2013%&%BMMB%597D:%Analyzing%Next%Genera<on%Sequencing%Data% % %Week%2,%Lecture%3% István'Albert' ' Bioinforma<cs%Consul<ng%Center% % Penn%State%
|
|
- Barry McDowell
- 5 years ago
- Views:
Transcription
1 2013&BMMB597D:AnalyzingNextGenera<onSequencingData Week2,Lecture3 István'Albert' ' Bioinforma<csConsul<ngCenter PennState
2 SomeProgrammingRequired Exis<ngsoNwaretoolscanrarelydoallsteps SourcedataindifferentfilesmaybeformaTed differently Weneedtobridgethedifferenceswithsimple transforma<ons Someprogrammingabilityisnecessaryforevery project
3 Biostar:ques<onoftheday I'vebeendoingbioinforma<csforabout10yearsnow. Iusedtojokewithafriendofminethatmostofourworkwasconver<ngbetweenfile formats. Wedon'tjokeaboutthatanymore.
4 ProgrammingLanguages Twomajorgroups Compiledlanguages!theoutputis(usually) astandaloneprogramthatcanberun Interpretedlanguages!requiresthe presenceofanothersonwarethatinturnwill runthesonware
5 Compiledbioinforma<cscode Compiledbioinforma<cscodeiswriTen mostlyinincandc++ Butthecodeisusuallycomposedofboth 1. thestandardizedlanguage 2. opera<ngsystemspecificextensions ThislaTeristhereasonmostcodewillnotrun onsaythewindowsopera<ngsystem.
6 Languagesthatrequiresuppor<ng sonware Java,Perl,Python,Ruby Verycommonmisguidedques<on: Which'language'can'be'used'to'do'X?'
7 Turingcompleteness Alllanguagescaninprinciplebeusedtosolve anycomputableproblem. Thereisdifferencehoweverinthewayone solvestheproblem!usuallythereare varioustradeoffsbetweensimplicityofthe solu<onandthespeedofexecu<on.
8 Itisallaboutthelibraries! ModernsoNwaredevelopmentisallabout reusingexis<ngfunc<onality ProgrammingLanguagesareslowlyturning intoveryhighlevelprogramming Environments!Mathema<caorMatlab.
9 Getagoodtexteditor Desiredfeatures:syntax'highligh:ng,line numbering,abilitytoviewwhitespace KomodoEdit SublimeText TextMate etc.therearemanyotherop<ons programmers passionatelylovetheireditors
10 Possiblythefirstscrip<nglanguage:awk' appearedin1977,strongunix(1972)roots itistheprecursoroflanguagessuchasperl(1987) andpython(1989) Hasfallenintodisuseforawhile Largetextdatasetsleadtoaresurgenceofthe language
11 TheArtofUnixProgramming:TAOUP SeminalopensourcebookbyEricRaymond Notquiteright:The'more'things'change'the'more'they'stay'the'same.'
12 Thestructureofanawkprogram!!!!awk!!pattern!{!action!}!! lineoriented 1. trytomatchthepaterntotheline 2. Ifthereisamatchprocessthelineandproduceanew line defaultpatern=matcheverything
13 SimpleAwkExample nopaternspecified
14 Advice writepipelineswithclearinputsandoutput Keeptheflowofinforma<onfromleNtoright Itisaloteasiertomodify/alterlateron
15 Specialvariables Awkautoma:cally'splitstheinputby whitespace(spacesandtabs)andassigns namestothem: $0theen<reline $1firstfield $2secondfield NFthenumberoffields NRthenumberofthecurrentline
16 Thewhitespacecurse:spacesandtabs Manytoolswillautosplitbywhitespace!thiswas thoughttobeconvenientbutisalsothesourceof extremelysubtleerrors!leadstoacolumnshinina tabfileifafieldcontainsspaces Always'specify'the'character'to'be'split'by!' Thisreferstoprogramminglanguagesaswell! Donotusethesplit()methodswiththeirdefault behavior(python,perletc)unlessyouperfectly understandwhattheydo)
17 Customizeawktousetabsasboththe inputandoutputfieldseparator alias!awk="awk!4f!'\t'!4v!ofs='\t'"! Tip:youcanaddthistothe.profile'or'.bash_profile'fileinyourrootfoldersothat itisac<vateallthe<me Note:filenamesthatstartwithadot.areonlylistedifyoudoals'Oa'
18 RecalltheGFFformatfromlecture3 SearchforGFF3!hTp:// Tabseparatedwith9columns.MissingaTributesmaybereplacedwithadot!. 1. Seqid'(usuallychromosome) 2. Source(whereisthedatacomingfrom) 3. Type(usuallyatermfromthesequenceontology) 4. Start''(intervalstartrela<vetotheseqid) 5. End''''(intervalendrela<vetotheseqid) 6. Score'''(thescoreofthefeature,afloa<ngpointnumber) 7. Strand''(+/&/.) 8. Phase'''''''(usedtoindicatereadingframeforcodingsequences) 9. AZributes(semicolonseparatedaTributes!Name=ABC;ID=1) ExampleaTributespecifica<on:name=REB1;id=YP33546
