Automaton-based Sublinear Keyword Pattern Matching. SoC Software. Loek Cleophas, Bruce W. Watson, Gerard Zwaan
|
|
- Stephen Daniel
- 5 years ago
- Views:
Transcription
1 SPIRE 2004 Padova, Italy October 5 8, 2004 Automaton-based Sublinear Keyword Pattern Matching Loek Cleophas, Bruce W. Watson, Gerard Zwaan SoC Software Construction Software Construction Group Department of Mathematics and Computer Science Technische Universiteit Eindhoven Eindhoven, The Netherlands FASTAR Research Group
2 Overview Introduction KPM Problem TABASCO & Taxonomies KPM Taxonomy Automaton-based Sublinear KPM Towards a Sublinear KPM Algorithm Skeleton Skeleton Instantiations Concluding Remarks Future Work References
3 Keyword Pattern Matching `Problem of finding all occurrences of keywords from a given set as substrings in a given string (text) For simplicity, assume single keyword instead of set Example: Keyword baby a b a b y d a b a b y Solution set O = {( a, baby, dababy), (ababyda, baby, )}
4 TAxonomy-BAsed Software COnstruction Long term SoC research project Steps 1) Selection of problem field 5) DSL design 2) Literature survey 6) Toolkit implementation 3) Taxonomy construction 7) Benchmarking 4) Toolkit design 8) DSL implementation Aims ease comparison and understanding of algorithms provide correctness arguments ease implementation and choice between algorithms lead to new algorithms
5 Taxonomy Classification according to algorithm and problem details algorithm details deal with algorithm structure problem details deal with problem changes Representation Directed acyclic graph Algorithms as nodes Details as branches Root is simple solution, for KPM: take set of occurrences of keywords in text Sequences of details (branches) lead to algorithms from literature or new algorithms Details are correctness-preserving transformations
6 KPM Taxonomy Graph backward (suffix, factor, factor oracle -based) GS EGC LMIN SSD + S + - P forward (prefixbased) E AC AC-OPT BP SPP AC-FAIL LS BP KMP-FAIL OKW OKW SHO NFS NLAU OPT OLAU INDICES OKW BMCW BM CW CW BM BMH NLA BMH
7 KPM Taxonomy History Initial literature survey & taxonomy development Watson & Zwaan ( ) Contained Aho-Corasick, Knuth-Morris-Pratt, Boyer- Moore, Commentz-Walter and many variants Revised & extended taxonomy Cleophas (2003) Since 1995, factor- and factor oracle-based algorithms emerged/gained attention Generalized Commentz-Walter/Boyer-Moore (suffixbased, sublinear) skeleton to automaton-based sublinear KPM skeleton Added algorithms such as (Set) Backward DAWG Matching, (Set) Backward Oracle Matching
8 Towards a Sublinear KPM Skeleton - I (u,r) and (l,v) pairs nondeterministically chosen a b a b y d a b a b y l v P u r O := ( l, v, r : lvr = S v P : {(l, v, r)}) { R : O = ( l, v, r : lvr = S v P : {(l, v, r)}) } O := ; for (u, r) : ur = S O := O ( ( l, v : lv = u v P : {(l, v, r)}) rof { R } O := ; for (u, r) : ur = S for (l, v) : lv = u as v P O := O ( {(l, v, r)} sa rof rof { R } Algorithm ( ) Algorithm ( P ) Algorithm ( P, S )
9 Towards a Sublinear KPM Skeleton - II (u,r) and (l,v) pairs in increasing length of u resp. v a b a b y d a b a b y l v P u r f(p): P f(p) suff(f(p)) f(p) δ R,f : automaton recognizing f(p) R u,r := ε, S; O := ; l,v := ε, ε; do r ε u,r := u(r 1), r 1; l,v := u, ε; q := δ R,f (q 0, l 1); { invariant: q = δ R,f (q 0, (l 1)v) R } do l ε cand q l,v := l 1, (l 1)v; q := δ R,f (q 0, l 1); as v P O := O ( {(l, v, r)} sa od { R } od Algorithm ( P+, S+, GS, EGC )
