HeadSetup Pro Manager Quick User Guide Contact information Support Portal: www.sennheiser.com/cco-support E-mail: hsuphelp@senncom.com Phone: Find your local support phone number and opening hours here below. Asia-Pacific Australia

More information

ScholarOne Manuscripts. Publisher Level Reporting Guide

ScholarOne Manuscripts. Publisher Level Reporting Guide ScholarOne Manuscripts Publisher Level Reporting Guide 1-May-2018 Clarivate Analytics ScholarOne Manuscripts Publisher Level Reporting Guide Page i TABLE OF CONTENTS PUBLISHER-LEVEL REPORTING OVERVIEW...

More information

Technical Overview. Key Features

Technical Overview. Key Features Agilent P94xA/C Solid State PIN Diode Switches P942A 1 MHz to 8 GHz SPDT PIN switch P942C 1 MHz to 18 GHz SPDT PIN switch P944A 1 MHz to 8 GHz SP4T PIN switch P944C 1 MHz to 18 GHz SP4T PIN switch Technical

More information

IBM Product Lifecycle Management. CAA Rade solutions

IBM Product Lifecycle Management. CAA Rade solutions IBM Product Lifecycle Management CAA Rade solutions 2 CAA Rade solutions CAA V5 provides the most complete set of tools, guides and API s to support the application development process from the very start

More information

INSTALLATION INSTRUCTIONS LFH160 Cable

INSTALLATION INSTRUCTIONS LFH160 Cable INSTALLATION INSTRUCTIONS LFH160 This guide describes how to connect and use the National Instruments LFH160 cable which has a maximum voltage rating of 100 VDC, CAT I. Use the LFH160 cable to connect

More information

THE NEW STANDARD IN RADIAL COMPRESSION Not just a product, an experience. PreludeSYNC. Radial Compression Devices

THE NEW STANDARD IN RADIAL COMPRESSION Not just a product, an experience. PreludeSYNC. Radial Compression Devices THE NEW STANDARD IN RADIAL COMPRESSION Not just a product, an experience. PreludeSYNC PreludeSYNC WHY PreludeSYNC? EFFECTIVE * The PreludeSYNC assists in achieving vascular hemostasis. Access site visibility

More information

N2753A and N2754A Windows XP to Windows 7 Upgrade Kits. For Infiniium 9000, 90000, and X-Series Oscilloscopes

N2753A and N2754A Windows XP to Windows 7 Upgrade Kits. For Infiniium 9000, 90000, and X-Series Oscilloscopes N2753A and N2754A Windows XP to Windows 7 Upgrade Kits For Infiniium 9000, 90000, and 90000 X-Series Oscilloscopes All new Infiniium 9000, 90000, and 90000-X oscilloscopes now ship standard with Microsoft

More information

Keysight Technologies MXG X-Series Signal Generators N5181B Analog & N5182B Vector

Keysight Technologies MXG X-Series Signal Generators N5181B Analog & N5182B Vector Keysight Technologies MXG X-Series Signal Generators N5181B Analog & N5182B Vector Configuration Guide This configuration guide will help you determine which performance options, software applications,

More information

Amazon Global Selling

Amazon Global Selling Amazon Global Selling Expanding internationally has never been easier! Lesley Schwartz Amazon Channel Sales March 14, 2013 All Rights Reserved 1 2010 Worldwide Retail Sales $16.5 TRILLION 10.9% growth

More information

STEVAL-CCM002V1. TFT-LCD panel demonstration board based on the STM32 as LCD controller. Features. Description

STEVAL-CCM002V1. TFT-LCD panel demonstration board based on the STM32 as LCD controller. Features. Description TFT-LCD panel demonstration board based on the STM32 as LCD controller Data brief Features Displays images on a TFT-LCD using the STM32 as LCD controller Includes a slideshow of images to demonstrate static

More information

RELEASE NOTES. .ini file utility, version 1.0. Release Notes:.ini File Utility, Version 1.0. Purpose and Summary. Purpose. Summary

RELEASE NOTES. .ini file utility, version 1.0. Release Notes:.ini File Utility, Version 1.0. Purpose and Summary. Purpose. Summary Release Notes:.ini File Utility, Version 1.0 Purpose and Summary Purpose The.ini file utility automates much of the procedure for downloading user configuration (.ini) files from Network Management Cards

More information

STEVAL-PCC010V1. ST802RT1A Ethernet PHY demonstration board with STM32F107 controller add-on board. Features. Description

STEVAL-PCC010V1. ST802RT1A Ethernet PHY demonstration board with STM32F107 controller add-on board. Features. Description ST802RT1A Ethernet PHY demonstration board with STM32F107 controller add-on board Data brief Features ST802RT1A Ethernet PHY demonstration board: ST802RT1A fast Ethernet physical layer transceiver On-board

More information

E-Seminar. Voice over IP. Internet Technical Solution Seminar

E-Seminar. Voice over IP. Internet Technical Solution Seminar E-Seminar Voice over IP Internet Technical Solution Seminar Voice over IP Internet Technical Solution Seminar 3 Welcome 4 Objectives 5 Telephony in Business 6 VoIP and IP Telephony 7 Traditional Telephony

More information

Keysight Technologies Configuring Boundary Scan Chains on Keysight x1149 Boundary Scan Analyzer. Application Note

