Text Algorithms (6EAP) Lecture 3: Exact paaern matching II
|
|
- Felix Hoover
- 5 years ago
- Views:
Transcription
1 Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND R. Boyer,.Moore: A fast string searching algorithm. CACM 20 (1977), [DF] Boyer- Moore Factor searches 3 4 ABCDE BBCDE Have we missed anything? What have we learned if we test for a potenaal match from the end? 5 6 1
2 A B 7 8 Bad character heuris2cs maximal shir on [i] A B X X X First x in pattern (from end) delta 1 ( [i] ) m if pattern does not contain [i] patlen-j max j so that [j] == [i] [i] void bminitocc() { char a; int j; for(a=0; a<alphabetsize; a++) occ[a]=-1; for (j=0; j<m; j++) { a=p[j]; occ[a]=j; } } 9 10 Good suffix heuris2cs Boyer- Moore algorithm delta 2 ( [i] ) A B minimal shift so that matched region is fully covered or that the sufix of match is also a prefix of Input: Text [1..n] and pattern [1..m] Output: Occurrences of in preprocess_bm() // delta1 and delta2 i=m while i <= n for( j=m; j>0 and [j]==[i-m+j]; j-- ) ; if j==0 report match at position i-m+1 i = i+ max( delta1[ [i] ], delta2[ j ] )
3 implificaaons of BM hap:// flensburg.de/lang/algorithmen/paaern/bmen.htm hap://biit.cs.ut.ee/~vilo/edu/ /text_algorithms/aracles/exact/boyer- Moore- original- p762- boyer.pdf Animaaon: hap://www- igm.univ- mlv.fr/~lecroq/string/ There are many variants of Boyer- Moore, and many scienafic papers. On average the ame complexity is sublinear Algorithm speed can be improved and yet simplify the code. It is useful to use the last character heurisacs (Horspool (1980), Baeza- Yates(1989), Hume and unday(1991)) Algorithm BMH (Boyer- Moore- Horspool) RN Horspool - racacal Fast earching in trings o&ware - rac/ce and Experience, 10(6): Input: Text [1..n] and pattern [1..m] Output: occurrences of in 1. for a in Σ do delta[a] = m 2. for j=1..m-1 do delta[[j]] = m-j 3. i=m 4. while i <= n 5. if [i] == [m] 6. j = m-1 7. while ( j>0 and [j]==[i-m+j] ) j = j-1 ; 8. if j==0 report match at i-m+1 9. i = i + delta[ [i] ] 15 tring Matching: Horspool algorithm How the comparison is made? Text : attern : From right to left: suffix search Which is the next position of the window? Text : a attern : It depends of where appears the last letter of the text, say it a, in the pattern: a a a a a a a a a Then it is necessary a preprocess that determines the length of the shift. Algorithm Boyer- Moore- Horspool- Hume- unday (BMHH) Use delta in a aght loop If match (delta==0) then check and apply original delta d Input: Text [1..n] and pattern [1..m] Output: occurrences of in 1. for a in Σ do delta[a] = m 2. for j=1..m-1 do delta[[j]] = m-j 3. d = delta[ [ m ] ]; // memorize d on [m] 4. delta[ [ m ] ] = 0; // ensure delta on match of last char is 0 5. for ( i=m ; i<= n ; i = i+d ) 6. repeat // skip loop 7. t=delta[ [i] ] ; i = i + t 8. until t==0 9. for( j=m-1 ; j> 0 and [j]==[i-m+j] ; j = j-1 ) ; 10. if j==0 report match at i-m+1 Daniel M. unday: A very fast substring search algorithm [DF] Communica/ons of the ACM August 1990, Volume 33 Issue 8 Loop unrolling: Avoid too many loops (each loop requires tests) by just repeaang code within the loop. Line 7 in previous algorithm can be replaced by: 7. i += delta[ [i] ]; i += delta[ [i] ]; i += (t = delta[ [i] ]) ; BMHH requires that the text is padded by : [n+1]..[n+m] = (in order for the algorithm to finish correctly at least one occurrence!)