19 Makeasimplerfile:extractthename from9 th column&>theatribute matching ac<on SemicolonseparatedaTributesoneofthemisName=YAL069W;' 1. Splitbysemicolonandkeepthesecondelement,thensplitthisagainbythe= signandkeepthesecondelement
20 Youmayalso puttheprogramintoafile
21 Writeasingestepata<me andtestitevery<me
22
23 Createagfffilethatcontainsthegene nameinthetypecolumn
24 Makethatnewsimplergff:short.gff containsonlygenesandhasnameinthesecondcolumn
25 Intervallengthsforgenes
26 Operators +'O'*'/'fornumericalcontext modulodivision(remainderofdivision) <space>''stringconcatena<on ==,'!='''equal,notequal ~,'!~''''''match,nomatch(regularexpressions)
27 SpecialpaTerns BEGIN!beforethestreamstarts END!aNerthestreamends
28 MulitplepaTerns!awkwilltrythem eachinturn
29 Advancedawk usuallynotneeded condi<onals:if' loops:for,while' break,con:nue' associa:ve'data'structures'(hash,'dic:onary)' Youcandoallthatthoughatthatpoint itisprobablybetertolearnpython Butyoucan'do'a'lot'with'just'basic'awk! Awk s'power'comes'from'its'simplicity' 'one'liners!'
30 Afewawkresources Largenumberofresources,thequirkyname makesitverysearchable!how'to'do'x'with' awk? Howtouseawk seecoursewebpagefor links
31 Homework3 1. Writetheawkcodethatfindsthelengthof thegenome(sumofallchromosomelenghts) fromthefeatures.gfffile. 2. Writethecombinda<onofawkandshell codethatfindsthelongestandshortestgene inthefeatures.gfffile
István'Albert' ' Biochemistry$and$Molecular$Biology$$ and$bioinforma;cs$consul;ng$center$ $ Penn$State$
2012%BMMB597D:AnalyzingNextGenera;onSequencingData Week1,Lecture3 István'Albert' ' BiochemistryandMolecularBiology andbioinforma;csconsul;ngcenter PennState SomeProgrammingRequired Exis;ngsoOwaretoolscanrarelydoallsteps
More informationNGS%sequencing%read%formats% Random#DNA#fragment#% sequencing%with%illumina# Extending%the%FASTA%format% 9/11/14%
9/11/14 NGSsequencingreadformats BMMB#852:AppliedBioinforma4cs Week3,Lecture6 István#Albert# # Bioinforma4csConsul4ngCenter PennState,2014 Reads:shortsequencesproducedbythe instrument Illumina!FastQformat(.fastqor.fq)
More informationWeek 9, Lecture 17. Some Programming Required. Programming Languages. Turing Completeness 10/20/15
Some Programming Required BMMB 852: Applied Bioinforma5cs Week 9, Lecture 17 István Albert Bioinforma5cs Consul5ng Center Penn State, 2015 Exis5ng sohware tools can rarely do all steps Source data in different
More informationPrinciples of So3ware Construc9on. A formal design process, part 2
Principles of So3ware Construc9on Design (sub- )systems A formal design process, part 2 Josh Bloch Charlie Garrod School of Computer Science 1 Administrivia Midterm exam Thursday Review session Wednesday,
More informationLast &me: Javascript (forms and func&ons)
Let s debug some code together: hkp://www.clsp.jhu.edu/~anni/cs103/test_before.html hkp://www.clsp.jhu.edu/~anni/cs103/test_arer.html
More informationJanuary 3, 2017 Do Now Today I can map similar figures onto one another HW: p , CR 6 due Friday
January 3, 2017 Do Now Today I can map similar figures onto one another HW: p 110 1 4, 17 20 CR 6 due Friday Reminders: Quiz Tues Jan 10 Benchmark Exam Jan 19 & 20 Chapter test Feb 2 Do Now Graph Rectangle
More informationGenome Sciences 373 Genome Informa1cs. Quiz Sec1on #1 March 31, 2015
Genome Sciences 373 Genome Informa1cs Quiz Sec1on #1 March 31, 2015 About me, course logistics, etc. Matthew s contact info Email: mwsnyder@uw.edu Phone: 206-685-3720 Office hours: Mondays 2:00-3:00pm
More informationA formal design process, part 2
Principles of So3ware Construc9on: Objects, Design, and Concurrency Designing (sub-) systems A formal design process, part 2 Josh Bloch Charlie Garrod School of Computer Science 1 Administrivia Midterm
More informationDeclara've Parallel Analysis in ROOT: TDataFrame
