Quality Control of Sequencing Data

Size: px
Start display at page:

Download "Quality Control of Sequencing Data"

Transcription

1 Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY // BTI Plant Bioinformatics Course /27/2017 BTI Plant Bioinformatics Course

2 3/27/2017 BTI Plant Bioinformatics Course Quality Control of NGS Data 1. Exploration 2. Evaluation 3. Preprocessing

3 3/27/2017 BTI Plant Bioinformatics Course Exploration Goal: Use shell commands and installed tools to explore using the file from TAIR Data: /home/bioinfo/data/tair10_pep.fasta.gz Tools: (fasta toolkit)

4 3/27/2017 BTI Plant Bioinformatics Course Exploration Exercise 1: 1. Type fasta and TAB key to find all the commands starting with fasta 2. Uncompress and find the length of sequences in the file: TAIR10_pep.fasta.gz Tip: Use gzip and fastalength 3. Split the above file into 3 fasta files Tip: Use fastasplit

5 Evaluation Goal: Learn the use of read evaluation programs keeping attention in relevant parameters such as quality score and length distributions and unusual reads duplications. Data: data for two tomato ripening stages /home/bioinfo/data/slch04_demo.tar.gz Tools: tar -zxvf OR xvf (command line, untar and unzip the files) head (command line, take a quick look of the files) mv (command line, change the name of the files) grep (command line, find/count patterns in files) FASTX toolkit (command line, process fasta/fastq) FastQC (gui, to calculate several stats for each file) 3/27/2017 BTI Plant Bioinformatics Course

6 3/27/2017 BTI Plant Bioinformatics Course Evaluation Exercise 2: 1. Uncompress the file: /home/bioinfo/data/slch04_demo.tar.gz 2. Raw data will be found in 4 files. Print the first 10 lines for the files: SRR404331_ch4.fq, SRR404333_ch4.fq, SRR404334_ch4.fq and SRR404336_ch4.fq. Question 2.1: Do these files have fastq format?

7 Evaluation Exercise 2: 3. Count number of sequences in each fastq file using commands you learnt last time. 4. Convert the fastq files to fasta. Tip: Use grep Tip: Use fastq_to_fasta -h to see help Use Google if you are stuck 5. Explore other tools in the FASTX toolkit Now count the number of sequences in fasta file and see if the number of sequences has changed. 3/27/2017 BTI Plant Bioinformatics Course

8 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Quality

9 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Quality Poor

10 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Sequence Quality Pacific Biosciences

11 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Content

12 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Sequence Content Poor

13 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Duplication Good

14 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Duplication Poor

15 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Overrepresented Sequences Good

16 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Overrepresented Sequences Good Poor

17 3/27/2017 BTI Plant Bioinformatics Course Evaluation: Kmer content Good

18 3/27/2017 BTI Plant Bioinformatics Course Good Evaluation: Kmer content Poor

19 3/27/2017 BTI Plant Bioinformatics Course Evaluation Exercise 3: 1.Type fastqc to start the FastQC program. Load the four fastq sequence files in the program. Question 3.2: How many sequences there are per file in FastQC? Question 3.3: Which is the length range for these reads? Question 3.4: Which is the quality score range for these reads? Which one looks best quality-wise? Question 3.5: Do these s have read overrepresentation? Question 3.6: Looking into the kmer content, do you think that the samples have an adaptor?

20 3/27/2017 BTI Plant Bioinformatics Course Preprocessing Goal: Trim the low quality ends of the reads and remove the short reads. Data: data for two tomato ripening stages /home/bioinfo/data/slch04_demo.tar.gz Tools: fastq-mcf (command line tool to process reads) FastQC (gui, to calculate several stats for each file)

21 Preprocessing Exercise 4: Download the file: adapters1.fa from ftp://ftp.solgenomics.net/user_requests/aubombarely/courses/rnaseqcorpoica/a dapters1.fa Run the read processing program over each of the s using Min. qscore of 30 Min. length of 40 bp Tip: Use fastq-mcf -h to see help Type fastqc to start the FastQC program. Load the four new fastq sequence files. Compare the results with the previous s. 3/27/2017 BTI Plant Bioinformatics Course

22 3/27/2017 BTI Plant Bioinformatics Course Bonus Material Here are some simple exercises using the file from TAIR /home/bioinfo/data/tair10_pep.fasta.gz Number of unknown proteins per chromosome Number of proteins that are not unknown proteins per chromosome and are on the forward strand Number of proteins which are located within the first 5MB of the chromosome (awk) All genes of length greater than 2000bp (awk) All proteins of length greater than 200aa (awk)

Quality assessment of NGS data

Quality assessment of NGS data Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:

More information

NGS : reads quality control

NGS : reads quality control NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Introduction to UNIX command-line

Introduction to UNIX command-line Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions

More information

Sequence Data Quality Assessment Exercises and Solutions.

