Inf1-OOP. Data Types. A Foundation for Programming. type value set operations. Overview. Using Data Types 1. Image Processing

Transcription

1 Inf1-OOP Using Data Types 1 Ewan Klein, Perdita Stevens School of Informatics January 10, 2013 Overview Image Processing String Processing Summary/Admin 1 Thanks to Sedgewick&Wayne for much of this content A Foundation for Programming Data Types Data type: a set of values and operations on those values. Primitive types: data types whose operations translate directly to machine instructions. objects functions and modules graphics, sound and image I/O arrays conditionals and loops create your own data types type value set operations int integers add, subtract, multiply, divide double floating-point numbers add, subtract, multiply, divide boolean truth values and, or, not Math primitive data types text I/O assignment statements But we want to write code that will process other types of data: Colors, pictures, strings, input streams,... Complex numbers, vectors, matrices, polynomials,... Points, polygons, charged particles, celestial bodies,...

2 User-defined data types Object An object has state, behaviour and identity. Java is a class-based object-oriented language. A class is a kind of data type that you can define yourself. An object is an instance of a class. The code in a Java system is organised into classes. The system runs by objects sending messages to one another, and reacting to receiving messages, possibly by sending other messages... the sender trusts the receiver to do the right thing (Most) variables refer to objects. State: the data that the object encapsulates the object may decide to modify its state in response to a message but immutable objects never do this Behaviour: the messages the object understands, and what it does in response exactly what an object does in response to a message may depend on its state Identity: two objects may currently have identical data, but be different objects e.g. o1 and o2 could be in the same state now, but not after you sent a message to o1, which affects o1 s state but not o2 s. Why use object orientation? OO has taken the world by storm. Why? For programming, OOP is nice, but not clearly better than FP, say. For software engineering, OO is definitely better use objects to model real-world things use classes to model domain concepts. These change more slowly than specific functional requirements, so what OO does is to put things together that change together as requirements evolve. Change is the thing that makes software engineering hard and interesting; OO helps manage it. for most applications, E&OE, don t tell PW I said so :-)

3 Constructors and Methods Static Methods vs. Instance Methods declare a variable (object name) String s; call a constructor to create an object s = new String("Hello, World!"); System.out.println( s.substring(0, 5) ); object name call an instance method that operates on the object's value Static Methods: Associated with a class. Identifying a method in a separate class requires name of the class: Math.abs(), PointDistance.distance(). Instance Methods: Associated with an object. Identifying an instance method requires an object name: s.substring() Colour Data Type Colour: a visual perception property in humans deriving from interaction of the eye with electromagnetic radiation. Set of values (RGB representation): possible values, which quantify the amount of red, green and blue, each on a scale of 0 to 255. R G B Colour Java Color API public class java.awt.color Color(int r, int g, int b) constructor int getred() red intensity int getgreen() green intensity int getblue() blue intensity Color brighter() brighter version of this colour Color darker() darker version of this colour String tostring() string representation of this colour boolean equals(color c) is this colour s value the same as c s? Color.html Standard format for expressing APIs. Will be used in coming weeks.

4 Albers Squares Albers Squares blue grey % java AlbersSquares Homage to the Square, Josef Albers (series painted ) Using Colours in Java Using Colours in Java import java.awt.color; access the Color library public class AlbersSquares { public static void main(string[] args) { int r1 = Integer.parseInt(args[0]); int g1 = Integer.parseInt(args[1]); int b1 = Integer.parseInt(args[2]); Color c1 = new Color(r1, g1, b1); int r2 = Integer.parseInt(args[3]); int g2 = Integer.parseInt(args[4]); int b2 = Integer.parseInt(args[5]); Color c2 = new Color(r2, g2, b2); StdDraw.setPenColor(c1); StdDraw.filledSquare(.25,.5,.2); StdDraw.setPenColor(c2); StdDraw.filledSquare(.25,.5,.1); first colour second colour first square Color c1 = new Color(r1, g1, b1): Call the Color constructor to create a new color object c1 with arguments for RGB. Example makes use of StdDraw library filledsquare(double x, double y, double r): Draw a filled square of side length 2r, centered on (x, y). StdDraw.setPenColor(c2); StdDraw.filledSquare(.75,.5,.2); StdDraw.setPenColor(c1); StdDraw.filledSquare(.75,.5,.1); second square