Declara've Parallel Analysis in ROOT: TDataFrame D. Piparo For the ROOT Team CERN EP-SFT Introduction Novel way to interact with ROOT columnar format Inspired by tools such as Pandas or Spark Analysis
More informationTangent line problems
You will find lots of practice problems and homework problems that simply ask you to differentiate. The following examples are to illustrate some of the types of tangent line problems that you may come
More informationPowerware Plus 18. Operator's Manual
Powerware Plus 18 Operator's Manual 1 Introduction Powerware Plus 18 Special Features Powerware Plus 18 Two year Best Power limited System Overview Powerware Plus 18 LTM-1336B System Requirements 3 COMPUTERS
More informationLecture 2 Making Simple Commits
Lecture 2 Making Simple Commits Sign in on the attendance sheet! credit: https://xkcd.com/1296/ Course Website https://www.andrew.cmu.edu/course/98-174/ Homework Reminders Great job gitting the homework
More informationqwertyuiopasdfghjklzxcvbnmqwertyui opasdfghjklzxcvbnmqwertyuiopasdfgh jklzxcvbnmqwertyuiopasdfghjklzxcvb nmqwertyuiopasdfghjklzxcvbnmqwer
qwertyuiopasdfghjklzxcvbnmqwertyui opasdfghjklzxcvbnmqwertyuiopasdfgh jklzxcvbnmqwertyuiopasdfghjklzxcvb nmqwertyuiopasdfghjklzxcvbnmqwer ABAP Interview Questions & Answers Set 4 tyuiopasdfghjklzxcvbnmqwertyuiopas
More informationObjec&ve % U&lize appropriate tools and methods to produce digital graphics.
Objec&ve 102.04 20% U&lize appropriate tools and methods to produce digital graphics. Fill and Stroke q Stroke is the outline of a shape, text or image. Weight Color Style q Fill is the inside color of
More informationData Engineering. How MapReduce Works. Shivnath Babu
Data Engineering How MapReduce Works Shivnath Babu Lifecycle of a MapReduce Job Map function Reduce function Run this program as a MapReduce job Lifecycle of a MapReduce Job Map function Reduce function
More informationPractical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential
More informationCS-152: Computer Programming Fundamentals in Java
CS-152: Computer Programming Fundamentals in Java Neal Holtschulte June 3, 2013 What did you sign up for? Fundamentals of computer programming Control flow Variables and arithmetic Objects etc Java syntax
More informationXSEDE Scholars Program Introduction to C Programming. John Lockman III June 7 th, 2012
XSEDE Scholars Program Introduction to C Programming John Lockman III June 7 th, 2012 Homework 1 Problem 1 Find the error in the following code #include int main(){ } printf(find the error!\n");
More informationObjec&ve % U&lize appropriate tools and methods to produce digital graphics.
Objec&ve 102.04 20% U&lize appropriate tools and methods to produce digital graphics. Free Transform q Change by using rotate, scale, skew, distort, or perspec&ve in one con&nuous opera&on. Instead of
More informationCSE 374 Programming Concepts & Tools. Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup
CSE 374 Programming Concepts & Tools Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup Where we are Learned how to use the shell to run, combine, and write programs
More informationQuality Control of Sequencing Data
Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY ss2489@cornell.edu // Twitter:@SahaSurya BTI Plant Bioinformatics Course 2017 3/27/2017 BTI
More informationPrinciples in Programming: Orientation & Lecture 1. SWE2004: Principles in Programming Spring 2014 Euiseong Seo
Principles in Programming: Orientation & Lecture 1 1 Course Objectives Introduce various subjects in computer science through puzzles and problems Most problems came from ICPC 2 Textbook Programming Challenges
More informationFile I/O in Python CS 8: Introduction to Computer Science Lecture #11
File I/O in Python CS 8: Introduction to Computer Science Lecture #11 Ziad Matni Dept. of Computer Science, UCSB Administrative Midterm #2 is next week on Thursday 5/18! Tutoring/Review Session Available!