Keysight Technologies Configuring Boundary Scan Chains on Keysight x1149 Boundary Scan Analyzer. Application Note Keysight Technologies Configuring Boundary Scan Chains on Keysight x1149 Boundary Scan Analyzer Application Note Introduction A boundary scan chain consists of two or more boundary scan integrated circuit

More information

Personal Emergency Response Systems (PERS) - Global Market Outlook ( )

Personal Emergency Response Systems (PERS) - Global Market Outlook ( ) Published on Market Research Reports Inc. (https://www.marketresearchreports.com) Home > Personal Emergency Response Systems (PERS) - Global Market Outlook (2015-2022) Personal Emergency Response Systems

More information

Troubleshooting Ethernet Problems with Your Oscilloscope APPLICATION NOTE

Troubleshooting Ethernet Problems with Your Oscilloscope APPLICATION NOTE Troubleshooting Ethernet Problems with Your Oscilloscope Introduction Ethernet is a family of frame-based computer networking technologies for local area networks (LANs), initially developed at Xerox PARC

More information

Keysight Technologies N6472A IEEE802.3bs/cd Compliance Application

Keysight Technologies N6472A IEEE802.3bs/cd Compliance Application Keysight Technologies N6472A IEEE802.3bs/cd Compliance Application For Infiniium Z-Series Oscilloscopes Data Sheet Characterize electrical pulse amplitude modulated (PAM) and Non-Return-to-Zero (NRZ) signals

More information

Scope of the Report Gastrointestinal Endoscopy Devices Market

Scope of the Report Gastrointestinal Endoscopy Devices Market Global Gastrointestinal Endoscopy Devices Market: Analysis By Product Type (Hemostasis Devices, Capsule Endoscopes, G.I Videoscopes, Biopsy Devices, ERCP Devices), End-User (Hospitals, Clinics, Others),

More information

Keysight Technologies UXG Agile Signal Generator, Modified Version N5191A

Keysight Technologies UXG Agile Signal Generator, Modified Version N5191A Keysight Technologies UXG Agile Signal Generator, Modified Version N5191A Configuration Guide This configuration guide will help you determine which performance options, accessories, and services to include

More information

OPERATING INSTRUCTIONS AND SPECIFICATIONS NI 9870E

OPERATING INSTRUCTIONS AND SPECIFICATIONS NI 9870E OPERATING INSTRUCTIONS AND SPECIFICATIONS NI 9870E 4-Port, RS232 Serial Module This document describes how to use the National Instruments 9870E and includes dimensions, pin assignments, and specifications

More information

BlueFuse Multi v4.4 Installation Guide

BlueFuse Multi v4.4 Installation Guide BlueFuse Multi v4.4 Installation Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 3 Introduction 4 Supported Operating Systems 5 Hardware Requirements 6 Deployment Modes

More information

Keysight Technologies E3620A and E3630A Non-programmable DC Power Supplies. Data Sheet

Keysight Technologies E3620A and E3630A Non-programmable DC Power Supplies. Data Sheet Keysight Technologies and E3630A Non-programmable DC Power Supplies Data Sheet 02 Keysight and E3630A Non-programmable DC Power Supplies Data Sheet Reliable Power, Repeatable Results Linear power supply

More information

SUUNTO SPARTAN ULTRA QUICK GUIDE

SUUNTO SPARTAN ULTRA QUICK GUIDE SUUNTO SPARTAN ULTRA QUICK GUIDE Read complete User Guide www.suunto.com/support EN, DE, FR, ES, IT, NL, PT, EL, SV, FI, ET, NO, DA, RU, SK, SL, PL, CS, HU, BG, TR, ZHTW, KO, ID, TL, TH GETTING STARTED

More information

Keysight E4991B Impedance Analyzer

Keysight E4991B Impedance Analyzer Keysight E4991B Impedance Analyzer 1 MHz to 500 M/1 G/3 GHz Configuration Guide 02 Keysight E4991B Impedance Analyzer - Configuration Guide Ordering Guide The following steps will guide you through configuring

More information

Purchasing. Operations 3% Marketing 3% HR. Production 1%

Purchasing. Operations 3% Marketing 3% HR. Production 1% Agenda Item DOC ID IAF CMC (11) 75 For Information For discussion For decision For comments to the author IAF End User Survey results (October 211) This report summarises the total responses to the IAF

More information

RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration

RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration Browse the Configurator at www.configurator.realtimeready.roche.com. For life science research only. Not for use in diagnostic

More information

NI SMB-2145/2146/2147/2148

NI SMB-2145/2146/2147/2148 USER GUIDE NI SMB-2145/2146/2147/2148 Shielded Signal Accessories for NI 5751/5752 Adapter Modules The NI SMB-2145/2146/2147/2148 (NI SMB-214x) devices are shielded signal accessories for NI FlexRIO digitizer

More information

Certified Technical Training for Emerson Flow Instruments. Helping you to maximize your Flow instrument investment

Certified Technical Training for Emerson Flow Instruments. Helping you to maximize your Flow instrument investment Certified Technical Training for Emerson Flow Instruments Helping you to maximize your Flow instrument investment Utilize the full range of product features to achieve the highest value from your flow,

More information