Quality Control of Sequencing Data
|
|
- Phillip Horton
- 6 years ago
- Views:
Transcription
1 Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY // BTI Plant Bioinformatics Course /27/2017 BTI Plant Bioinformatics Course
2 3/27/2017 BTI Plant Bioinformatics Course Quality Control of NGS Data 1. Exploration 2. Evaluation 3. Preprocessing
3 3/27/2017 BTI Plant Bioinformatics Course Exploration Goal: Use shell commands and installed tools to explore using the file from TAIR Data: /home/bioinfo/data/tair10_pep.fasta.gz Tools: (fasta toolkit)
4 3/27/2017 BTI Plant Bioinformatics Course Exploration Exercise 1: 1. Type fasta and TAB key to find all the commands starting with fasta 2. Uncompress and find the length of sequences in the file: TAIR10_pep.fasta.gz Tip: Use gzip and fastalength 3. Split the above file into 3 fasta files Tip: Use fastasplit
5 Evaluation Goal: Learn the use of read evaluation programs keeping attention in relevant parameters such as quality score and length distributions and unusual reads duplications. Data: data for two tomato ripening stages /home/bioinfo/data/slch04_demo.tar.gz Tools: tar -zxvf OR xvf (command line, untar and unzip the files) head (command line, take a quick look of the files) mv (command line, change the name of the files) grep (command line, find/count patterns in files) FASTX toolkit (command line, process fasta/fastq) FastQC (gui, to calculate several stats for each file) 3/27/2017 BTI Plant Bioinformatics Course
6 3/27/2017 BTI Plant Bioinformatics Course Evaluation Exercise 2: 1. Uncompress the file: /home/bioinfo/data/slch04_demo.tar.gz 2. Raw data will be found in 4 files. Print the first 10 lines for the files: SRR404331_ch4.fq, SRR404333_ch4.fq, SRR404334_ch4.fq and SRR404336_ch4.fq. Question 2.1: Do these files have fastq format?
7 Evaluation Exercise 2: 3. Count number of sequences in each fastq file using commands you learnt last time. 4. Convert the fastq files to fasta. Tip: Use grep Tip: Use fastq_to_fasta -h to see help Use Google if you are stuck 5. Explore other tools in the FASTX toolkit Now count the number of sequences in fasta file and see if the number of sequences has changed. 3/27/2017 BTI Plant Bioinformatics Course
8 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Quality
9 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Quality Poor
10 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Sequence Quality Pacific Biosciences
11 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Content
12 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Content Poor
13 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Duplication Good
14 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Duplication Poor
15 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Overrepresented Sequences Good
16 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Overrepresented Sequences Good Poor
17 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Kmer content Good
18 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Kmer content Poor
19 3/27/2017 BTI Plant Bioinformatics Course Evaluation Exercise 3: 1.Type fastqc to start the FastQC program. Load the four fastq sequence files in the program. Question 3.2: How many sequences there are per file in FastQC? Question 3.3: Which is the length range for these reads? Question 3.4: Which is the quality score range for these reads? Which one looks best quality-wise? Question 3.5: Do these s have read overrepresentation? Question 3.6: Looking into the kmer content, do you think that the samples have an adaptor?
20 3/27/2017 BTI Plant Bioinformatics Course Preprocessing Goal: Trim the low quality ends of the reads and remove the short reads. Data: data for two tomato ripening stages /home/bioinfo/data/slch04_demo.tar.gz Tools: fastq-mcf (command line tool to process reads) FastQC (gui, to calculate several stats for each file)
21 Preprocessing Exercise 4: Download the file: adapters1.fa from ftp://ftp.solgenomics.net/user_requests/aubombarely/courses/rnaseqcorpoica/a dapters1.fa Run the read processing program over each of the s using Min. qscore of 30 Min. length of 40 bp Tip: Use fastq-mcf -h to see help Type fastqc to start the FastQC program. Load the four new fastq sequence files. Compare the results with the previous s. 3/27/2017 BTI Plant Bioinformatics Course
22 3/27/2017 BTI Plant Bioinformatics Course Bonus Material Here are some simple exercises using the file from TAIR /home/bioinfo/data/tair10_pep.fasta.gz Number of unknown proteins per chromosome Number of proteins that are not unknown proteins per chromosome and are on the forward strand Number of proteins which are located within the first 5MB of the chromosome (awk) All genes of length greater than 2000bp (awk) All proteins of length greater than 200aa (awk)
Quality assessment of NGS data
Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:
More informationNGS : reads quality control
NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationIntroduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
More informationSequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
More informationChIP-Seq data analysis workshop
ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationUnderstanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationTrimming and quality control ( )
Trimming and quality control (2015-06-03) Alexander Jueterbock, Martin Jakt PhD course: High throughput sequencing of non-model organisms Contents 1 Overview of sequence lengths 2 2 Quality control 3 3
More informationChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationLecture 8. Sequence alignments
Lecture 8 Sequence alignments DATA FORMATS bioawk bioawk is a program that extends awk s powerful processing of tabular data to processing tasks involving common bioinformatics formats like FASTA/FASTQ,
More informationNext Generation Sequencing quality trimming (NGSQTRIM)
Next Generation Sequencing quality trimming (NGSQTRIM) Danamma B.J 1, Naveen kumar 2, V.G Shanmuga priya 3 1 M.Tech, Bioinformatics, KLEMSSCET, Belagavi 2 Proprietor, GenEclat Technologies, Bengaluru 3
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationMetaStorm: User Manual
MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To
More informationThe Analysis of RAD-tag Data for Association Studies
EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationHMPL User Manual. Shuying Sun or Texas State University
HMPL User Manual Shuying Sun (ssun5211@yahoo.com or s_s355@txstate.edu), Texas State University Peng Li (pxl119@case.edu), Case Western Reserve University June 18, 2015 Contents 1. General Overview and
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationData Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationAllBio Tutorial. NGS data analysis for non-coding RNAs and small RNAs
AllBio Tutorial NGS data analysis for non-coding RNAs and small RNAs Aim of the Tutorial Non-coding RNA (ncrna) are functional RNA molecule that are not translated into a protein. ncrna genes include highly
More informationThe UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationHuber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter
Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter I. Introduction: MultiFinder is a tool designed to combine the results of multiple motif finders and analyze the resulting motifs
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationABySS. Assembly By Short Sequences
ABySS Assembly By Short Sequences ABySS Developed at Canada s Michael Smith Genome Sciences Centre Developed in response to memory demands of conventional DBG assembly methods Parallelizability Illumina
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationPractical: Using LAST and MEGAN to get a quick view of a metagenome
Practical: Using LAST and MEGAN to get a quick view of a metagenome Daniel Lundin Linneaeus University November 14, 2014 Daniel Lundin (LNU) LAST+MEGAN practical November 14, 2014 1 / 25 A GIT archive
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationsee also:
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 3 Genome Assembly Newbler 2.9 Most assembly programs are run in a similar manner to one another. We will use the
More informationUnix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th
Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationREAPR version Martin Hunt. Feb 23 rd 2015
REAPR version 1.0.18 Martin Hunt Feb 23 rd 2015 1 Contents 1 Installation 3 1.1 Prerequisites................................... 3 1.2 Install REAPR.................................. 3 2 Brief instructions
More informationLecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
More informationUSING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)
USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are
More informationMerge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.
Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics
More informationreplace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
More informationRun Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose
More informationData Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis
Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationIntroduction to Linux Organizing Files
Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing
More informationGenome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly
2 Sept Groups Group 5 was down to 3 people so I merged it into the other groups Group 1 is now 6 people anyone want to change? The initial drafter is not the official leader use any management structure
More informationBriefly: Bioinformatics File Formats. J Fass September 2018
Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /
More informationIntroduction To NGS Data & Analytic Tools. Steve Pederson Bioinformatics Centre University Of Adelaide
Introduction To NGS Data & Analytic Tools Steve Pederson Bioinformatics Centre University Of Adelaide Adelaide, South Australa October 2014 Introduction 1 Thank you for your attendance & welcome to the
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationWhole genome assembly comparison of duplication originally described in Bailey et al
WGAC Whole genome assembly comparison of duplication originally described in Bailey et al. 2001. Inputs species name path to FASTA sequence(s) to be processed either a directory of chromosomal FASTA files
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More information2018/08/16 14:47 1/36 CD-HIT User's Guide
2018/08/16 14:47 1/36 CD-HIT User's Guide CD-HIT User's Guide This page is moving to new CD-HIT wiki page at Github.com Last updated: 2017/06/20 07:38 http://cd-hit.org Program developed by Weizhong Li's
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationFusion Detection Using QIAseq RNAscan Panels
Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationFrom genomic regions to biology
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationMDA Blast2GO Exercises
MDA 2011 - Blast2GO Exercises Ana Conesa and Stefan Götz March 2011 Bioinformatics and Genomics Department Prince Felipe Research Center Valencia, Spain Contents 1 Annotate 10 sequences with Blast2GO 2
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationFast-track to Gene Annotation and Genome Analysis
Fast-track to Gene Annotation and Genome Analysis Contents Section Page 1.1 Introduction DNA Subway is a bioinformatics workspace that wraps high-level analysis tools in an intuitive and appealing interface.
More informationVirtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/
Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More information1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central
1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 2. SCOPE: This procedure applies to all clinical isolates that are whole
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationWei Shen Third Military Medical University, China Aug 2016
Wei Shen Third Military Medical University, China http://shenwei.me Aug 2016 About http://shenwei.me FASTA/Q formats FASTA FASTQ >cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
More informationWhere can UNIX be used? Getting to the terminal. Where are you? most important/useful commands & examples. Real Unix computers
Where can UNIX be used? Introduction to Unix: most important/useful commands & examples Bingbing Yuan Jan. 19, 2010 Real Unix computers tak, the Whitehead h Scientific Linux server Apply for an account
More informationGenome Assembly: Preliminary Results
Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.
More informationHands-on Instruction in Sequence Assembly
1 Botany 2010 Workshop: An Introduction to Next-Generation Sequencing Hands-on Instruction in Sequence Assembly Part 1. Download sequence files in fastq format from GenBank Sequence Read Archive. 1. Go
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationTaller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics
Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across
More informationEpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
More informationCSC BioWeek 2018: Using Taito cluster for high throughput data analysis
CSC BioWeek 2018: Using Taito cluster for high throughput data analysis 7. 2. 2018 Running Jobs in CSC Servers Exercise 1: Running a simple batch job in Taito We will run a small alignment using BWA: https://research.csc.fi/-/bwa
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationhttp://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More information1. Download the data from ENA and QC it:
GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You
More information2. Take a few minutes to look around the site. The goal is to familiarize yourself with a few key components of the NCBI.
2 Navigating the NCBI Instructions Aim: To become familiar with the resources available at the National Center for Bioinformatics (NCBI) and the search engine Entrez. Instructions: Write the answers to
More informationUMass High Performance Computing Center
UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every
More informationGlimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher
Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher 10 October 2005 1 Introduction This document describes Version 3 of the Glimmer gene-finding software. This version incorporates a nearly complete
More informationTutorial: De Novo Assembly of Paired Data
: De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly
More information