4 Forward- Fast- earch: Another Fast Variant of the Boyer- Moore tring Matching Algorithm The rague tringology Conference '03 Domenico Cantone and imone Faro Abstract: We present a variaaon of the Fast- earch string matching algorithm, a recent member of the large family of Boyer- Moore- like algorithms, and we compare it with some of the most effecave string matching algorithms, such as Horspool, Quick earch, Tuned Boyer- Moore, Reverse Factor, Berry- Ravindran, and Fast- earch itself. All algorithms are compared in terms of run- ame efficiency, number of text character inspecaons, and number of character comparisons. It turns out that our new proposed variant, though not linear, achieves very good results especially in the case of very short paaerns or small alphabets. hap://cs.felk.cvut.cz/psc/event/2003/p2.html.gz (local copy) Factor based approach Opamal average- case algorithms Assuming independent characters, same probability Factor based approach Opamal average- case algorithms Assuming independent characters, same probability Factor a substring of a paaern Any substring (how many?) Factor searches Examples X u Backward DAWG Matching (BDM) Crochemore et al 1994 Backward Nondeterminisac DAWG Matching (BNDM) Navarro, Raffinot 2000 Backward Oracle Matching (BOM) Allauzen, Crochermore, Raffinot 2001 Do not compare characters, but find the longest match to any subregion of the pattern
5 Backward DAWG Matching BDM uffix automaton recognises all factors (and suffixes) in O(n) BNDM simulate using bitparallelism Bits show where the factors have occurred so far Do not compare characters, but find the longest match to any subregion of the pattern BNDM matches an NDA NDA on the suffixes of announce Determinisac version of the same Backward Factor Oracle BNDM Backward Non-Deterministic DAWG Matching BOM - Backward Oracle matching tring Matching of one paaern CTACTACTACGTCTATACTGATCGTAGC TACTACGGTATGACTAA uffix search refix search Factor search 29 5
6 6
Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II
Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)
More informationText Algorithms. Jaak Vilo 2016 fall. MTAT Text Algorithms
Text Algorithms Jaak Vilo 2016 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Topics Exact matching of one pattern(string) Exact matching of multiple patterns Suffix trie and tree indexes Applications Suffix
More informationTopics. Text Algorithms. Algorithms. Exact pattern matching. Find occurrences in text. Animations
3..7 opics ext lgorithms Jaak Vilo 6 fall Exact matching of one pattern(string) Exact matching of multiple patterns uffix trie and tree indexes pplications uffix arrays Inverted index pproximate matching
More informationApplication of String Matching in Auto Grading System
Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute
More informationPractical and Optimal String Matching
Practical and Optimal String Matching Kimmo Fredriksson Department of Computer Science, University of Joensuu, Finland Szymon Grabowski Technical University of Łódź, Computer Engineering Department SPIRE
More informationarxiv: v1 [cs.ds] 3 Jul 2017
Speeding Up String Matching by Weak Factor Recognition Domenico Cantone, Simone Faro, and Arianna Pavone arxiv:1707.00469v1 [cs.ds] 3 Jul 2017 Università di Catania, Viale A. Doria 6, 95125 Catania, Italy
More informationImproving Practical Exact String Matching
Improving Practical Exact String Matching Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We present improved variations of the BNDM algorithm for exact string matching. At each alignment
More informationFast exact string matching algorithms
Information Processing Letters 102 (2007) 229 235 www.elsevier.com/locate/ipl Fast exact string matching algorithms Thierry Lecroq LITIS, Faculté des Sciences et des Techniques, Université de Rouen, 76821
More informationString Matching Algorithms
String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational
More informationThe Exact Online String Matching Problem: A Review of the Most Recent Results
13 The Exact Online String Matching Problem: A Review of the Most Recent Results SIMONE FARO, Università di Catania THIERRY LECROQ, Université derouen This article addresses the online exact string matching
More informationAlgorithms and Data Structures
Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction
More informationString matching algorithms
String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A
More informationMax-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms
Regular Paper Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms Mohammed Sahli 1,a) Tetsuo Shibuya 2 Received: September 8, 2011, Accepted: January 13, 2012 Abstract:
More informationString matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي
String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred
More informationFast Exact String Matching Algorithms
Fast Exact String Matching Algorithms Thierry Lecroq Thierry.Lecroq@univ-rouen.fr Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore
More informationApplied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017
Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of
More informationPLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [Universiteit Twente] On: 21 May 2010 Access details: Access Details: [subscription number 907217948] Publisher Taylor & Francis Informa Ltd Registered in England and Wales
More informationString Matching in Scribblenauts Unlimited
String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia
More informationA Survey of String Matching Algorithms
RESEARCH ARTICLE OPEN ACCESS A Survey of String Matching Algorithms Koloud Al-Khamaiseh*, Shadi ALShagarin** *(Department of Communication and Electronics and Computer Engineering, Tafila Technical University,
More informationSurvey of Exact String Matching Algorithm for Detecting Patterns in Protein Sequence
Advances in Computational Sciences and Technology ISSN 0973-6107 Volume 10, Number 8 (2017) pp. 2707-2720 Research India Publications http://www.ripublication.com Survey of Exact String Matching Algorithm
More informationA Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms
A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms Charalampos S. Kouzinopoulos and Konstantinos G. Margaritis Parallel and Distributed Processing Laboratory Department
More informationKnuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011
Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given
More informationIndexing and Searching
Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)
More informationTuning BNDM with q-grams
Tuning BNDM with q-grams Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We develop bit-parallel algorithms for exact string matching. Our algorithms are variations of the BNDM and Shift-Or
More informationExperimental Results on String Matching Algorithms
SOFTWARE PRACTICE AND EXPERIENCE, VOL. 25(7), 727 765 (JULY 1995) Experimental Results on String Matching Algorithms thierry lecroq Laboratoire d Informatique de Rouen, Université de Rouen, Facultés des
More informationFast Hybrid String Matching Algorithms
Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms
More informationEfficient String Matching Using Bit Parallelism
Efficient String Matching Using Bit Parallelism Kapil Kumar Soni, Rohit Vyas, Dr. Vivek Sharma TIT College, Bhopal, Madhya Pradesh, India Abstract: Bit parallelism is an inherent property of computer to
More informationA Practical Distributed String Matching Algorithm Architecture and Implementation
A Practical Distributed String Matching Algorithm Architecture and Implementation Bi Kun, Gu Nai-jie, Tu Kun, Liu Xiao-hu, and Liu Gang International Science Index, Computer and Information Engineering
More informationHigh Performance Pattern Matching Algorithm for Network Security
IJCSNS International Journal of Computer Science and Network Security, VOL.6 No., October 6 83 High Performance Pattern Matching Algorithm for Network Security Yang Wang and Hidetsune Kobayashi Graduate
More informationStudy of Selected Shifting based String Matching Algorithms
Study of Selected Shifting based String Matching Algorithms G.L. Prajapati, PhD Dept. of Comp. Engg. IET-Devi Ahilya University, Indore Mohd. Sharique Dept. of Comp. Engg. IET-Devi Ahilya University, Indore
More informationAn efficient matching algorithm for encoded DNA sequences and binary strings
An efficient matching algorithm for encoded DNA sequences and binary strings Simone Faro 1 and Thierry Lecroq 2 1 Dipartimento di Matematica e Informatica, Università di Catania, Italy 2 University of
More informationVolume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies
Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com
More informationA New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System
IACSIT International Journal of Engineering and Technology, Vol. 8, No. 2, April 2016 A New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System Nguyen Le Dang, Dac-Nhuong Le,
More informationAlgorithms and Data Structures Lesson 3
Algorithms and Data Structures Lesson 3 Michael Schwarzkopf https://www.uni weimar.de/de/medien/professuren/medieninformatik/grafische datenverarbeitung Bauhaus University Weimar May 30, 2018 Overview...of
More informationFast Substring Matching
Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which
More informationAnswer any FIVE questions 5 x 10 = 50. Graph traversal algorithms process all the vertices of a graph in a systematic fashion.