5 Monochrome Luminance Colour Compatibility Monochrome Luminance: effective brightness of a colour. In TV transmission, calculated as the weighted sum of R, G and B. NTSC formula for luminance: Y = (0.299 R) + (0.587 G) + (0.114 B) import java.awt.color; public class Luminance { public static double luminance(color color) { int r = color.getred(); int g = color.getgreen(); int b = color.getblue(); return 0.299*r *g *b; Q: Which font colours will be most readable on given background colours on computer and mobile phone screens? A: Rule of thumb: luminance should be Grayscale Grayscale: when all three R, G and B values are the same, the resulting colour is on grayscale, from 0 (black) to 255 (white). Conversion: Coloured images can be converted to grayscale using luminance to determine the value. public static Color togrey(color color) { int y = (int) (Math.round(lum(color))); Color gray = new Color(y, y, y); return grey; round double to nearest int red green blue this colour: grayscale version: black: Color Data Type The Color data type is a way of abstracting away from the physical reality of colour. Separates the task of specifying and manipulating colours from the task of reproducing colours in various mediums (print, web, photos,... ). The Color data type implements one particular model of colour, namely RGB (three 8-bit integers). Y = ( ) + ( ) + ( ) =

6 Color Data Type OOP Context for Colour Possible memory representation: D0 D1 D2 D3 D4 D5 D6 D7 D8 The method luminance() takes a parameter of type Color, which in turn allows it to call methods that are part of the Color API; e.g., Color.getRed(). The method togrey() returns a value of type Color, which in effect allows it to return a bundle of three integer values (i.e., the RGB values of a particular colour). Color is called reference type (vs. primitive type) magenta A0 D0 memory address ("pointer") B0 D6 gray Object reference is analogous to variable name: We can manipulate the value that it holds. We can pass it to a method, or return it from one. String Data Type String Data Type: basis for text processing Set of Values: sequence of Unicode characters public class String String(String s) create a string with same value as s int length() return length of string char charat(int i) i th character String substring(int i, int j) i th through (j 1) th characters boolean contains(string sub) does string contain sub as a substring? boolean startswith(string pre) does string start with pre? boolean startswith(string post) does string end with post? int indexof(string p) index of first occurrence of p int indexof(string p, int i) index of first occurrence of p after i String concat(string t) this string with t appended int compareto(string t) compare lexicographically with t String replaceall(string a, String b) result of changing all as to bs String[] split(string delim) result of splitting string at delim boolean equals(string t) is this string the same as t? http: //download.oracle.com/javase/6/docs/api/java/lang/string.html Typical String Processing Code is the string a palindrome? extract filenames and extensions from a command-line argument print all lines from standard input containing the string info print all ac.uk URLs in text file on standard input public static boolean ispalindrome(string s) { int N = s.length(); for (int i = 0; i < N / 2; i++) { if (s.charat(i)!= s.charat(n i)) return false; return true; String s = args[0]; int dot = s.indexof("."); String base = s.substring(0, dot); String extension = s.substring(dot + 1, s.length()); while (!StdIn.isEmpty()) { String s = StdIn.readLine(); if (s.contains("info")) System.out.println(s); while (!StdIn.isEmpty()) { String s = StdIn.readString(); if (s.startswith(" && s.endswith("ac.uk" System.out.println(s);

7 Gene Finding Gene Finding: Algorithm Pregenomic era: Sequencing the human genome [Human Genome Project, 2003]. Postgenomic era: Analyse the data and understand structure. Genome: Represent genome as a string over {A, C, T, G alphabet. Gene: A substring of genome that represents a functional unit. Preceded by ATG (start codon). Multiples of three nucleotides (codons other than start/stop). Succeeded by TAG, TAA or TGA (stop codons). Goal: find all genes A T A G A T G C A T A G C G C A T A G C T A G A T G T G C T A G C start gene stop gene Algorithm: Scan left-to-right through genome. If start codon, then set beg to index i. If stop codon and substring is multiple of 3: output gene reset beg to -1 i start stop beg gene remaining portion of input 0-1 ATAGATGCATAGCGCATAGCTAGATGTGCTA 1 TAG -1 ATAGATGCATAGCGCATAGCTAGATGTGCTA 4 ATG 4 ATAGATGCATAGCGCATAGCTAGATGTGCTA 9 TAG 4 ATAGATGCATAGCGCATAGCTAGATGTGCTA 16 TAG 4 CATAGCGCA ATAGATGCATAGCGCATAGCTAGATGTGCTA 20 TAG -1 ATAGATGCATAGCGCATAGCTAGATGTGCTA 23 ATG 23 ATAGATGCATAGCGCATAGCTAGATGTGCTA 29 TAG 23 TGC ATAGATGCATAGCGCATAGCTAGATGTGCTA Strings and Equality OOP Framework for Strings Possible memory representation of a string genome = "AACAAGTTTACAAGC" equals(): are the characters inside a String object the same? ==: do the two object references refer to the same instance? In all the coursework for this course, you should be using equals() for checking whether two strings are the same D0 D1 D2 D3 D4 D5 D6 D7 D8 D9 DA DB DC DD DE A0 A1 A A C A A G T T T A C A A G C D0 15 s = genome.substring(1, 5); t = genome.substring(9, 13); s memory address genome t B0 B1 B2 B3 D1 4 D9 4 length (s == t) is false (s.equals(t)) is true s and t are different strings that share the same value "ACAA"

