3.1 Using Data Types. Data Type. Constructors and Methods. Objects. Data type. Set of values and operations on those values.

Size: px

Start display at page:

Download "3.1 Using Data Types. Data Type. Constructors and Methods. Objects. Data type. Set of values and operations on those values."

Veronica Greene
6 years ago
Views:

1 Data Types 3.1 Using Data Types Data type. Set of values and operations on those values. Primitive types. Ops directly translate to machine instructions. Data Type boolean int double Set of Values true, false to any of 2 64 possible reals Operations not, and, or, xor add, subtract, multiply add, subtract, multiply We want to write programs that process other types of data.! Colors, pictures, strings, input streams,! Complex numbers, vectors, matrices, polynomials,! Points, polygons, charges, particles, Introduction to Computer Science Robert Sedgewick and Kevin Wayne Copyright Objects Constructors and Methods Object. Holds a data type value; variable name refers to object. To construct a new object: Use keyword new and name of data type. Impact. Enables us to create our own data types; define operations on them; and integrate into our programs. To apply an operation: Use name of object, the dot operator, and the name of the method. Data Type Color Set of Values 24 bits Operations get red component, brighten Picture 2D array of colors get/set color of pixel (i, j) String sequence of characters length, substring, compare 3 4

2 Color Data Type Image Processing Color. A sensation in the eye from electromagnetic radiation. Set of values. [RGB representation] possible values, which quantify the amount of red, green, and blue, each on a scale of to. R G B Color Introduction to Computer Science Robert Sedgewick and Kevin Wayne Copyright Color Data Type Using Colors in Java Color. A sensation in the eye from electromagnetic radiation. One use of objects. Store aggregate data in one variable. Set of values. [RGB representation] possible values, which quantify the amount of red, green, and blue, each on a scale of to. API. [Applications Program Interface] to access Color library import java.awt.color; public class ColorTest { public static void main(string[] args) { Color magenta = new Color(,, ); Color sienna = new Color(16, 82, 45); StdDraw.setPenColor(magenta); StdDraw.filledCircle(.5,.5,.667); StdDraw.setPenColor(sienna); StdDraw.filledSquare(.5,.5,.25); StdDraw.setPenColor(magenta); StdDraw.filledCircle(.5,.5,.333); Reference: 7 8

3 Monochrome Luminance Color Compatibility Monochrome luminance. Effective brightness of a color. NTSC formula. Y =.299r +.587g +.114b. Q. Which font colors will be most readable with which background colors on computer monitors and cell phone screens? A. Rule of thumb: difference in luminance should be! 128. import java.awt.color; public class Luminance { public static double lum(color c) { int r = c.getred(); int g = c.getgreen(); int b = c.getblue(); return.299*r +.587*g +.114*b; public static boolean compatible(color a, Color b) { return Math.abs(lum(a) - lum(b)) >= 128.; 9 1 Grayscale OOP Context for Color Grayscale. When all three R, G, and B values are the same, resulting color is on grayscale from (black) to (white). Possible memory representation. Convert to grayscale. Use luminance to determine value. D D1 D2 D3 D4 D5 D6 15 D7 15 D8 15 public static Color togray(color c) { int l = (int) Math.round(lum(c)); Color gray = new Color(l, l, l); return gray; magenta A D memory address B D6 gray Bottom line. We are writing programs that manipulate color. Object reference is analogous to variable name.! We can manipulate the value that it holds.! We can pass it to (or return it from) a method

René Magritte. "This is not a pipe." References Picture Data Type Raster graphics. Basis for image processing. Set of values. 2D array of Color objects (pixels). (, ) i j API. Java.

13 15 Image Processing: Grayscale Filter Image Processing: Grayscale Filter Goal. Convert color image to grayscale according to luminance formula. Goal. Convert color image to grayscale according to luminance formula. import java.

4 René Magritte. "This is not a pipe." References Picture Data Type Raster graphics. Basis for image processing. Set of values. 2D array of Color objects (pixels). (, ) i j API. Java. This is not a color. Color sienna = new Color(16, 82, 45); Color c = sienna.darker(); OOP. Natural vehicle for studying abstract models of the real world Image Processing: Grayscale Filter Image Processing: Grayscale Filter Goal. Convert color image to grayscale according to luminance formula. Goal. Convert color image to grayscale according to luminance formula. import java.awt.color; public class Grayscale { public static void main(string[] args) { Picture pic = new Picture(args[]); for (int i = ; i < pic.width(); i++) { for (int j = ; j < pic.height(); j++) { Color color = pic.get(i, j); Color gray = Luminance.toGray(color); pic.set(i, j, gray); pic.show(); mandrill.jpg % java Grayscale mandrill.jpg 16 17

Image Processing: Scaling Filter Image Processing: Scaling Filter Goal. Shrink or enlarge an image to desired size. Goal. Shrink or enlarge an image to desired size. Downscaling.