PES Institute of Technology, Bangalore South Campus (Hosur Road, 1KM before Electronic City, Bangalore 560 100) Solution Set Test III Subject & Code: Design and Analysis of Algorithms(10MCA44) Name of
More informationA Multipattern Matching Algorithm Using Sampling and Bit Index
A Multipattern Matching Algorithm Using Sampling and Bit Index Jinhui Chen, Zhongfu Ye Department of Automation University of Science and Technology of China Hefei, P.R.China jeffcjh@mail.ustc.edu.cn,
More informationGRASPm: an efficient algorithm for exact pattern-matching in genomic sequences
Int. J. Bioinformatics Research and Applications, Vol. GRASPm: an efficient algorithm for exact pattern-matching in genomic sequences Sérgio Deusdado* Centre for Mountain Research (CIMO), Polytechnic Institute
More informationA very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)
A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de
More informationCSCI S-Q Lecture #13 String Searching 8/3/98
CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching
More informationCSC152 Algorithm and Complexity. Lecture 7: String Match
CSC152 Algorithm and Complexity Lecture 7: String Match Outline Brute Force Algorithm Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm Boyer-Moore algorithm String Matching Aims to Detecting the occurrence
More informationTUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH UNROLLING Q-GRAMS AND HASH
Computer Modelling and New Technologies, 2013, Vol.17, No. 4, 58-65 Transport and Telecommunication Institute, Lomonosov 1, LV-1019, Riga, Latvia TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH
More informationA Unifying Look at the Apostolico Giancarlo String-Matching Algorithm
A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm MAXIME CROCHEMORE, IGM (Institut Gaspard-Monge), Université de Marne-la-Vallée, 77454 Marne-la-Vallée CEDEX 2, France. E-mail: mac@univ-mlv.fr,
More informationAccelerating Boyer Moore Searches on Binary Texts
Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il
More informationString Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42
String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt
More informationCSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs
CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to
More informationUniversity of Huddersfield Repository
University of Huddersfield Repository Klaib, Ahmad and Osborne, Hugh OE Matching for Searching Biological Sequences Original Citation Klaib, Ahmad and Osborne, Hugh (2009) OE Matching for Searching Biological
More informationString Processing Workshop
String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string
More informationString Matching using Inverted Lists
nternational Journal of Computer nformation Engineering String Matching using nverted Lists Chouvalit Khancome, Veera Boonjing nternational Science ndex, Computer nformation Engineering aset.org/publication/7400
More informationMultiple Skip Multiple Pattern Matching Algorithm (MSMPMA)
Multiple Skip Multiple Pattern Matching (MSMPMA) Ziad A.A. Alqadi 1, Musbah Aqel 2, & Ibrahiem M. M. El Emary 3 1 Faculty Engineering, Al Balqa Applied University, Amman, Jordan E-mail:ntalia@yahoo.com
More informationWAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA
WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA 2010 WAVE-FRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND
More informationAlgorithms for Weighted Matching
Algorithms for Weighted Matching Leena Salmela and Jorma Tarhio Helsinki University of Technology {lsalmela,tarhio}@cs.hut.fi Abstract. We consider the matching of weighted patterns against an unweighted
More informationAutomaton-based Sublinear Keyword Pattern Matching. SoC Software. Loek Cleophas, Bruce W. Watson, Gerard Zwaan
SPIRE 2004 Padova, Italy October 5 8, 2004 Automaton-based Sublinear Keyword Pattern Matching Loek Cleophas, Bruce W. Watson, Gerard Zwaan SoC Software Construction Software Construction Group Department
More informationChapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input
More informationMulti-Pattern String Matching with Very Large Pattern Sets
Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume
More informationAn introduction to suffix trees and indexing
An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet
More informationBit-Reduced Automaton Inspection for Cloud Security
Bit-Reduced Automaton Inspection for Cloud Security Haiqiang Wang l Kuo-Kun Tseng l* Shu-Chuan Chu 2 John F. Roddick 2 Dachao Li 1 l Department of Computer Science and Technology, Harbin Institute of Technology,
More informationString Searching Algorithm Implementation-Performance Study with Two Cluster Configuration
International Journal of Computer Science & Communication Vol. 1, No. 2, July-December 2010, pp. 271-275 String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration Prasad
More informationCS/COE 1501
CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ String Pattern Matching General idea Have a pattern string p of length m Have a text string t of length n Can we find an index i of string t such that each of
More informationString Matching Algorithms
String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -
More informationA New String Matching Algorithm Based on Logical Indexing
The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department
More informationText Algorithms (6EAP)
Text Algorithms (6EAP) Approximate Matching Jaak Vilo 2017 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Exact vs approximate search In exact search we searched for a string or set of strings in a long
More informationExperiments on string matching in memory structures
Experiments on string matching in memory structures Thierry Lecroq LIR (Laboratoire d'informatique de Rouen) and ABISS (Atelier de Biologie Informatique Statistique et Socio-Linguistique), Universite de
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern
More informationApplication of the BWT Method to Solve the Exact String Matching Problem
Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com
More informationBit-parallel (δ, γ)-matching and Suffix Automata
Bit-parallel (δ, γ)-matching and Suffix Automata Maxime Crochemore a,b,1, Costas S. Iliopoulos b, Gonzalo Navarro c,2,3, Yoan J. Pinzon b,d,2, and Alejandro Salinger c a Institut Gaspard-Monge, Université
More informationPractical Fast Searching in Strings
SOFTWARE-PRACTICE AND EXPERIENCE, VOL. 10, 501-506 (1980) Practical Fast Searching in Strings R. NIGEL HORSPOOL School of Computer Science, McGill University, 805 Sherbrooke Street West, Montreal, Quebec
More informationkvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx
COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?
