Text Algorithms (6EAP) Lecture 3: Exact paaern matching II

Size: px
Start display at page:

Download "Text Algorithms (6EAP) Lecture 3: Exact paaern matching II"

Transcription

1 Text Algorithms (6EA) Lecture 3: Exact paaern matching II Jaak Vilo 2012 fall Jaak Vilo MTAT Text Algorithms 1 2 Algorithms Brute force O(nm) Knuth- Morris- raa O(n) Karp- Rabin hir- OR, hir- AND R. Boyer,.Moore: A fast string searching algorithm. CACM 20 (1977), [DF] Boyer- Moore Factor searches 3 4 ABCDE BBCDE Have we missed anything? What have we learned if we test for a potenaal match from the end? 5 6 1

2 A B 7 8 Bad character heuris2cs maximal shir on [i] A B X X X First x in pattern (from end) delta 1 ( [i] ) m if pattern does not contain [i] patlen-j max j so that [j] == [i] [i] void bminitocc() { char a; int j; for(a=0; a<alphabetsize; a++) occ[a]=-1; for (j=0; j<m; j++) { a=p[j]; occ[a]=j; } } 9 10 Good suffix heuris2cs Boyer- Moore algorithm delta 2 ( [i] ) A B minimal shift so that matched region is fully covered or that the sufix of match is also a prefix of Input: Text [1..n] and pattern [1..m] Output: Occurrences of in preprocess_bm() // delta1 and delta2 i=m while i <= n for( j=m; j>0 and [j]==[i-m+j]; j-- ) ; if j==0 report match at position i-m+1 i = i+ max( delta1[ [i] ], delta2[ j ] )

3 implificaaons of BM hap:// flensburg.de/lang/algorithmen/paaern/bmen.htm hap://biit.cs.ut.ee/~vilo/edu/ /text_algorithms/aracles/exact/boyer- Moore- original- p762- boyer.pdf Animaaon: hap://www- igm.univ- mlv.fr/~lecroq/string/ There are many variants of Boyer- Moore, and many scienafic papers. On average the ame complexity is sublinear Algorithm speed can be improved and yet simplify the code. It is useful to use the last character heurisacs (Horspool (1980), Baeza- Yates(1989), Hume and unday(1991)) Algorithm BMH (Boyer- Moore- Horspool) RN Horspool - racacal Fast earching in trings o&ware - rac/ce and Experience, 10(6): Input: Text [1..n] and pattern [1..m] Output: occurrences of in 1. for a in Σ do delta[a] = m 2. for j=1..m-1 do delta[[j]] = m-j 3. i=m 4. while i <= n 5. if [i] == [m] 6. j = m-1 7. while ( j>0 and [j]==[i-m+j] ) j = j-1 ; 8. if j==0 report match at i-m+1 9. i = i + delta[ [i] ] 15 tring Matching: Horspool algorithm How the comparison is made? Text : attern : From right to left: suffix search Which is the next position of the window? Text : a attern : It depends of where appears the last letter of the text, say it a, in the pattern: a a a a a a a a a Then it is necessary a preprocess that determines the length of the shift. Algorithm Boyer- Moore- Horspool- Hume- unday (BMHH) Use delta in a aght loop If match (delta==0) then check and apply original delta d Input: Text [1..n] and pattern [1..m] Output: occurrences of in 1. for a in Σ do delta[a] = m 2. for j=1..m-1 do delta[[j]] = m-j 3. d = delta[ [ m ] ]; // memorize d on [m] 4. delta[ [ m ] ] = 0; // ensure delta on match of last char is 0 5. for ( i=m ; i<= n ; i = i+d ) 6. repeat // skip loop 7. t=delta[ [i] ] ; i = i + t 8. until t==0 9. for( j=m-1 ; j> 0 and [j]==[i-m+j] ; j = j-1 ) ; 10. if j==0 report match at i-m+1 Daniel M. unday: A very fast substring search algorithm [DF] Communica/ons of the ACM August 1990, Volume 33 Issue 8 Loop unrolling: Avoid too many loops (each loop requires tests) by just repeaang code within the loop. Line 7 in previous algorithm can be replaced by: 7. i += delta[ [i] ]; i += delta[ [i] ]; i += (t = delta[ [i] ]) ; BMHH requires that the text is padded by : [n+1]..[n+m] = (in order for the algorithm to finish correctly at least one occurrence!)