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationMobile Web Appplications Development with HTML5
Mobile Web Appplications Development with HTML5 Lab 1: The Challenge Claudio Riva Aalto University - Fall 2012 1 / 36 THE CHALLENGE OVERVIEW OF THE ASSIGNMENT WAY OF WORKING TEAMS DEVEVELOPMENT ENVIRONMENT
More informationAsync SOQL Guide. Salesforce, Spring
Async SOQL Guide Salesforce, Spring 18 @salesforcedocs Last updated: March 20, 2018 Copyright 2000 2018 salesforce.com, inc. All rights reserved. Salesforce is a registered trademark of salesforce.com,
More informationUSING ECONOMETRICS A PRACTICAL GUIDE 6TH EDITION PDF
USING ECONOMETRICS A PRACTICAL GUIDE 6TH EDITION PDF ==> Download: USING ECONOMETRICS A PRACTICAL GUIDE 6TH EDITION PDF USING ECONOMETRICS A PRACTICAL GUIDE 6TH EDITION PDF - Are you searching for Using
More informationManual Sublime Text 2 Windows 7 64
Manual Sublime Text 2 Windows 7 64 I'm taking a very beginning HTML course and my instructor wanted us to use SublimeText so I went to the website and downloaded sublime text 2 but now that I. Laravel
More informationLeveraging SDN Layering to Systema2cally Troubleshoot Networks
Leveraging SDN Layering to Systema2cally Troubleshoot Networks Brandon Heller Colin Sco/ Nick McKeown Sco= Shenker Andreas Wundsam Hongyi Zeng Sam Whitlock Vimalkumar Jeyakumar Nikhil Handigol James McCauley
More informationFronter User Level 2
London MLE Fronter Waltham Forest How to customise your today page It is easy to customise your today page so that it shows exactly what you want to see when you login. The instructions below will help
More informationWashington State University School of EECS Computer Science Course Assessment Report
Washington State University School of EECS Computer Science Course Assessment Report Course Number CptS 224 Course Title Programming Tools Semesters Offered Summer Spring Instructor Andrew O'Fallon 10
More informationChapter 8. Arrays and Collections. McGraw-Hill. Copyright 2011 by The McGraw-Hill Companies, Inc. All Rights Reserved.
Chapter 8 Arrays and Collections McGraw-Hill Copyright 2011 by The McGraw-Hill Companies, Inc. All Rights Reserved. Objectives Establish an array and refer to individual elements in the array with subscripts.
More informationFläktGroup Revit Plugin User guide
FläktGroup Revit Plugin User guide 2 (13) CONTENTS ABOUT THIS DOCUMENT... 3 INSTALLING THE SOFTWARE... 3 REQUIRED MAGICAD VERSION... 3 INSTALLATION... 3 STARTING THE PROGRAM... 3 INSERTING FLÄKTGROUP PRODUCTS
More informationUni$ng Church & State OO vs FP
Uni$ng Church & State OO vs FP Noel Welsh @noelwelsh underscore Alonzo Church Invented the Lambda Calculus Alan Kay Invented Smalltalk + OO + FP =? The Church Encoding Claims #1 FP and OO make different
More informationComputer Science Design I Version Control with Git
Computer Science Design I Version Control with Git Department of Electrical Engineering & Computer Science Information Technology & Telecommunications Research Center The University of Kansas annguyen@ittc.ku.edu
More informationWeb App Testing: RECON. MAPPING. ANALYSIS.
www.pandoralabs.net Expert Advice. Experience Advantage. Proactive Security Solutions Through Cutting-Edge Research. Web App Testing: RECON. MAPPING. ANALYSIS. By @isaacsabas We are a Security-as-a-Service
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationCS 217 Algorithms and Complexity Homework Assignment 2
CS 217 Algorithms and Complexity Homework Assignment 2 Shanghai Jiaotong University, Fall 2015 Handed out on 2015-10-19 Due on 2015-10-26 You can hand in your solution either as a printed file or hand-written
More informationNHS Scotland: Staff Engagement Portal (SEP) Board Chair Manual May 2015
NHS Scotland: Staff Engagement Portal (SEP) Board Chair Manual May 2015 1 Creating your Board Chair account 1. You will receive an email with a personal link similar to: http://nhsscotland- sep.webropol.com/en/account/setpassword?userid=eac285c8-3acf-4bbd-
More informationAccelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes. In 1.1, we discussed using t-charts to help graph functions. e.g.
Accelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes In 1.1, we discussed using t-charts to help graph functions. e.g., Graph: y = x 3 What are some other strategies that can make graphing
More informationGit: (Distributed) Version Control
Git: (Distributed) Version Control Computer Science and Engineering College of Engineering The Ohio State University Lecture 2 The Need for Version Control Track evolution of a software artifact Development
More informationCourse Outline. TERM EFFECTIVE: Fall 2016 CURRICULUM APPROVAL DATE: 11/23/2015
5055 Santa Teresa Blvd Gilroy, CA 95023 Course Outline COURSE: CSIS 49 DIVISION: 50 ALSO LISTED AS: TERM EFFECTIVE: Fall 2016 CURRICULUM APPROVAL DATE: 11/23/2015 SHORT TITLE: UNIX SHELL PROGRAM LONG TITLE:
More informationTutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low
More informationStudent Outcomes. Classwork. Opening Exercise (3 minutes) Example 1 (8 minutes)
Student Outcomes Students model and write equivalent expressions using the distributive property. They move from a factored form to an expanded form of an expression. Classwork Opening Exercise (3 minutes)
More informationAwk & Regular Expressions
Awk & Regular Expressions CSCI-620 Dr. Bill Mihajlovic awk Text Editor awk, named after its developers Aho, Weinberger, and Kernighan. awk is UNIX utility. The awk command uses awk program to scan text
More informationAssembly of glass fiber optic cables
Light Equipment, Business Services, & Other INVESTMENT OPPORTUNITY: Assembly of glass fiber optic cables Executive summary There is an opportunity to establish or expand a local facility for the assembly
More informationManual Sublime Text 2 Plugin Php Syntax Highlighting
Manual Sublime Text 2 Plugin Php Syntax Highlighting SublimeAutoHotkey - Syntax Package for Sublime Text 2/3. AutoHotkey AHK language package for SublimeText including syntax highlighting, comments toggling,
More informationLogic Programming for Data Tagging
Logic Programming for Data Tagging Stephen Chong Privacy Tools Project NSF Site Visit Monday October 19 with Alexandra Wood Berkman Micah Altman MIT Kevin Wang Harvard Undergrad Aaron Bembenek Harvard
More informationSection 2-2. Histograms, frequency polygons and ogives. Friday, January 25, 13
Section 2-2 Histograms, frequency polygons and ogives 1 Histograms 2 Histograms The histogram is a graph that displays the data by using contiguous vertical bars of various heights to represent the frequencies
More informationProcess dependability. Barbara Pernici Politecnico di Milano
1 Process dependability Barbara Pernici Politecnico di Milano Process dependability Design of Coopera6ve IS STAKEHOLDERS FAILURES Adap6ve systems Process dependability BPM SERVICE COMPOSITION Diagnosis
More informationIntroduc+on. General Information. General Information. General Information. General Information. General Information
Introduc+on IT244 - Introduc+on to Linux / Unix Instructor: Bo Sheng Location and Time S-3-143, Mon & Wed, 4:00 ~ 5:15pm Door code: 261359* Office Hours Science Center, S-3-167, Mon & Wed, 2 ~ 4pm TA office
More informationDealing with Data Especially Big Data
Dealing with Data Especially Big Data INFO-GB-2346.01 Fall 2017 Professor Norman White nwhite@stern.nyu.edu normwhite@twitter Teaching Assistant: Frenil Sanghavi fps241@stern.nyu.edu Administrative Assistant:
More informationCSE 391 Lecture 9. Version control with Git
CSE 391 Lecture 9 Version control with Git slides created by Ruth Anderson & Marty Stepp, images from http://git-scm.com/book/en/ http://www.cs.washington.edu/391/ 1 Problems Working Alone Ever done one
More informationS56 (5.1) Graphs of Functions.notebook September 22, 2016
Daily Practice 8.9.2016 Q1. Write in completed square form y = 3x 2-18x + 4 Q2. State the equation of the line that passes through (2, 3) and is parallel to the x - axis Q1. If f(x) = 3x + k and g(x) =
More informationSubtraction Understand Subtraction on a Number Line Using a number line let s demonstrate the subtraction process using the problem 7 5.