More informationEfficient Pattern Matching With Flexible Wildcard Gaps and One-off Constraint
Efficient Pattern Matching With Flexible Wildcard Gaps and One-off Constraint Thesis submitted in partial fulfillment of the requirements for the award of degree of Master of Engineering in Computer Science
More informationAlgorithms for Order- Preserving Matching
Departm en tofcom pu terscien ce Algorithms for Order- Preserving Matching TamannaChhabra 90 80 text pattern 70 60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10 11 DOCTORAL DISSERTATIONS Preface First, I
More informationKeywords Pattern Matching Algorithms, Pattern Matching, DNA and Protein Sequences, comparison per character
Volume 3, Issue 5, May 2013 ISSN: 2277 128X International Journal of Advanced Research in Computer Science and Software Engineering Research Paper Available online at: www.ijarcsse.com Index Based Multiple
More informationThis chapter is based on the following sources, which are all recommended reading:
Bioinformatics I, WS 09-10, D. Hson, December 7, 2009 105 6 Fast String Matching This chapter is based on the following sorces, which are all recommended reading: 1. An earlier version of this chapter
More informationAutomaton-based Backward Pattern Matching
Czech Technical University in Prague Faculty of Electrical Engineering Department of Computer Science and Engineering Automaton-based Backward Pattern Matching Doctoral Thesis Jan Antoš PhD program: Computer
More informationThis article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author s institution, sharing
More informationData Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation
Data Structures and Algorithms Course slides: String Matching, Algorithms growth evaluation String Matching Basic Idea: Given a pattern string P, of length M Given a text string, A, of length N Do all
More informationLecture 7 February 26, 2010
6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some
More informationA NEW STRING MATCHING ALGORITHM
Intern. J. Computer Math., Vol. 80, No. 7, July 2003, pp. 825 834 A NEW STRING MATCHING ALGORITHM MUSTAQ AHMED a, *, M. KAYKOBAD a,y and REZAUL ALAM CHOWDHURY b,z a Department of Computer Science and Engineering,
More informationBoyer-Moore strategy to efficient approximate string matching
Boyer-Moore strategy to efficient approximate string matching Nadia El Mabrouk, Maxime Crochemore To cite this version: Nadia El Mabrouk, Maxime Crochemore. Boyer-Moore strategy to efficient approximate
More informationEnhanced Two Sliding Windows Algorithm For Pattern Matching (ETSW) University of Jordan, Amman Jordan
Enhanced Two Sliding Windows Algorithm For Matching (ETSW) Mariam Itriq 1, Amjad Hudaib 2, Aseel Al-Anani 2, Rola Al-Khalid 2, Dima Suleiman 1 1. Department of Business Information Systems, King Abdullah
More informationClever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More informationOn Performance Evaluation of BM-Based String Matching Algorithms in Distributed Computing Environment
International Journal of Future Computer and Communication, Vol. 6, No. 1, March 2017 On Performance Evaluation of BM-Based String Matching Algorithms in Distributed Computing Environment Kunaphas Kongkitimanon
More informationLZW Based Compressed Pattern Matching
LZW Based Compressed attern Matching Tao Tao, Amar Mukherjee School of Electrical Engineering and Computer Science University of Central Florida, Orlando, Fl.32816 USA Email: (ttao+amar)@cs.ucf.edu Abstract
More informationAlgorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE
lgorithms ROBERT SEDGEWICK KEVIN WYNE 5.3 SUBSTRING SERCH lgorithms F O U R T H E D I T I O N ROBERT SEDGEWICK KEVIN WYNE introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp http://algs4.cs.princeton.edu
More informationFast Searching in Biological Sequences Using Multiple Hash Functions
Fast Searching in Biological Sequences Using Multiple Hash Functions Simone Faro Dip. di Matematica e Informatica, Università di Catania Viale A.Doria n.6, 95125 Catania, Italy Email: faro@dmi.unict.it
More information/ department of mathematics and computer science
TABASCO: TAxonomy-BAsed Software COnstruction + A Keyword Pattern Matching Example Loek Cleophas l.g.w.a.cleophas@tue.nl May 11, 2005 Software Construction Group FASTAR Research Espresso Research http://www.win.tue.nl/soc
More information5.3 Substring Search
5.3 Substring Search brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp lgorithms, 4 th Edition Robert Sedgewick and Kevin Wayne opyright 2002 2010 December 3, 2010 7:00:21 M Substring search Goal.
More informationSUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search.
M 202 - LGORITHMS TODY Substring search DPT. OF OMPUTR NGINRING rute force Knuth-Morris-Pratt oyer-moore Rabin-Karp SUSTRING SRH cknowledgement: The course slides are adapted from the slides prepared by
More informationAssignment 2 (programming): Problem Description
CS2210b Data Structures and Algorithms Due: Monday, February 14th Assignment 2 (programming): Problem Description 1 Overview The purpose of this assignment is for students to practice on hashing techniques
More informationSWIFT -A Performance Accelerated Optimized String Matching Algorithm for Nvidia GPUs
2016 15th International Symposium on Parallel and Distributed Computing SWIFT -A Performance Accelerated Optimized String Matching Algorithm for Nvidia GPUs Sourabh S. Shenoy, Supriya Nayak U. and B. Neelima
More informationUniversity of Waterloo CS240 Spring 2018 Help Session Problems
University of Waterloo CS240 Spring 2018 Help Session Problems Reminder: Final on Wednesday, August 1 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems
More informationComputing Patterns in Strings I. Specific, Generic, Intrinsic
Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems
More informationA Two-Hashing Table Multiple String Pattern Matching Algorithm
2013 10th International Conference on Information Technology: New Generations A Two-Hashing Table Multiple String Pattern Matching Algorithm Chouvalit Khancome Department of Computer Science, Faculty of
More information17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching.
17 dicembre 2003 Luca Bortolussi SUFFIX TREES From exact to approximate string matching. An introduction to string matching String matching is an important branch of algorithmica, and it has applications
More informationCSC 421: Algorithm Design & Analysis. Spring Space vs. time
CSC 421: Algorithm Design & Analysis Spring 2015 Space vs. time space/time tradeoffs examples: heap sort, data structure redundancy, hashing string matching brute force, Horspool algorithm, Boyer-Moore
More informationString Patterns and Algorithms on Strings
String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms
More informationInexact Pattern Matching Algorithms via Automata 1
Inexact Pattern Matching Algorithms via Automata 1 1. Introduction Chung W. Ng BioChem 218 March 19, 2007 Pattern matching occurs in various applications, ranging from simple text searching in word processors
More informationData Structures and Algorithms(4)
Ming Zhang Data Structures and Algorithms Data Structures and Algorithms(4) Instructor: Ming Zhang Textbook Authors: Ming Zhang, Tengjiao Wang and Haiyan Zhao Higher Education Press, 2008.6 (the "Eleventh
More informationPattern Matching In LZW Compressed Files
> RELACE THIS LINE WITH YOUR AER IDENTIFICATION NUMBER (DOUBLE-CLICK HERE TO EDIT) < 1 attern Matching In LZW Compressed Files Tao Tao, Amar Mukherjee, Fellow, IEEE Abstract Compressed pattern matching
More informationUniversity of Waterloo CS240R Fall 2017 Review Problems
University of Waterloo CS240R Fall 2017 Review Problems Reminder: Final on Tuesday, December 12 2017 Note: This is a sample of problems designed to help prepare for the final exam. These problems do not
More informationClever Linear Time Algorithms. Maximum Subset String Searching
Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]
More information