4 Forward- Fast- earch: Another Fast Variant of the Boyer- Moore tring Matching Algorithm The rague tringology Conference '03 Domenico Cantone and imone Faro Abstract: We present a variaaon of the Fast- earch string matching algorithm, a recent member of the large family of Boyer- Moore- like algorithms, and we compare it with some of the most effecave string matching algorithms, such as Horspool, Quick earch, Tuned Boyer- Moore, Reverse Factor, Berry- Ravindran, and Fast- earch itself. All algorithms are compared in terms of run- ame efficiency, number of text character inspecaons, and number of character comparisons. It turns out that our new proposed variant, though not linear, achieves very good results especially in the case of very short paaerns or small alphabets. hap://cs.felk.cvut.cz/psc/event/2003/p2.html.gz (local copy) Factor based approach Opamal average- case algorithms Assuming independent characters, same probability Factor based approach Opamal average- case algorithms Assuming independent characters, same probability Factor a substring of a paaern Any substring (how many?) Factor searches Examples X u Backward DAWG Matching (BDM) Crochemore et al 1994 Backward Nondeterminisac DAWG Matching (BNDM) Navarro, Raffinot 2000 Backward Oracle Matching (BOM) Allauzen, Crochermore, Raffinot 2001 Do not compare characters, but find the longest match to any subregion of the pattern

5 Backward DAWG Matching BDM uffix automaton recognises all factors (and suffixes) in O(n) BNDM simulate using bitparallelism Bits show where the factors have occurred so far Do not compare characters, but find the longest match to any subregion of the pattern BNDM matches an NDA NDA on the suffixes of announce Determinisac version of the same Backward Factor Oracle BNDM Backward Non-Deterministic DAWG Matching BOM - Backward Oracle matching tring Matching of one paaern CTACTACTACGTCTATACTGATCGTAGC TACTACGGTATGACTAA uffix search refix search Factor search 29 5

6 6

Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II

Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Text Algorithms (6EAP) Lecture 3: Exact pa;ern matching II Jaak Vilo 2010 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Find occurrences in text P S 2 Algorithms Brute force O(nm) Knuth- Morris- Pra; O(n)

More information

Text Algorithms. Jaak Vilo 2016 fall. MTAT Text Algorithms

Text Algorithms. Jaak Vilo 2016 fall. MTAT Text Algorithms Text Algorithms Jaak Vilo 2016 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Topics Exact matching of one pattern(string) Exact matching of multiple patterns Suffix trie and tree indexes Applications Suffix

More information

Topics. Text Algorithms. Algorithms. Exact pattern matching. Find occurrences in text. Animations

Topics. Text Algorithms. Algorithms. Exact pattern matching. Find occurrences in text. Animations 3..7 opics ext lgorithms Jaak Vilo 6 fall Exact matching of one pattern(string) Exact matching of multiple patterns uffix trie and tree indexes pplications uffix arrays Inverted index pproximate matching

More information

Application of String Matching in Auto Grading System

Application of String Matching in Auto Grading System Application of String Matching in Auto Grading System Akbar Suryowibowo Syam - 13511048 Computer Science / Informatics Engineering Major School of Electrical Engineering & Informatics Bandung Institute

More information

Practical and Optimal String Matching

Practical and Optimal String Matching Practical and Optimal String Matching Kimmo Fredriksson Department of Computer Science, University of Joensuu, Finland Szymon Grabowski Technical University of Łódź, Computer Engineering Department SPIRE

More information

arxiv: v1 [cs.ds] 3 Jul 2017

arxiv: v1 [cs.ds] 3 Jul 2017 Speeding Up String Matching by Weak Factor Recognition Domenico Cantone, Simone Faro, and Arianna Pavone arxiv:1707.00469v1 [cs.ds] 3 Jul 2017 Università di Catania, Viale A. Doria 6, 95125 Catania, Italy

More information

Improving Practical Exact String Matching

Improving Practical Exact String Matching Improving Practical Exact String Matching Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We present improved variations of the BNDM algorithm for exact string matching. At each alignment

More information

Fast exact string matching algorithms

Fast exact string matching algorithms Information Processing Letters 102 (2007) 229 235 www.elsevier.com/locate/ipl Fast exact string matching algorithms Thierry Lecroq LITIS, Faculté des Sciences et des Techniques, Université de Rouen, 76821

More information

String Matching Algorithms

String Matching Algorithms String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational

More information

The Exact Online String Matching Problem: A Review of the Most Recent Results

The Exact Online String Matching Problem: A Review of the Most Recent Results 13 The Exact Online String Matching Problem: A Review of the Most Recent Results SIMONE FARO, Università di Catania THIERRY LECROQ, Université derouen This article addresses the online exact string matching

More information

Algorithms and Data Structures

Algorithms and Data Structures Algorithms and Data Structures Charles A. Wuethrich Bauhaus-University Weimar - CogVis/MMC May 11, 2017 Algorithms and Data Structures String searching algorithm 1/29 String searching algorithm Introduction

More information

String matching algorithms

String matching algorithms String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A

More information

Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms

Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms Regular Paper Max-Shift BM and Max-Shift Horspool: Practical Fast Exact String Matching Algorithms Mohammed Sahli 1,a) Tetsuo Shibuya 2 Received: September 8, 2011, Accepted: January 13, 2012 Abstract:

More information

String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي

String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي String matching algorithms تقديم الطالب: سليمان ضاهر اشراف المدرس: علي جنيدي للعام الدراسي: 2017/2016 The Introduction The introduction to information theory is quite simple. The invention of writing occurred

More information

Fast Exact String Matching Algorithms

Fast Exact String Matching Algorithms Fast Exact String Matching Algorithms Thierry Lecroq Thierry.Lecroq@univ-rouen.fr Laboratoire d Informatique, Traitement de l Information, Systèmes. Part of this work has been done with Maxime Crochemore

More information

Applied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017

Applied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017 Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of

More information

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use: This article was downloaded by: [Universiteit Twente] On: 21 May 2010 Access details: Access Details: [subscription number 907217948] Publisher Taylor & Francis Informa Ltd Registered in England and Wales

More information

String Matching in Scribblenauts Unlimited

String Matching in Scribblenauts Unlimited String Matching in Scribblenauts Unlimited Jordan Fernando / 13510069 Program Studi Teknik Informatika Sekolah Teknik Elektro dan Informatika Institut Teknologi Bandung, Jl. Ganesha 10 Bandung 40132, Indonesia

More information

A Survey of String Matching Algorithms

A Survey of String Matching Algorithms RESEARCH ARTICLE OPEN ACCESS A Survey of String Matching Algorithms Koloud Al-Khamaiseh*, Shadi ALShagarin** *(Department of Communication and Electronics and Computer Engineering, Tafila Technical University,

More information

Survey of Exact String Matching Algorithm for Detecting Patterns in Protein Sequence

Survey of Exact String Matching Algorithm for Detecting Patterns in Protein Sequence Advances in Computational Sciences and Technology ISSN 0973-6107 Volume 10, Number 8 (2017) pp. 2707-2720 Research India Publications http://www.ripublication.com Survey of Exact String Matching Algorithm

More information

A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms

A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms A Performance Evaluation of the Preprocessing Phase of Multiple Keyword Matching Algorithms Charalampos S. Kouzinopoulos and Konstantinos G. Margaritis Parallel and Distributed Processing Laboratory Department

More information

Knuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011

Knuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011 Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given

More information

Indexing and Searching

Indexing and Searching Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)

More information

Tuning BNDM with q-grams

Tuning BNDM with q-grams Tuning BNDM with q-grams Branislav Ďurian Jan Holub Hannu Peltola Jorma Tarhio Abstract We develop bit-parallel algorithms for exact string matching. Our algorithms are variations of the BNDM and Shift-Or

More information

Experimental Results on String Matching Algorithms

Experimental Results on String Matching Algorithms SOFTWARE PRACTICE AND EXPERIENCE, VOL. 25(7), 727 765 (JULY 1995) Experimental Results on String Matching Algorithms thierry lecroq Laboratoire d Informatique de Rouen, Université de Rouen, Facultés des

More information

Fast Hybrid String Matching Algorithms

Fast Hybrid String Matching Algorithms Fast Hybrid String Matching Algorithms Jamuna Bhandari 1 and Anil Kumar 2 1 Dept. of CSE, Manipal University Jaipur, INDIA 2 Dept of CSE, Manipal University Jaipur, INDIA ABSTRACT Various Hybrid algorithms

More information

Efficient String Matching Using Bit Parallelism

Efficient String Matching Using Bit Parallelism Efficient String Matching Using Bit Parallelism Kapil Kumar Soni, Rohit Vyas, Dr. Vivek Sharma TIT College, Bhopal, Madhya Pradesh, India Abstract: Bit parallelism is an inherent property of computer to