Scale row index by w s / w t.! Scale column index by h s / h t.! Set color of pixel (i, j) in target image to color of pixel (i " w s / w t, j " h s / h t ) in source image. h s? h t w t w s 18 19 Image Processing: Scaling Filter Image Processing: Scale Filter import java.

parseInt(args[2]); Picture source = new Picture(filename); Picture target = new Picture(w, h); for (int ti = ; ti < w; ti++) { for (int tj = ; tj < h; tj++) { int si = ti * source.

5 Image Processing: Scaling Filter Image Processing: Scaling Filter Goal. Shrink or enlarge an image to desired size. Goal. Shrink or enlarge an image to desired size. Downscaling. To halve the size, delete half the rows and columns. Upscaling. To double the size, replace each pixel by 4 copies. Uniform strategy. To convert from w s -by-h s to w t -by-h t :! Scale row index by w s / w t.! Scale column index by h s / h t.! Set color of pixel (i, j) in target image to color of pixel (i " w s / w t, j " h s / h t ) in source image. h s? h t w t w s Image Processing: Scaling Filter Image Processing: Scale Filter import java.awt.color; public class Scale { public static void main(string args[]) { String filename = args[]; int w = Integer.parseInt(args[1]); int h = Integer.parseInt(args[2]); Picture source = new Picture(filename); Picture target = new Picture(w, h); for (int ti = ; ti < w; ti++) { for (int tj = ; tj < h; tj++) { int si = ti * source.width() / w; int sj = tj * source.height() / h; Color color = source.get(si, sj); target.set(ti, tj, color); source.show(); target.show(); Scale.java. Creates two Picture objects and windows. % java Scale 4 2 mandrill.jpg 2 21

More Image Processing Effects OOP Context for

Can't change a Color object's value once

set(, 3, color); RGB color separation D4 D8 DC

edge detection 22 23 String Data Type String

Basis for text processing. Set of values.

6 More Image Processing Effects OOP Context for Picture Immutability. Can't change a Color object's value once created. Mutability. Can change a Picture object's value. D Color color = pic.get(, ); pic.set(, 3, color); RGB color separation D4 D8 DC swirl filter wave filter glass filter Sobel edge detection String Data Type String Processing String data type. Basis for text processing. Set of values. Sequence of Unicode characters. API. [partial list] Introduction to Computer Science Robert Sedgewick and Kevin Wayne Copyright

7 Gene Finding Gene Finding: Algorithm Pre-genomics era. Sequence a human genome. Post-genomics era. Analyze the data and understand structure. Genomics. Represent genome as a string over { A, C, T, G alphabet. Gene. A substring of genome that represents a functional unit.! Preceded by ATG. [start codon]! Multiple of 3 nucleotides. [codons other than start/stop]! Succeeded by TAG, TAA, TAG, or TGA. [stop codons] Algorithm. Scan left-to-right through genome.! If start codon, then set beg to index i.! If stop codon and substring is a multiple of 3 output gene reset beg to A T A G A T G C A T A G C G C A T A G C T A G A T G T G C T A G C start stop Gene Finding: Implementation OOP Context for Strings public class GeneFind { public static void main(string[] args) { String start = args[]; String stop = args[1]; String genome = StdIn.readAll(); int beg = -1; for (int i = ; i < genome.length() - 2; i++) { String codon = genome.substring(i, i+3); if (codon.equals(start)) beg = i; if (codon.equals(stop) && beg!= -1) { String gene = genome.substring(beg+3, i); if (gene.length() % 3 == ) { System.out.println(gene); beg = -1; % more genometiny.txt ATAGATGCATAGCGCATAGCTAGATGTGCTAGC % java GeneFind ATG TAG < genometiny.txt CATAGCGCA TGC Possible memory representation of a string.! String genome = "aacaagtttacaagc"; D D1 a a D2 c D3 a D4 a D5 g D6 t D7 t D8 t! s = genome.substring(1, 4);! t = genome.substring(9, 12); Consequences. D9 a DA DB DC DD DE c a a g c s t B B1 B2 B3 D1 3 D9 3! Use s.equals(t) to compare character sequences.! Use s == t to compare object identity. genome A D memory address A1 15 length 28 29

8 OOP Summary Object. Holds a data type value; variable name refers to object. In Java, programs manipulate references to objects.! Exception: primitive types, e.g., boolean, int, double.! Reference types: String, Picture, Color, arrays, everything else.! OOP purist: language should not have separate primitive types. Bottom line. We wrote programs that manipulate colors, pictures, and strings. Next time. We'll write programs that manipulate our own abstractions. 3

3.1 Data Types. Abstract Data Types. Objects. Object. Holds a data type value; variable name refers to object.

3.1 Data Types. Abstract Data Types. Objects. Object. Holds a data type value; variable name refers to object. 3.1 Data Types any program you might want to write objects create your own data types functions and modules graphics, sound, and image I/O arrays conditionals and loops Math primitive data types text I/O