10 Towards a Sublinear KPM Skeleton - III k(l,v,r) : shift function `at least 1 and at most distance to next match u,r := ε, S; O := ; l,v := ε, ε; do r ε u,r := u(r k(l,v,r)), r k(l,v,r); l,v := u, ε; q := δ R,f (q 0, l 1); { invariant: q = δ R,f (q 0, (l 1)v) R } do l ε cand q l,v := l 1, (l 1)v; q := δ R,f (q 0, l 1); as v P O := O ( {(l, v, r)} sa od od { R } Algorithm ( P+, S+, GS, EGC, SSD )
11 KPM Taxonomy Graph, Revisited backward (suffix, factor, factor oracle -based) GS EGC LMIN SSD + S + - P forward (prefixbased) E AC AC-OPT BP SPP AC-FAIL LS BP KMP-FAIL OKW OKW SHO shift functions (leading to sublinear algorithms) OKW NLAU OPT BMCW BM CW CW BM NFS BMH NLA OLAU BMH GS INDICES S F FO SO EGC RSA RFA RFO (RSO) choice of f(p) & δ R,f (automaton recognizin g f(p) R )
12 Skeleton Instantiations - I Value of shift function k(l,v,r) `at least 1 and at most distance to next match : 1 k (MIN n : 1 n suff(u(r n)) P : n) Idea: shift functions approximating maximal value from below Done for f(p)=suff(p) (i.e. for suffix-based SKPM) derivations of Commentz-Walter, Boyer-Moore, Fan- Su by Watson & Zwaan, Horspool by Cleophas Choosing f(p)=fact(p) (i.e. factor-based SKPM) More information for shifts: something is not factor More comparisons: something is factor but not suffix
13 Skeleton Instantiations - II Using f(p)=fact(p), can use shift function k(l,v,r) max (1 max (lmin P - v )), with k(l,v,r) suffix-based shift function Using 1 max (lmin P - v ), large shifts with little precomputation Called `No-Factor Shift : uses (l 1)v fact(p) Combination of `No-Factor Shift with suffix-based shift functions Yields many previously undescribed SKPM variants Practical usefulness unknown: precomputation large but extra shift gained small? Useful if precomputation time not an issue
14 Skeleton Instantiations - III Using f(p)=factoracle(p R ) R I.e. using factor oracle as automaton Easy to construct, less memory vs. factor automaton Recognizes at least fact(p) At least same information for shifts, in particular `Nofactor Shift may be used More comparisons Combination of `No-Factor Shift with suffix-based shift functions possible Yields many previously undescribed SKPM variants Practical usefulness unknown Useful if precomputation time not an issue
15 Concluding Remarks Derived automaton-based SKPM algorithm skeleton Suffix, factor and factor oracle automaton-based SKPM as instantiations Suffix-based shift functions in principle reusable for factor- and factor oracle-based algorithms As a result, many new variants of factor- and factor oracle-based SKPM Combining `No-Factor Shift with traditional (suffixbased) shift functions
16 Future Work Performance of new factor- and factor oracle-based SKPM algorithm variants Precomputation of shift functions Done for suffix-based algorithms by Watson & Zwaan Extension to factor-/factor oracle-based algorithms remains to be done Update output variable after instead of in inner loop
17 References L. Cleophas, B.W. Watson & G. Zwaan, Automaton-based Sublinear Keyword Pattern Matching. In Proceedings of SPIRE 2004, L. Cleophas, B.W. Watson & G. Zwaan, Automaton-based Sublinear Keyword Pattern Matching, Technical Report 04-07, Computer Science Group, TU/e, B.W. Watson & G. Zwaan, A Taxonomy of Sublinear Multiple Keyword Pattern Matching Algorithms. In Science of Computer Programming 27(2):85-118, Elsevier Science, L. Cleophas, Towards SPARE Time A New Taxonomy and Toolkit of Keyword Pattern Matching Algorithms, MSc thesis, Computer Science Group, TU/e, 2003.