More information

A Practical Distributed String Matching Algorithm Architecture and Implementation

A Practical Distributed String Matching Algorithm Architecture and Implementation A Practical Distributed String Matching Algorithm Architecture and Implementation Bi Kun, Gu Nai-jie, Tu Kun, Liu Xiao-hu, and Liu Gang International Science Index, Computer and Information Engineering

More information

High Performance Pattern Matching Algorithm for Network Security

High Performance Pattern Matching Algorithm for Network Security IJCSNS International Journal of Computer Science and Network Security, VOL.6 No., October 6 83 High Performance Pattern Matching Algorithm for Network Security Yang Wang and Hidetsune Kobayashi Graduate

More information

Study of Selected Shifting based String Matching Algorithms

Study of Selected Shifting based String Matching Algorithms Study of Selected Shifting based String Matching Algorithms G.L. Prajapati, PhD Dept. of Comp. Engg. IET-Devi Ahilya University, Indore Mohd. Sharique Dept. of Comp. Engg. IET-Devi Ahilya University, Indore

More information

An efficient matching algorithm for encoded DNA sequences and binary strings

An efficient matching algorithm for encoded DNA sequences and binary strings An efficient matching algorithm for encoded DNA sequences and binary strings Simone Faro 1 and Thierry Lecroq 2 1 Dipartimento di Matematica e Informatica, Università di Catania, Italy 2 University of

More information

Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies

Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Volume 3, Issue 9, September 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com

More information

A New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System

A New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System IACSIT International Journal of Engineering and Technology, Vol. 8, No. 2, April 2016 A New Multiple-Pattern Matching Algorithm for the Network Intrusion Detection System Nguyen Le Dang, Dac-Nhuong Le,

More information

Algorithms and Data Structures Lesson 3

Algorithms and Data Structures Lesson 3 Algorithms and Data Structures Lesson 3 Michael Schwarzkopf https://www.uni weimar.de/de/medien/professuren/medieninformatik/grafische datenverarbeitung Bauhaus University Weimar May 30, 2018 Overview...of

More information

Fast Substring Matching

Fast Substring Matching Fast Substring Matching Andreas Klein 1 2 3 4 5 6 7 8 9 10 Abstract The substring matching problem occurs in several applications. Two of the well-known solutions are the Knuth-Morris-Pratt algorithm (which

More information

Answer any FIVE questions 5 x 10 = 50. Graph traversal algorithms process all the vertices of a graph in a systematic fashion.

Answer any FIVE questions 5 x 10 = 50. Graph traversal algorithms process all the vertices of a graph in a systematic fashion. PES Institute of Technology, Bangalore South Campus (Hosur Road, 1KM before Electronic City, Bangalore 560 100) Solution Set Test III Subject & Code: Design and Analysis of Algorithms(10MCA44) Name of

More information

A Multipattern Matching Algorithm Using Sampling and Bit Index

A Multipattern Matching Algorithm Using Sampling and Bit Index A Multipattern Matching Algorithm Using Sampling and Bit Index Jinhui Chen, Zhongfu Ye Department of Automation University of Science and Technology of China Hefei, P.R.China jeffcjh@mail.ustc.edu.cn,

More information

GRASPm: an efficient algorithm for exact pattern-matching in genomic sequences

GRASPm: an efficient algorithm for exact pattern-matching in genomic sequences Int. J. Bioinformatics Research and Applications, Vol. GRASPm: an efficient algorithm for exact pattern-matching in genomic sequences Sérgio Deusdado* Centre for Mountain Research (CIMO), Polytechnic Institute

More information

A very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract)

A very fast string matching algorithm for small. alphabets and long patterns. (Extended abstract) A very fast string matching algorithm for small alphabets and long patterns (Extended abstract) Christian Charras 1, Thierry Lecroq 1, and Joseph Daniel Pehoushek 2 1 LIR (Laboratoire d'informatique de

More information

CSCI S-Q Lecture #13 String Searching 8/3/98

CSCI S-Q Lecture #13 String Searching 8/3/98 CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching

More information

CSC152 Algorithm and Complexity. Lecture 7: String Match

CSC152 Algorithm and Complexity. Lecture 7: String Match CSC152 Algorithm and Complexity Lecture 7: String Match Outline Brute Force Algorithm Knuth-Morris-Pratt Algorithm Rabin-Karp Algorithm Boyer-Moore algorithm String Matching Aims to Detecting the occurrence