Sequence Data Quality Assessment Exercises and Solutions. Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and

More information

ChIP-Seq data analysis workshop

ChIP-Seq data analysis workshop ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Understanding and Pre-processing Raw Illumina Data

Understanding and Pre-processing Raw Illumina Data Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Trimming and quality control ( )

Trimming and quality control ( ) Trimming and quality control (2015-06-03) Alexander Jueterbock, Martin Jakt PhD course: High throughput sequencing of non-model organisms Contents 1 Overview of sequence lengths 2 2 Quality control 3 3

More information

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Practical Linux examples: Exercises

Practical Linux examples: Exercises Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

Lecture 8. Sequence alignments

Lecture 8. Sequence alignments Lecture 8 Sequence alignments DATA FORMATS bioawk bioawk is a program that extends awk s powerful processing of tabular data to processing tasks involving common bioinformatics formats like FASTA/FASTQ,

More information

Next Generation Sequencing quality trimming (NGSQTRIM)

Next Generation Sequencing quality trimming (NGSQTRIM) Next Generation Sequencing quality trimming (NGSQTRIM) Danamma B.J 1, Naveen kumar 2, V.G Shanmuga priya 3 1 M.Tech, Bioinformatics, KLEMSSCET, Belagavi 2 Proprietor, GenEclat Technologies, Bengaluru 3

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

MetaStorm: User Manual

MetaStorm: User Manual MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To

More information

The Analysis of RAD-tag Data for Association Studies

The Analysis of RAD-tag Data for Association Studies EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

HMPL User Manual. Shuying Sun or Texas State University

HMPL User Manual. Shuying Sun or Texas State University HMPL User Manual Shuying Sun (ssun5211@yahoo.com or s_s355@txstate.edu), Texas State University Peng Li (pxl119@case.edu), Case Western Reserve University June 18, 2015 Contents 1. General Overview and

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

AllBio Tutorial. NGS data analysis for non-coding RNAs and small RNAs

AllBio Tutorial. NGS data analysis for non-coding RNAs and small RNAs AllBio Tutorial NGS data analysis for non-coding RNAs and small RNAs Aim of the Tutorial Non-coding RNA (ncrna) are functional RNA molecule that are not translated into a protein. ncrna genes include highly

More information

The UCSC Gene Sorter, Table Browser & Custom Tracks

The UCSC Gene Sorter, Table Browser & Custom Tracks The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Huber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter

Huber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter I. Introduction: MultiFinder is a tool designed to combine the results of multiple motif finders and analyze the resulting motifs

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

ABySS. Assembly By Short Sequences

ABySS. Assembly By Short Sequences ABySS Assembly By Short Sequences ABySS Developed at Canada s Michael Smith Genome Sciences Centre Developed in response to memory demands of conventional DBG assembly methods Parallelizability Illumina

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

Identiyfing splice junctions from RNA-Seq data

Identiyfing splice junctions from RNA-Seq data Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice

More information

Practical: Using LAST and MEGAN to get a quick view of a metagenome

Practical: Using LAST and MEGAN to get a quick view of a metagenome Practical: Using LAST and MEGAN to get a quick view of a metagenome Daniel Lundin Linneaeus University November 14, 2014 Daniel Lundin (LNU) LAST+MEGAN practical November 14, 2014 1 / 25 A GIT archive

More information

DNA / RNA sequencing

DNA / RNA sequencing Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using

More information

see also:

see also: ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 3 Genome Assembly Newbler 2.9 Most assembly programs are run in a similar manner to one another. We will use the

More information

Unix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th

Unix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o

More information

REAPR version Martin Hunt. Feb 23 rd 2015

REAPR version Martin Hunt. Feb 23 rd 2015 REAPR version 1.0.18 Martin Hunt Feb 23 rd 2015 1 Contents 1 Installation 3 1.1 Prerequisites................................... 3 1.2 Install REAPR.................................. 3 2 Brief instructions

More information

Lecture 3. Essential skills for bioinformatics: Unix/Linux

Lecture 3. Essential skills for bioinformatics: Unix/Linux Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,

More information

USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)

USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012) USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are

More information

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p. Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the

More information

Essential Skills for Bioinformatics: Unix/Linux

Essential Skills for Bioinformatics: Unix/Linux Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose

More information

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Importing your Exeter NGS data into Galaxy:

Importing your Exeter NGS data into Galaxy: Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina

More information

Introduction to Linux Organizing Files

Introduction to Linux Organizing Files Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing

More information

Genome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly

Genome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly 2 Sept Groups Group 5 was down to 3 people so I merged it into the other groups Group 1 is now 6 people anyone want to change? The initial drafter is not the official leader use any management structure