Objective 1 Subtraction Understand Subtraction on a Number Line Using a number line let s demonstrate the subtraction process using the problem 7 5. -7-6 -5-4 -3-2 -1 0 1 2 3 4 5 6 7 Using the number line
More informationLinux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015
Linux command line basics III: piping commands for text processing Yanbin Yin Fall 2015 1 h.p://korflab.ucdavis.edu/unix_and_perl/unix_and_perl_v3.1.1.pdf 2 The beauty of Unix for bioinformagcs sort, cut,
More information-10 to 10V to User range setting. 4 to 20mA 0 to to 20mA 500.0nA
Analog I/O Analog Input Modules R60AD4 R60ADV8 Number of Analog Input Points 4 points (4 channels) 8 points (8 channels) Analog Input 10 to 10 VDC (input resistance 1MΩ) Analog Input DC (input resistance
More informationAnnouncements. Working in pairs is only allowed for programming assignments and not for homework problems. H3 has been posted
Announcements Working in pairs is only allowed for programming assignments and not for homework problems H3 has been posted 1 Syntax Directed Transla@on 2 CFGs so Far CFGs for Language Defini&on The CFGs
More informationClinical Research Professionals Educa3on Session Barb Greguson Alliance Sta3s3cal and Data Center
Clinical Research Professionals Educa3on Session Barb Greguson Alliance Sta3s3cal and Data Center greguson.barbara@mayo.edu Alliance for Clinical Trials in Oncology Spring 2015 Group Mee3ng Presenta3on
More informationFläkt Woods Revit Plugin User guide
Fläkt Woods Revit Plugin User guide 2 (9) CONTENTS ABOUT THIS DOCUMENT... 3 INSTALLING THE SOFTWARE... 3 REQUIRED MAGICAD VERSION... 3 INSTALLATION... 3 STARTING THE PROGRAM... 3 INSERTING FLÄKT WOODS
More information1.264 Lecture 3. Time and resource estimation
1.264 Lecture 3 Time and resource estimation Next class: Read chapters 7, 8. Hand in exercise solution after class Form groups for homework. Hand in today s exercises on paper. 1 Choose system implementation
More informationVersion control with Git.
1 Version control with Git http://git-scm.com/book/en/ Basic Intro to Git We will: Discuss how Git differs from Subversion Discuss the basic Git model Pull/clone files from a repository on github Edit
More informationFND Math Orientation MATH TEAM
FND Math Orientation MATH TEAM Key Goals of Foundation Math Build strong Foundation in Mathematics Improve motivation to learn Inculcate good study habits Enhance independent & mobile learning skills Improve
More informationCSS 161 Fundamentals of Compu3ng. Introduc3on to Computers & Java September 26, Instructor: Uma Murthy CSS SKL 161 A Instructor: Joe McCarthy
CSS 161 Fundamentals of Compu3ng Introduc3on to Computers & Java September 26, 2012 Instructor: Uma Murthy CSS SKL 161 A Instructor: Joe McCarthy Outline Update / reminder Introduc3on to Computers Introduc3on
More informationFile I/O in Python Formats for Outputs CS 8: Introduction to Computer Science, Winter 2018 Lecture #12
File I/O in Python Formats for Outputs CS 8: Introduction to Computer Science, Winter 2018 Lecture #12 Ziad Matni Dept. of Computer Science, UCSB Administrative Homework #7 is DUE on MONDAY (3/12) Lab
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step
More informationAutumn Apps. Breeze Documentation.
Autumn Apps Breeze Documentation http://www.autumnapps.com/breeze/ 1 What Is Breeze?! 3 Applying Window States! 4 Keyboard Shortcuts! 4 Saving A Global Window State! 5 Saving An Application Window State!