More information

TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH UNROLLING Q-GRAMS AND HASH

TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH UNROLLING Q-GRAMS AND HASH Computer Modelling and New Technologies, 2013, Vol.17, No. 4, 58-65 Transport and Telecommunication Institute, Lomonosov 1, LV-1019, Riga, Latvia TUNING BG MULTI-PATTERN STRING MATCHING ALGORITHM WITH

More information

A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm

A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm A Unifying Look at the Apostolico Giancarlo String-Matching Algorithm MAXIME CROCHEMORE, IGM (Institut Gaspard-Monge), Université de Marne-la-Vallée, 77454 Marne-la-Vallée CEDEX 2, France. E-mail: mac@univ-mlv.fr,

More information

Accelerating Boyer Moore Searches on Binary Texts

Accelerating Boyer Moore Searches on Binary Texts Accelerating Boyer Moore Searches on Binary Texts Shmuel T. Klein Miri Kopel Ben-Nissan Department of Computer Science, Bar Ilan University, Ramat-Gan 52900, Israel Tel: (972 3) 531 8865 Email: {tomi,kopel}@cs.biu.ac.il

More information

String Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42

String Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42 String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt

More information

CSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs

CSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to

More information

University of Huddersfield Repository

University of Huddersfield Repository University of Huddersfield Repository Klaib, Ahmad and Osborne, Hugh OE Matching for Searching Biological Sequences Original Citation Klaib, Ahmad and Osborne, Hugh (2009) OE Matching for Searching Biological

More information

String Processing Workshop

String Processing Workshop String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string

More information

String Matching using Inverted Lists

String Matching using Inverted Lists nternational Journal of Computer nformation Engineering String Matching using nverted Lists Chouvalit Khancome, Veera Boonjing nternational Science ndex, Computer nformation Engineering aset.org/publication/7400

More information

Multiple Skip Multiple Pattern Matching Algorithm (MSMPMA)

Multiple Skip Multiple Pattern Matching Algorithm (MSMPMA) Multiple Skip Multiple Pattern Matching (MSMPMA) Ziad A.A. Alqadi 1, Musbah Aqel 2, & Ibrahiem M. M. El Emary 3 1 Faculty Engineering, Al Balqa Applied University, Amman, Jordan E-mail:ntalia@yahoo.com

More information

WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA

WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA WAVEFRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND GPGPU PLATFORM BILAL MAHMOUD ISSA SHEHABAT UNIVERSITI SAINS MALAYSIA 2010 WAVE-FRONT LONGEST COMMON SUBSEQUENCE ALGORITHM ON MULTICORE AND

More information

Algorithms for Weighted Matching

Algorithms for Weighted Matching Algorithms for Weighted Matching Leena Salmela and Jorma Tarhio Helsinki University of Technology {lsalmela,tarhio}@cs.hut.fi Abstract. We consider the matching of weighted patterns against an unweighted

More information

Automaton-based Sublinear Keyword Pattern Matching. SoC Software. Loek Cleophas, Bruce W. Watson, Gerard Zwaan

Automaton-based Sublinear Keyword Pattern Matching. SoC Software. Loek Cleophas, Bruce W. Watson, Gerard Zwaan SPIRE 2004 Padova, Italy October 5 8, 2004 Automaton-based Sublinear Keyword Pattern Matching Loek Cleophas, Bruce W. Watson, Gerard Zwaan SoC Software Construction Software Construction Group Department

More information

Chapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input

More information

Multi-Pattern String Matching with Very Large Pattern Sets

Multi-Pattern String Matching with Very Large Pattern Sets Multi-Pattern String Matching with Very Large Pattern Sets Leena Salmela L. Salmela, J. Tarhio and J. Kytöjoki: Multi-pattern string matching with q-grams. ACM Journal of Experimental Algorithmics, Volume

More information

An introduction to suffix trees and indexing

An introduction to suffix trees and indexing An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet

More information

Bit-Reduced Automaton Inspection for Cloud Security

Bit-Reduced Automaton Inspection for Cloud Security Bit-Reduced Automaton Inspection for Cloud Security Haiqiang Wang l Kuo-Kun Tseng l* Shu-Chuan Chu 2 John F. Roddick 2 Dachao Li 1 l Department of Computer Science and Technology, Harbin Institute of Technology,