18 Taxonomy Construction Given algorithms from literature, distill commonalities and variation Commonalities result in common root path Adding detail (branch) results in correctness preserving transformation Formal derivation/proofs accompany detail (branch) Development often bottom-up Final presentation top-down Multiple paths to same solution possible Also constructed for garbage collection, FA & MADFA construction, FA minimization, LZ compression,
/ department of mathematics and computer science
TABASCO: TAxonomy-BAsed Software COnstruction + A Keyword Pattern Matching Example Loek Cleophas l.g.w.a.cleophas@tue.nl May 11, 2005 Software Construction Group FASTAR Research Espresso Research http://www.win.tue.nl/soc
More informationTaxonomy-Based Software Construction for Algorithmic Families
Taxonomy-Based Software Construction for Algorithmic Families Bruce W. Watson with Loek Cleophas & Derrick Kourie bruce@bruce-watson.com Aim & Motivation Aim Give overview and examples of Taxonomies and
More informationTECHNISCHE UNIVERSITEIT EINDHOVEN. Department of Mathematics and Computer Science MASTER S THESIS. Towards SPARE Time
TECHNISCHE UNIVERSITEIT EINDHOVEN Department of Mathematics and Computer Science MASTER S THESIS Towards SPARE Time A New Taxonomy and Toolkit of Keyword Pattern Matching Algorithms by L.G.W.A. Cleophas
More informationTABASCO: a Taxonomy-based Domain Engineering Method
TABASCO: a Taxonomy-based Domain Engineering Method LOEK CLEOPHAS Technische Universiteit Eindhoven and BRUCE W. WATSON, DERRICK G. KOURIE, ANDREW BOAKE University of Pretoria We discuss TABASCO, a method
More informationA Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms
A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms Charalampos S. Kouzinopoulos and Konstantinos G. Margaritis Parallel and Distributed Processing Laboratory Department
More informationApplied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017
Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of
More informationAutomaton-based Backward Pattern Matching
Czech Technical University in Prague Faculty of Electrical Engineering Department of Computer Science and Engineering Automaton-based Backward Pattern Matching Doctoral Thesis Jan Antoš PhD program: Computer
More informationString Matching with Multicore CPUs: Performing Better with the Aho-Corasick Algorithm
String Matching with Multicore CPUs: Performing Better with the -Corasick Algorithm S. Arudchutha, T. Nishanthy and R.G. Ragel Department of Computer Engineering University of Peradeniya, Sri Lanka Abstract
More informationfor the MADFA construction problem have typically been kept as trade secrets (due to their commercial success in applications such as spell-checking).
A Taxonomy of Algorithms for Constructing Minimal Acyclic Deterministic Finite Automata Bruce W. Watson 1 watson@openfire.org www.openfire.org University of Pretoria (Department of Computer Science) Pretoria
More informationOn compile time Knuth-Morris-Pratt precomputation
On compile time Knuth-Morris-Pratt precomputation Kourie, J.; Cleophas, L.G.W.A.; Watson, B.W. Published in: Proceedings of the Prague Stringology Conference 2011 (PSC'11, Prague, Czech Republic, August
More informationPractical and Optimal String Matching
Practical and Optimal String Matching Kimmo Fredriksson Department of Computer Science, University of Joensuu, Finland Szymon Grabowski Technical University of Łódź, Computer Engineering Department SPIRE
More informationKnuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011
Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given
More informationText Algorithms (6EAP) Lecture 3: Exact paaern matching II
Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND
More informationApplication of String Matching in Auto Grading System
Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute
More informationText Algorithms (6EAP) Lecture 3: Exact pa;ern matching II
Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)
More informationA New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System