8 Two-Dimensional Arrays Two-Dimensional Arrays in Java Array access: Use a[i][j] to access element in row i and column j. Zero-based indexing: Row and column indices start at 0. Examples of two-dimensional arrays: Table of data for each experiment and outcome. Table of grades for each student and assignment. Table of grayscale values for each pixel in a 2D image. Mathematical abstraction: matrix Java abstraction: 2D Array int M = 10; int N = 3; double[][] a = new double[m][n]; for (int i = 0; i < M; i++) { for (int j = 0; j < N; j++) { a[i][j] = 0.0; Initialize a 10-by-3 array of doubles a[ ][ ] a[5] a[0][0] a[0][1] a[0][2] a[1][0] a[1][1] a[1][2] a[2][0] a[2][1] a[2][2] a[3][0] a[3][1] a[3][2] a[4][0] a[4][1] a[4][2] a[5][0] a[5][1] a[5][2] a[6][0] a[6][1] a[6][2] a[7][0] a[7][1] a[7][2] a[8][0] a[8][1] a[8][2] a[9][0] a[9][1] a[9][2] A 10-by-3 array Setting 2D Array Values at Compile Time Initialize 2D array of doubles by listing values. Each element of the array p is itself an array of type double[]. Two-Dimensional Arrays in Java double[][] p = { {.02,.92,.02,.02,.02, {.02,.02,.32,.32,.32, {.02,.02,.02,.92,.02, {.92,.02,.02,.02,.02, {.47,.02,.47,.02,.02, ; MN Name Age MBox Gend s Peter 18 peter@math M s Michael 21 mike@geo M s Helen 20 helen@phys F s Mary 18 mary@inf F s John 21 john@inf M

9 Two Dimensional Arrays, 1 Two Dimensional Arrays, 2 Array of Arrays String[][] students = new String[5][]; students is an array of length 5 Each element of students is itself an array, of type String[]. Directly assign values to 5 new String[] arrays: Initialize some Elements String[] michael = { "s ", "Michael", "21", "mike@geo", "M" ; String[] peter = { "s ", "Peter", "18", "peter@math", "M" ; String[] helen = { "s ", "Helen", "20", "helen@phys", "F" ; String[] mary = { "s ", "Mary", "18", "mary@inf", "F" ; String[] john = { "s ", "John", "21", "john@inf", "M" ; Two Dimensional Arrays, 3 Two Dimensional Arrays, 4 Now make these be the rows in students: Assigning values to the rows students[0] = peter; students[1] = michael; students[2] = helen; students[3] = mary; students[4] = john; students[i][j] selects the i th row and the j th column of the table. Schematically: Indexing into the 2D array [0][0], [0][1], [0][2], [0][3], [0][4] [1][0], [1][1], [1][2], [1][3], [1][4] [2][0], [2][1], [2][2], [2][3], [2][4] [3][0], [3][1], [3][2], [3][3], [3][4] [4][0], [4][1], [4][2], [4][3], [4][4] Michael s Mbox? (students[1][3]) Mary s Name? (students[3][3])

10 Summary Sedgewick & Wayne: Reading An object is an instance of a class, which is a kind of data type often represents a real-world thing has state, behaviour and identity. A variable can have a primitive type e.g., boolean, int, double; or a reference type: any class, e.g. String, Picture, Color, any array type. Data Types Read Section 3.1 (pp )