More information

String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration

String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration International Journal of Computer Science & Communication Vol. 1, No. 2, July-December 2010, pp. 271-275 String Searching Algorithm Implementation-Performance Study with Two Cluster Configuration Prasad

More information

CS/COE 1501

CS/COE 1501 CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ String Pattern Matching General idea Have a pattern string p of length m Have a text string t of length n Can we find an index i of string t such that each of

More information

String Matching Algorithms

String Matching Algorithms String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -

More information

A New String Matching Algorithm Based on Logical Indexing

A New String Matching Algorithm Based on Logical Indexing The 5th International Conference on Electrical Engineering and Informatics 2015 August 10-11, 2015, Bali, Indonesia A New String Matching Algorithm Based on Logical Indexing Daniar Heri Kurniawan Department

More information

Text Algorithms (6EAP)

Text Algorithms (6EAP) Text Algorithms (6EAP) Approximate Matching Jaak Vilo 2017 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Exact vs approximate search In exact search we searched for a string or set of strings in a long

More information

Experiments on string matching in memory structures

Experiments on string matching in memory structures Experiments on string matching in memory structures Thierry Lecroq LIR (Laboratoire d'informatique de Rouen) and ABISS (Atelier de Biologie Informatique Statistique et Socio-Linguistique), Universite de

More information

CMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction

CMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: introduction CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: introduction Sequence alignment: exact matching ACAGGTACAGTTCCCTCGACACCTACTACCTAAG CCTACT CCTACT CCTACT CCTACT Text Pattern

More information

Application of the BWT Method to Solve the Exact String Matching Problem

Application of the BWT Method to Solve the Exact String Matching Problem Application of the BWT Method to Solve the Exact String Matching Problem T. W. Chen and R. C. T. Lee Department of Computer Science National Tsing Hua University, Hsinchu, Taiwan chen81052084@gmail.com

More information

Bit-parallel (δ, γ)-matching and Suffix Automata

Bit-parallel (δ, γ)-matching and Suffix Automata Bit-parallel (δ, γ)-matching and Suffix Automata Maxime Crochemore a,b,1, Costas S. Iliopoulos b, Gonzalo Navarro c,2,3, Yoan J. Pinzon b,d,2, and Alejandro Salinger c a Institut Gaspard-Monge, Université

More information

Practical Fast Searching in Strings

Practical Fast Searching in Strings SOFTWARE-PRACTICE AND EXPERIENCE, VOL. 10, 501-506 (1980) Practical Fast Searching in Strings R. NIGEL HORSPOOL School of Computer Science, McGill University, 805 Sherbrooke Street West, Montreal, Quebec

More information

kvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx

kvjlixapejrbxeenpphkhthbkwyrwamnugzhppfx COS 226 Lecture 12: String searching String search analysis TEXT: N characters PATTERN: M characters Idea to test algorithms: use random pattern or random text Existence: Any occurrence of pattern in text?

More information

Efficient Pattern Matching With Flexible Wildcard Gaps and One-off Constraint

Efficient Pattern Matching With Flexible Wildcard Gaps and One-off Constraint Efficient Pattern Matching With Flexible Wildcard Gaps and One-off Constraint Thesis submitted in partial fulfillment of the requirements for the award of degree of Master of Engineering in Computer Science

More information

Algorithms for Order- Preserving Matching

Algorithms for Order- Preserving Matching Departm en tofcom pu terscien ce Algorithms for Order- Preserving Matching TamannaChhabra 90 80 text pattern 70 60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10 11 DOCTORAL DISSERTATIONS Preface First, I

More information

Keywords Pattern Matching Algorithms, Pattern Matching, DNA and Protein Sequences, comparison per character

Keywords Pattern Matching Algorithms, Pattern Matching, DNA and Protein Sequences, comparison per character Volume 3, Issue 5, May 2013 ISSN: 2277 128X International Journal of Advanced Research in Computer Science and Software Engineering Research Paper Available online at: www.ijarcsse.com Index Based Multiple

More information

This chapter is based on the following sources, which are all recommended reading:

This chapter is based on the following sources, which are all recommended reading: Bioinformatics I, WS 09-10, D. Hson, December 7, 2009 105 6 Fast String Matching This chapter is based on the following sorces, which are all recommended reading: 1. An earlier version of this chapter