IACSIT International Journal of Engineering and Technology, Vol. 8, No. 2, April 2016 A New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System Nguyen Le Dang, Dac-Nhuong Le,
More informationarxiv: v1 [cs.ds] 3 Jul 2017
Speeding Up String Matching by Weak Factor Recognition Domenico Cantone, Simone Faro, and Arianna Pavone arxiv:1707.00469v1 [cs.ds] 3 Jul 2017 Università di Catania, Viale A. Doria 6, 95125 Catania, Italy
More informationString matching algorithms
String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A
More informationExact String Matching. The Knuth-Morris-Pratt Algorithm
Exact String Matching The Knuth-Morris-Pratt Algorithm Outline for Today The Exact Matching Problem A simple algorithm Motivation for better algorithms The Knuth-Morris-Pratt algorithm The Exact Matching
More informationHigh Performance Pattern Matching Algorithm for Network Security
IJCSNS International Journal of Computer Science and Network Security, VOL.6 No., October 6 83 High Performance Pattern Matching Algorithm for Network Security Yang Wang and Hidetsune Kobayashi Graduate
More information1. (10 points) Draw the state diagram of the DFA that recognizes the language over Σ = {0, 1}
CSE 5 Homework 2 Due: Monday October 6, 27 Instructions Upload a single file to Gradescope for each group. should be on each page of the submission. All group members names and PIDs Your assignments in
More informationAlgorithms and Data Structures
Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction
More informationA New String Matching Algorithm Based on Logical Indexing
The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department
More informationIndexing and Searching
Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)
More informationChapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input
More informationText Algorithms. Jaak Vilo 2016 fall. MTAT Text Algorithms
Text Algorithms Jaak Vilo 2016 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Topics Exact matching of one pattern(string) Exact matching of multiple patterns Suffix trie and tree indexes Applications Suffix
More informationPLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [Universiteit Twente] On: 21 May 2010 Access details: Access Details: [subscription number 907217948] Publisher Taylor & Francis Informa Ltd Registered in England and Wales
More informationEfficient String Matching Using Bit Parallelism
Efficient String Matching Using Bit Parallelism Kapil Kumar Soni, Rohit Vyas, Dr. Vivek Sharma TIT College, Bhopal, Madhya Pradesh, India Abstract: Bit parallelism is an inherent property of computer to
More informationString Matching Algorithms
String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational
More informationEfficient Automata Constructions and Approximate Automata
Efficient Automata Constructions and Approximate Automata Bruce W. Watson 1,2,3,4, Derrick G. Kourie 1,3, Ernest Ketcha Ngassam 1,5, Tinus Strauss 1,3, and Loek Cleophas 1,6 1 FASTAR Research group bruce@bruce-watson.com
More informationSmall-Space 2D Compressed Dictionary Matching
Small-Space 2D Compressed Dictionary Matching Shoshana Neuburger 1 and Dina Sokol 2 1 Department of Computer Science, The Graduate Center of the City University of New York, New York, NY, 10016 shoshana@sci.brooklyn.cuny.edu
More informationMulti-Pattern String Matching with Very Large Pattern Sets
Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume
More informationA Practical Distributed String Matching Algorithm Architecture and Implementation
A Practical Distributed String Matching Algorithm Architecture and Implementation Bi Kun, Gu Nai-jie, Tu Kun, Liu Xiao-hu, and Liu Gang International Science Index, Computer and Information Engineering
More informationSmall-Space 2D Compressed Dictionary Matching
Shoshana Neuburger and Dina Sokol City University of New York Problem Definition Compressed 2D Dictionary Matching Input: Compressed text of uncompressed size n n. Dictionary containing k compressed patterns.