More informationFläkt Woods Revit Plugin - Installation Instructions and User Guide. User s Guide
Fläkt Woods Revit Plugin - Installation Instructions and User Guide User s Guide Contents About this document... 2 Installing the software... 3 Required MagiCAD version... 3 Installation... 3 Starting
More informationInformation Security Training for XSEDE Researchers
September 6, 2017 Information Security Training for XSEDE Researchers Developed by XSEDE Security Operations James A. Marsteller PSC Training Overview Security Awareness You Are The Target Social Engineering
More informationARIS Pilot project REMIT data collection
ARIS Pilot project REMIT data collection Update, including invitation for the 2 nd phase the ARIS operational prototype Erik Rakhou Market Monitoring Department, ACER Public Workshop on REMIT implementation
More informationIntro to Contemporary Math
Intro to Contemporary Math Conditional Probability Intro Department of Mathematics UK Announcement You have a homework assignment due next Monday. Sequences of Experiments Suppose two experiments are performed,
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step
More informationOverview. Dataset: testpos DNA: CCCATGGTCGGGGGGGGGGAGTCCATAACCC Num exons: 2 strand: + RNA (from file): AUGGUCAGUCCAUAA peptide (from file): MVSP*
Overview In this homework, we will write a program that will print the peptide (a string of amino acids) from four pieces of information: A DNA sequence (a string). The strand the gene appears on (a string).
More informationPrinciples in Programming: Orientation & Lecture 1. SWE2004: Principles in Programming Spring 2015 Euiseong Seo
Principles in Programming: Orientation & Lecture 1 1 Course Objectives Introduce various subjects in computer science through puzzles and problems Most problems came from ICPC 2 Introduction Instructor:
More informationNote: This is a miniassignment and the grading is automated. If you do not submit it correctly, you will receive at most half credit.
Com S 227 Fall 2017 Miniassignment 1 50 points Due Date: Monday, October 16, 11:59 pm (midnight) Late deadline (25% penalty): Tuesday, October 17, 11:59 pm General information This assignment is to be
More informationQUIZ: Generations of computer technology. Hardware:
QUIZ: Generations of computer technology Hardware: 1. 2. 3. 4. 5. 1 QUIZ: Generations of computer technology Software: 1. 2. 3. 4. 5. 6. 2 Steampunk! 3 The Telectroscope, 1878-2008 Steampunk Wikipedia
More informationLesson 13: Exploring Factored Form
Opening Activity Below is a graph of the equation y = 6(x 3)(x + 2). It is also the graph of: y = 3(2x 6)(x + 2) y = 2(3x 9)(x + 2) y = 2(x 3)(3x + 6) y = 3(x 3)(2x + 4) y = (3x 9)(2x + 4) y = (2x 6)(3x
More informationMoodle 2.2 Student User Guide My Private Files
Moodle 2.2 Student User Guide My Private Files Using My Private Files My Private Files saves files in the cloud. Only the user may access it, but you can access it from any computer where you can access
More informationGit: (Distributed) Version Control
Git: (Distributed) Version Control Computer Science and Engineering College of Engineering The Ohio State University Lecture 6 The Need for Version Control Track evolution of a software artifact Development
More informationCalculator Tables and Graphs
" Calculator Tables and Graphs In the last investigation, you wrote equations to describe patterns and to show how variables are related. Such equations are used in mathematics, science, economics, and
More informationThe preseq Manual. Timothy Daley Victoria Helus Andrew Smith. January 17, 2014
The preseq Manual Timothy Daley Victoria Helus Andrew Smith January 17, 2014 Contents 1 Quick Start 2 2 Installation 3 3 Using preseq 4 4 File Format 5 5 Detailed usage 6 6 lc extrap Examples 8 7 preseq
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationPlainfield Public School District Mathematics/3 rd Grade Curriculum Guide
NJCCCS: STANDARD 4.2 (GEOMETRY AND MEASUREMENT) ALL STUDENTS WILL DEVELOP SPATIAL SENSE AND THE ABILITY TO USE GEOMETRIC PROPERTIES, RELATIONSHIPS, AND MEASUREMENT TO MODEL, DESCRIBE AND ANALYZE PHENOMENA.
More informationProperties of Quadratic functions
Name Today s Learning Goals: #1 How do we determine the axis of symmetry and vertex of a quadratic function? Properties of Quadratic functions Date 5-1 Properties of a Quadratic Function A quadratic equation
More informationSimplifying Square Root Expressions[In Class Version][Algebra 1 Honors].notebook August 26, Homework Assignment. Example 5 Example 6.