More information

Automaton-based Backward Pattern Matching

Automaton-based Backward Pattern Matching Czech Technical University in Prague Faculty of Electrical Engineering Department of Computer Science and Engineering Automaton-based Backward Pattern Matching Doctoral Thesis Jan Antoš PhD program: Computer

More information

This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author s institution, sharing

More information

Data Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation

Data Structures and Algorithms. Course slides: String Matching, Algorithms growth evaluation Data Structures and Algorithms Course slides: String Matching, Algorithms growth evaluation String Matching Basic Idea: Given a pattern string P, of length M Given a text string, A, of length N Do all

More information

Lecture 7 February 26, 2010

Lecture 7 February 26, 2010 6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some

More information

A NEW STRING MATCHING ALGORITHM

A NEW STRING MATCHING ALGORITHM Intern. J. Computer Math., Vol. 80, No. 7, July 2003, pp. 825 834 A NEW STRING MATCHING ALGORITHM MUSTAQ AHMED a, *, M. KAYKOBAD a,y and REZAUL ALAM CHOWDHURY b,z a Department of Computer Science and Engineering,

More information

Boyer-Moore strategy to efficient approximate string matching

Boyer-Moore strategy to efficient approximate string matching Boyer-Moore strategy to efficient approximate string matching Nadia El Mabrouk, Maxime Crochemore To cite this version: Nadia El Mabrouk, Maxime Crochemore. Boyer-Moore strategy to efficient approximate

More information

Enhanced Two Sliding Windows Algorithm For Pattern Matching (ETSW) University of Jordan, Amman Jordan

Enhanced Two Sliding Windows Algorithm For Pattern Matching (ETSW) University of Jordan, Amman Jordan Enhanced Two Sliding Windows Algorithm For Matching (ETSW) Mariam Itriq 1, Amjad Hudaib 2, Aseel Al-Anani 2, Rola Al-Khalid 2, Dima Suleiman 1 1. Department of Business Information Systems, King Abdullah

More information

Clever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange

Clever Linear Time Algorithms. Maximum Subset String Searching. Maximum Subrange Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]

More information

On Performance Evaluation of BM-Based String Matching Algorithms in Distributed Computing Environment

On Performance Evaluation of BM-Based String Matching Algorithms in Distributed Computing Environment International Journal of Future Computer and Communication, Vol. 6, No. 1, March 2017 On Performance Evaluation of BM-Based String Matching Algorithms in Distributed Computing Environment Kunaphas Kongkitimanon

More information

LZW Based Compressed Pattern Matching

LZW Based Compressed Pattern Matching LZW Based Compressed attern Matching Tao Tao, Amar Mukherjee School of Electrical Engineering and Computer Science University of Central Florida, Orlando, Fl.32816 USA Email: (ttao+amar)@cs.ucf.edu Abstract

More information

Algorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE

Algorithms. Algorithms 5.3 SUBSTRING SEARCH. introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp ROBERT SEDGEWICK KEVIN WAYNE lgorithms ROBERT SEDGEWICK KEVIN WYNE 5.3 SUBSTRING SERCH lgorithms F O U R T H E D I T I O N ROBERT SEDGEWICK KEVIN WYNE introduction brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp http://algs4.cs.princeton.edu

More information

Fast Searching in Biological Sequences Using Multiple Hash Functions

Fast Searching in Biological Sequences Using Multiple Hash Functions Fast Searching in Biological Sequences Using Multiple Hash Functions Simone Faro Dip. di Matematica e Informatica, Università di Catania Viale A.Doria n.6, 95125 Catania, Italy Email: faro@dmi.unict.it

More information

/ department of mathematics and computer science

/ department of mathematics and computer science TABASCO: TAxonomy-BAsed Software COnstruction + A Keyword Pattern Matching Example Loek Cleophas l.g.w.a.cleophas@tue.nl May 11, 2005 Software Construction Group FASTAR Research Espresso Research http://www.win.tue.nl/soc

More information

5.3 Substring Search

5.3 Substring Search 5.3 Substring Search brute force Knuth-Morris-Pratt Boyer-Moore Rabin-Karp lgorithms, 4 th Edition Robert Sedgewick and Kevin Wayne opyright 2002 2010 December 3, 2010 7:00:21 M Substring search Goal.

More information

SUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search.