More informationExperimental Results on String Matching Algorithms
SOFTWARE PRACTICE AND EXPERIENCE, VOL. 25(7), 727 765 (JULY 1995) Experimental Results on String Matching Algorithms thierry lecroq Laboratoire d Informatique de Rouen, Université de Rouen, Facultés des
More informationFast Substring Matching
Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which
More informationAn efficient matching algorithm for encoded DNA sequences and binary strings
An efficient matching algorithm for encoded DNA sequences and binary strings Simone Faro 1 and Thierry Lecroq 2 1 Dipartimento di Matematica e Informatica, Università di Catania, Italy 2 University of
More informationAn introduction to suffix trees and indexing
An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet
More informationString Matching Algorithms
String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -
More informationProject Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio
Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade
More informationAccelerating Boyer Moore Searches on Binary Texts
Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il
More informationImproving Practical Exact String Matching
Improving Practical Exact String Matching Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We present improved variations of the BNDM algorithm for exact string matching. At each alignment
More informationSurvey of Exact String Matching Algorithm for Detecting Patterns in Protein Sequence
Advances in Computational Sciences and Technology ISSN 0973-6107 Volume 10, Number 8 (2017) pp. 2707-2720 Research India Publications http://www.ripublication.com Survey of Exact String Matching Algorithm
More informationApplication of the BWT Method to Solve the Exact String Matching Problem
Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com
More informationFast Hybrid String Matching Algorithms
Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms
More informationBit-Reduced Automaton Inspection for Cloud Security
Bit-Reduced Automaton Inspection for Cloud Security Haiqiang Wang l Kuo-Kun Tseng l* Shu-Chuan Chu 2 John F. Roddick 2 Dachao Li 1 l Department of Computer Science and Technology, Harbin Institute of Technology,
More informationWAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA
WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA 2010 WAVE-FRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND
More informationA Survey of String Matching Algorithms
RESEARCH ARTICLE OPEN ACCESS A Survey of String Matching Algorithms Koloud Al-Khamaiseh*, Shadi ALShagarin** *(Department of Communication and Electronics and Computer Engineering, Tafila Technical University,
More informationThe Exact Online String Matching Problem: A Review of the Most Recent Results
13 The Exact Online String Matching Problem: A Review of the Most Recent Results SIMONE FARO, Università di Catania THIERRY LECROQ, Université derouen This article addresses the online exact string matching
More informationThe performance of single-keyword and multiple-keyword. pattern matching algorithms. Bruce W. Watson. Eindhoven University of Technology
The performance of sinle-keyword and multiple-keyword pattern matchin alorithms Bruce W. Watson Faculty of Mathematics and Computin Science Eindhoven University of Technoloy P.O. Box 513, 5600 MB Eindhoven,
More informationLecture 5: Suffix Trees
Longest Common Substring Problem Lecture 5: Suffix Trees Given a text T = GGAGCTTAGAACT and a string P = ATTCGCTTAGCCTA, how do we find the longest common substring between them? Here the longest common
More informationTuning BNDM with q-grams
Tuning BNDM with q-grams Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We develop bit-parallel algorithms for exact string matching. Our algorithms are variations of the BNDM and Shift-Or
More informationAn Improved Query Time for Succinct Dynamic Dictionary Matching
An Improved Query Time for Succinct Dynamic Dictionary Matching Guy Feigenblat 12 Ely Porat 1 Ariel Shiftan 1 1 Bar-Ilan University 2 IBM Research Haifa labs Agenda An Improved Query Time for Succinct
More informationAn Investigation of Dead-Zone Pattern Matching Algorithms
An Investigation of Dead-Zone Pattern Matching Algorithms by Melanie Barbara Mauch Thesis presented in fulfilment of the requirements for the degree of Master of Arts in the Faculty of Arts and Social
More informationMax-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms
Regular Paper Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms Mohammed Sahli 1,a) Tetsuo Shibuya 2 Received: September 8, 2011, Accepted: January 13, 2012 Abstract:
More information17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching.
17 dicembre 2003 Luca Bortolussi SUFFIX TREES From exact to approximate string matching. An introduction to string matching String matching is an important branch of algorithmica, and it has applications
More informationLog Linear Model for String Transformation Using Large Data Sets
Log Linear Model for String Transformation Using Large Data Sets Mr.G.Lenin 1, Ms.B.Vanitha 2, Mrs.C.K.Vijayalakshmi 3 Assistant Professor, Department of CSE, Podhigai College of Engineering & Technology,
More informationString matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي
String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred
More informationA Unifying Look at the Apostolico Giancarlo String-Matching Algorithm
A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm MAXIME CROCHEMORE, IGM (Institut Gaspard-Monge), Université de Marne-la-Vallée, 77454 Marne-la-Vallée CEDEX 2, France. E-mail: mac@univ-mlv.fr,
More informationString Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42
String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt
More informationkvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx
COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?