Homework Assignment The following examples have to be copied for next class Example 1 Example 2 Example 3 Example 4 Example 5 Example 6 Example 7 Example 8 Example 9 Example 10 Example 11 Example 12 The
More informationLecture 29 11/4/15. CMPSC431W: Database Management Systems. Instructor: Yu- San Lin
CMPSC431W: Database Management Systems Lecture 29 11/4/15 Instructor: Yu- San Lin yusan@psu.edu Course Website: hcp://www.cse.psu.edu/~yul189/cmpsc431w Slides based on McGraw- Hill & Dr. Wang- Chien Lee
More informationThe Universal Object Browser User Guide
The Universal Object Browser User Guide The Universal Object Browser is a product jointly developed by Nirvana Bound PTY LTD and View to Learn. Nirvana Bound Pty Ltd 7 Mill Hill Port Macquarie NSW 2444
More informationYacc Yet Another Compiler Compiler
LEX and YACC work as a team Yacc Yet Another Compiler Compiler How to work? Some material adapted from slides by Andy D. Pimentel LEX and YACC work as a team Availability call yylex() NUM + NUM next token
More informationChapter 2. Binary Values and Number Systems
Chapter 2 Binary Values and Number Systems Numbers Natural numbers, a.k.a. positive integers Zero and any number obtained by repeatedly adding one to it. Examples: 100, 0, 45645, 32 Negative numbers A
More informationMultithreaded Algorithms Part 2. Dept. of Computer Science & Eng University of Moratuwa
CS4460 Advanced d Algorithms Batch 08, L4S2 Lecture 12 Multithreaded Algorithms Part 2 N. H. N. D. de Silva Dept. of Computer Science & Eng University of Moratuwa Outline: Multithreaded Algorithms Part
More informationAssignment 3: Distance COP3330 Fall 2017
Assignment 3: Distance COP3330 Fall 2017 Due: Monday, October 16, 2017 at 11:59 PM Objective This assignment will provide experience with basic operator overloading. Task Your task will be to create a
More informationPHDD An RDF Vocabulary for the Physical Data Descrip:on Work in Progress
PHDD An RDF Vocabulary for the Physical Data Descrip:on Work in Progress Joachim Wackerow and Thomas Bosch (both GESIS Leibniz Ins:tute for the Social Sciences) What is it? Descrip:on of the physical proper:es
More informationQUIZ: Generations of computer technology. Hardware:
QUIZ: Generations of computer technology Hardware: 1. 2. 3. 4. 5. 1 QUIZ: Generations of computer technology Software: 1. 2. 3. 4. 5. 6. 2 Chapter 2 Binary Values and Number Systems Numbers Natural numbers,
More informationComputer Programming: C++
The Islamic University of Gaza Engineering Faculty Department of Computer Engineering Fall 2017 ECOM 2003 Muath i.alnabris Computer Programming: C++ Experiment #3 Loops Part I Contents Introduction For-Loop
More informationA/V System User Guide
1 A/V System User Guide This conference room is equipped a data projector, with a stationary furniture layout (fixed table). Table of Contents Technical Assistance Information.2 Presentation Setup.3 Internet
More informationVersion Control System - Git. zswu
Version Control System - Git zswu Overview Why VCS? Why Git? Using Git Personally Using Git with Others Etiquette Rules of Using Git Tools & Services Tips 2 Why VCS (1/3) How do you manage your homework?
More informationSoftware Design The Journey of an Idea to Invention
Software Design The Journey of an Idea to Invention (Week One) The George Washington University Department of Computer Science CSCI 4243: Senior Design Learn By Doing Develop a system through which consumers
More informationehealth in the implementa,on of the cross border direc,ve: role of the ehealth Network 26th February 2012
ehealth in the implementa,on of the cross border direc,ve: role of the ehealth Network 26th February 2012 Agenda EU in health Ehealth in the EU ehealth Network ehealth High- Level Governance Ini,a,ve Goals
More informationCSC201, SECTION 002, Fall 2000: Homework Assignment #2
1 of 7 11/8/2003 7:34 PM CSC201, SECTION 002, Fall 2000: Homework Assignment #2 DUE DATE Monday, October 2, at the start of class. INSTRUCTIONS FOR PREPARATION Neat, in order, answers easy to find. Staple
More informationTransitioning Teacher Websites
Transitioning Teacher Websites Google sites is an online web building tool that can be accessed and updated from anywhere there is an internet connection. Here is a brief video introduction of Google sites.
More information