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Introduction To NGS Data & Analytic Tools. Steve Pederson Bioinformatics Centre University Of Adelaide

Introduction To NGS Data & Analytic Tools. Steve Pederson Bioinformatics Centre University Of Adelaide Introduction To NGS Data & Analytic Tools Steve Pederson Bioinformatics Centre University Of Adelaide Adelaide, South Australa October 2014 Introduction 1 Thank you for your attendance & welcome to the

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Whole genome assembly comparison of duplication originally described in Bailey et al

Whole genome assembly comparison of duplication originally described in Bailey et al WGAC Whole genome assembly comparison of duplication originally described in Bailey et al. 2001. Inputs species name path to FASTA sequence(s) to be processed either a directory of chromosomal FASTA files

More information

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

2018/08/16 14:47 1/36 CD-HIT User's Guide

2018/08/16 14:47 1/36 CD-HIT User's Guide 2018/08/16 14:47 1/36 CD-HIT User's Guide CD-HIT User's Guide This page is moving to new CD-HIT wiki page at Github.com Last updated: 2017/06/20 07:38 http://cd-hit.org Program developed by Weizhong Li's

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Fusion Detection Using QIAseq RNAscan Panels

Fusion Detection Using QIAseq RNAscan Panels Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com

More information

From genomic regions to biology

From genomic regions to biology Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

MDA Blast2GO Exercises

MDA Blast2GO Exercises MDA 2011 - Blast2GO Exercises Ana Conesa and Stefan Götz March 2011 Bioinformatics and Genomics Department Prince Felipe Research Center Valencia, Spain Contents 1 Annotate 10 sequences with Blast2GO 2

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Fast-track to Gene Annotation and Genome Analysis

Fast-track to Gene Annotation and Genome Analysis Fast-track to Gene Annotation and Genome Analysis Contents Section Page 1.1 Introduction DNA Subway is a bioinformatics workspace that wraps high-level analysis tools in an intuitive and appealing interface.

More information

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/ Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central

1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 2. SCOPE: This procedure applies to all clinical isolates that are whole

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

Wei Shen Third Military Medical University, China Aug 2016

Wei Shen Third Military Medical University, China  Aug 2016 Wei Shen Third Military Medical University, China http://shenwei.me Aug 2016 About http://shenwei.me FASTA/Q formats FASTA FASTQ >cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC

More information

Where can UNIX be used? Getting to the terminal. Where are you? most important/useful commands & examples. Real Unix computers

Where can UNIX be used? Getting to the terminal. Where are you? most important/useful commands & examples. Real Unix computers Where can UNIX be used? Introduction to Unix: most important/useful commands & examples Bingbing Yuan Jan. 19, 2010 Real Unix computers tak, the Whitehead h Scientific Linux server Apply for an account

More information

Genome Assembly: Preliminary Results

Genome Assembly: Preliminary Results Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.

More information

Hands-on Instruction in Sequence Assembly

Hands-on Instruction in Sequence Assembly 1 Botany 2010 Workshop: An Introduction to Next-Generation Sequencing Hands-on Instruction in Sequence Assembly Part 1. Download sequence files in fastq format from GenBank Sequence Read Archive. 1. Go

More information

Genome Browsers - The UCSC Genome Browser

Genome Browsers - The UCSC Genome Browser Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,

More information

Taller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics

Taller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read

More information

Essential Skills for Bioinformatics: Unix/Linux

Essential Skills for Bioinformatics: Unix/Linux Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across

More information

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on

More information

CSC BioWeek 2018: Using Taito cluster for high throughput data analysis

CSC BioWeek 2018: Using Taito cluster for high throughput data analysis CSC BioWeek 2018: Using Taito cluster for high throughput data analysis 7. 2. 2018 Running Jobs in CSC Servers Exercise 1: Running a simple batch job in Taito We will run a small alignment using BWA: https://research.csc.fi/-/bwa

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

http://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

1. Download the data from ENA and QC it:

1. Download the data from ENA and QC it: GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You

More information

2. Take a few minutes to look around the site. The goal is to familiarize yourself with a few key components of the NCBI.

2. Take a few minutes to look around the site. The goal is to familiarize yourself with a few key components of the NCBI. 2 Navigating the NCBI Instructions Aim: To become familiar with the resources available at the National Center for Bioinformatics (NCBI) and the search engine Entrez. Instructions: Write the answers to

More information

UMass High Performance Computing Center

UMass High Performance Computing Center UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every

More information

Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher

Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher 10 October 2005 1 Introduction This document describes Version 3 of the Glimmer gene-finding software. This version incorporates a nearly complete

More information

Tutorial: De Novo Assembly of Paired Data

Tutorial: De Novo Assembly of Paired Data : De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly

More information