More informationData structures for string pattern matching: Suffix trees
Suffix trees Data structures for string pattern matching: Suffix trees Linear algorithms for exact string matching KMP Z-value algorithm What is suffix tree? A tree-like data structure for solving problems
More informationExperiments on string matching in memory structures
Experiments on string matching in memory structures Thierry Lecroq LIR (Laboratoire d'informatique de Rouen) and ABISS (Atelier de Biologie Informatique Statistique et Socio-Linguistique), Universite de
More informationA very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)
A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de
More informationString Matching in Scribblenauts Unlimited
String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia
More informationFaculty of Mathematics and Natural Sciences
UNIVERSITY of OSLO Faculty of Mathematics and Natural Sciences Exam in: INF 4130/9135: Algoritmer: Design og effektivitet Date of exam: 16th December 2013 Exam hours: 09:00 13:00 (4 hours) Exam paper consists
More informationApplications of Suffix Tree
Applications of Suffix Tree Let us have a glimpse of the numerous applications of suffix trees. Exact String Matching As already mentioned earlier, given the suffix tree of the text, all occ occurrences
More informationTaxonomies and Toolkits of
Taxonomies and Toolkits of Regular Language Algorithms Bruce William Watson Eindhoven University of Technology Department of Mathematics and Computing Science tue Copyright c 1995 by Bruce W. Watson, Eindhoven,
More informationEfficient validation and construction of border arrays
Efficient validation and construction of border arrays Jean-Pierre Duval Thierry Lecroq Arnaud Lefebvre LITIS, University of Rouen, France, {Jean-Pierre.Duval,Thierry.Lecroq,Arnaud.Lefebvre}@univ-rouen.fr
More information4. Suffix Trees and Arrays
4. Suffix Trees and Arrays Let T = T [0..n) be the text. For i [0..n], let T i denote the suffix T [i..n). Furthermore, for any subset C [0..n], we write T C = {T i i C}. In particular, T [0..n] is the
More informationCMPUT 403: Strings. Zachary Friggstad. March 11, 2016
CMPUT 403: Strings Zachary Friggstad March 11, 2016 Outline Tries Suffix Arrays Knuth-Morris-Pratt Pattern Matching Tries Given a dictionary D of strings and a query string s, determine if s is in D. Using
More informationString Searching Algorithm Implementation-Performance Study with Two Cluster Configuration
International Journal of Computer Science & Communication Vol. 1, No. 2, July-December 2010, pp. 271-275 String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration Prasad
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationThis chapter is based on the following sources, which are all recommended reading:
Bioinformatics I, WS 09-10, D. Hson, December 7, 2009 105 6 Fast String Matching This chapter is based on the following sorces, which are all recommended reading: 1. An earlier version of this chapter
More informationComputing Patterns in Strings I. Specific, Generic, Intrinsic
Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems
More informationSuffix links are stored for compact trie nodes only, but we can define and compute them for any position represented by a pair (u, d):
Suffix links are the same as Aho Corasick failure links but Lemma 4.4 ensures that depth(slink(u)) = depth(u) 1. This is not the case for an arbitrary trie or a compact trie. Suffix links are stored for
More informationAlgorithms for Nearest Neighbors
Algorithms for Nearest Neighbors Classic Ideas, New Ideas Yury Lifshits Steklov Institute of Mathematics at St.Petersburg http://logic.pdmi.ras.ru/~yura University of Toronto, July 2007 1 / 39 Outline
More informationA Multipattern Matching Algorithm Using Sampling and Bit Index
A Multipattern Matching Algorithm Using Sampling and Bit Index Jinhui Chen, Zhongfu Ye Department of Automation University of Science and Technology of China Hefei, P.R.China jeffcjh@mail.ustc.edu.cn,
More informationStrings. Zachary Friggstad. Programming Club Meeting
Strings Zachary Friggstad Programming Club Meeting Outline Suffix Arrays Knuth-Morris-Pratt Pattern Matching Suffix Arrays (no code, see Comp. Prog. text) Sort all of the suffixes of a string lexicographically.