SUBSTRING SEARCH BBM ALGORITHMS TODAY DEPT. OF COMPUTER ENGINEERING. Substring search applications. Substring search. M 202 - LGORITHMS TODY Substring search DPT. OF OMPUTR NGINRING rute force Knuth-Morris-Pratt oyer-moore Rabin-Karp SUSTRING SRH cknowledgement: The course slides are adapted from the slides prepared by

More information

Assignment 2 (programming): Problem Description

Assignment 2 (programming): Problem Description CS2210b Data Structures and Algorithms Due: Monday, February 14th Assignment 2 (programming): Problem Description 1 Overview The purpose of this assignment is for students to practice on hashing techniques

More information

SWIFT -A Performance Accelerated Optimized String Matching Algorithm for Nvidia GPUs

SWIFT -A Performance Accelerated Optimized String Matching Algorithm for Nvidia GPUs 2016 15th International Symposium on Parallel and Distributed Computing SWIFT -A Performance Accelerated Optimized String Matching Algorithm for Nvidia GPUs Sourabh S. Shenoy, Supriya Nayak U. and B. Neelima

More information

University of Waterloo CS240 Spring 2018 Help Session Problems

University of Waterloo CS240 Spring 2018 Help Session Problems University of Waterloo CS240 Spring 2018 Help Session Problems Reminder: Final on Wednesday, August 1 2018 Note: This is a sample of problems designed to help prepare for the final exam. These problems

More information

Computing Patterns in Strings I. Specific, Generic, Intrinsic

Computing Patterns in Strings I. Specific, Generic, Intrinsic Outline : Specific, Generic, Intrinsic 1,2,3 1 Algorithms Research Group, Department of Computing & Software McMaster University, Hamilton, Ontario, Canada email: smyth@mcmaster.ca 2 Digital Ecosystems

More information

A Two-Hashing Table Multiple String Pattern Matching Algorithm

A Two-Hashing Table Multiple String Pattern Matching Algorithm 2013 10th International Conference on Information Technology: New Generations A Two-Hashing Table Multiple String Pattern Matching Algorithm Chouvalit Khancome Department of Computer Science, Faculty of

More information

17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching.

17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching. 17 dicembre 2003 Luca Bortolussi SUFFIX TREES From exact to approximate string matching. An introduction to string matching String matching is an important branch of algorithmica, and it has applications

More information

CSC 421: Algorithm Design & Analysis. Spring Space vs. time

CSC 421: Algorithm Design & Analysis. Spring Space vs. time CSC 421: Algorithm Design & Analysis Spring 2015 Space vs. time space/time tradeoffs examples: heap sort, data structure redundancy, hashing string matching brute force, Horspool algorithm, Boyer-Moore

More information

String Patterns and Algorithms on Strings

String Patterns and Algorithms on Strings String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms

More information

Inexact Pattern Matching Algorithms via Automata 1

Inexact Pattern Matching Algorithms via Automata 1 Inexact Pattern Matching Algorithms via Automata 1 1. Introduction Chung W. Ng BioChem 218 March 19, 2007 Pattern matching occurs in various applications, ranging from simple text searching in word processors

More information

Data Structures and Algorithms(4)

Data Structures and Algorithms(4) Ming Zhang Data Structures and Algorithms Data Structures and Algorithms(4) Instructor: Ming Zhang Textbook Authors: Ming Zhang, Tengjiao Wang and Haiyan Zhao Higher Education Press, 2008.6 (the "Eleventh

More information

Pattern Matching In LZW Compressed Files

Pattern Matching In LZW Compressed Files > RELACE THIS LINE WITH YOUR AER IDENTIFICATION NUMBER (DOUBLE-CLICK HERE TO EDIT) < 1 attern Matching In LZW Compressed Files Tao Tao, Amar Mukherjee, Fellow, IEEE Abstract Compressed pattern matching

More information

University of Waterloo CS240R Fall 2017 Review Problems

University of Waterloo CS240R Fall 2017 Review Problems University of Waterloo CS240R Fall 2017 Review Problems Reminder: Final on Tuesday, December 12 2017 Note: This is a sample of problems designed to help prepare for the final exam. These problems do not

More information

Clever Linear Time Algorithms. Maximum Subset String Searching

Clever Linear Time Algorithms. Maximum Subset String Searching Clever Linear Time Algorithms Maximum Subset String Searching Maximum Subrange Given an array of numbers values[1..n] where some are negative and some are positive, find the subarray values[start..end]

More information