More informationLecture 7 February 26, 2010
6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some
More informationlec3:nondeterministic finite state automata
lec3:nondeterministic finite state automata 1 1.introduction Nondeterminism is a useful concept that has great impact on the theory of computation. When the machine is in a given state and reads the next
More informationTUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH UNROLLING Q-GRAMS AND HASH
Computer Modelling and New Technologies, 2013, Vol.17, No. 4, 58-65 Transport and Telecommunication Institute, Lomonosov 1, LV-1019, Riga, Latvia TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH
More informationImportance of String Matching in Real World Problems
www.ijecs.in International Journal Of Engineering And Computer Science ISSN: 2319-7242 Volume 3 Issue 6 June, 2014 Page No. 6371-6375 Importance of String Matching in Real World Problems Kapil Kumar Soni,
More informationCSCI S-Q Lecture #13 String Searching 8/3/98
CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching
More informationMining Frequent Patterns without Candidate Generation
Mining Frequent Patterns without Candidate Generation Outline of the Presentation Outline Frequent Pattern Mining: Problem statement and an example Review of Apriori like Approaches FP Growth: Overview
More informationSchool of Engineering and Mathematical Sciences. Packet Pattern Matching for Intrusion Detection
School of Engineering and Mathematical Sciences Packet Pattern Matching for Intrusion Detection by Alireza Shams Project for the Degree of MSc In Telecommunications and Networks Supervisor: Prof Tom Chen
More informationImplementation of String Matching and Breadth First Search for Recommending Friends on Facebook
Implementation of String Matching and Breadth First Search for Recommending Friends on Facebook Ahmad 13512033 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern
More informationFast exact string matching algorithms
Information Processing Letters 102 (2007) 229 235 www.elsevier.com/locate/ipl Fast exact string matching algorithms Thierry Lecroq LITIS, Faculté des Sciences et des Techniques, Université de Rouen, 76821
More informationAlgorithms for Order- Preserving Matching
Departm en tofcom pu terscien ce Algorithms for Order- Preserving Matching TamannaChhabra 90 80 text pattern 70 60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10 11 DOCTORAL DISSERTATIONS Preface First, I
More informationInternational Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, ISSN
International Journal of Computer Engineering and Applications, Volume XI, Issue XI, Nov. 17, www.ijcea.com ISSN 2321-3469 DNA PATTERN MATCHING - A COMPARATIVE STUDY OF THREE PATTERN MATCHING ALGORITHMS
More informationFast Exact String Matching Algorithms
Fast Exact String Matching Algorithms Thierry Lecroq Thierry.Lecroq@univ-rouen.fr Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore
More informationMultiple Skip Multiple Pattern Matching Algorithm (MSMPMA)
Multiple Skip Multiple Pattern Matching (MSMPMA) Ziad A.A. Alqadi 1, Musbah Aqel 2, & Ibrahiem M. M. El Emary 3 1 Faculty Engineering, Al Balqa Applied University, Amman, Jordan E-mail:ntalia@yahoo.com
More informationClever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationInexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming)
Inexact Matching, Alignment See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Outline Yet more applications of generalized suffix trees, when combined with a least common ancestor
More informationCISC 4090 Theory of Computation
CISC 4090 Theory of Computation Turing machines Professor Daniel Leeds dleeds@fordham.edu JMH 332 Alan Turing (1912-1954) Father of Theoretical Computer Science Key figure in Artificial Intelligence Codebreaker
More informationTopics. Text Algorithms. Algorithms. Exact pattern matching. Find occurrences in text. Animations
3..7 opics ext lgorithms Jaak Vilo 6 fall Exact matching of one pattern(string) Exact matching of multiple patterns uffix trie and tree indexes pplications uffix arrays Inverted index pproximate matching
More informationProject Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio
Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade
More informationImproved Parallel Rabin-Karp Algorithm Using Compute Unified Device Architecture
Improved Parallel Rabin-Karp Algorithm Using Compute Unified Device Architecture Parth Shah 1 and Rachana Oza 2 1 Chhotubhai Gopalbhai Patel Institute of Technology, Bardoli, India parthpunita@yahoo.in
More informationAlgorithms for Nearest Neighbors
Algorithms for Nearest Neighbors State-of-the-Art Yury Lifshits Steklov Institute of Mathematics at St.Petersburg Yandex Tech Seminar, April 2007 1 / 28 Outline 1 Problem Statement Applications Data Models
More information