UNIX for Smar0es. compu0ng environments. Aaron J. Mackey Bill Pearson

Size: px
Start display at page:

Download "UNIX for Smar0es. compu0ng environments. Aaron J. Mackey Bill Pearson"

Transcription

1 UNIX for Smar0es Aaron J. Mackey Bill Pearson compu0ng environments UNIX compu0ng: the command line "shell" environment, built- in tools infinitely extensible: download/install tools most bioinforma0cs algorithms/tools are implemented as UNIX command line u0li0es or libraries or, write your own algorithms/tools from scratch highly automatable by scrip0ng (Perl, Python, etc.) interopera0on between tools only limited by your ability to glue together input/output formats almost en0rely free access to tools demo 1

2 UNIX file editors UNIX newlines are "\n" PC is "\r\n"; Mac is \r"; Use a UNIX editor on UNIX files: nano emacs vs. vi/vim When programming, use an IDE eclipse ( Komodo Edit ( edit) do not use: Word, NotePad/WordPad, TextEdit, etc. every editor has pros and cons, try a few filesystem naviga0on cd change directory pwd print working directory (current dir.) ls list files pushd/popd cd, but remember stack find search through filesystem basename/dirname extract filename pieces 2

3 filesystem manipula0on cp copy files mv move files rm remove files rmdir remove directories touch make a new, empty file mkdir make a new, empty directory file inspec0on more read/browse through a file/stdin cat dump file contents to stdout head/tail print first/last N lines od look at the raw data sort sort the lines in the file uniq report unique lines cut extract specific columns grep search for matching lines wc count words/lines/characters 3

4 UNIX permisions chmod change the permissions on a file/dir chown change the ownership of a file/dir chgrp change the group of a file/dir UNIX host status top/ps what processes/apps are running kill force- quit running processes/apps df -h available disk resources du disk space usage 4

5 other UNIX commands builtins list available shell commands which/where find path of commands time measure how long something take echo/tee print/report text wget/curl download files gzip/gunzip/bunzip/zcat compressed files ssh/scp login/copy to/from remote hosts history what have I done previously man get help redirec0on, pipes, replacements > - redirect stdout into file, replace exis0ng >> - redirect stdout into file, appending - redirect/pipe stdout to stdin of next command `backticks`- replace with captured stdout 5

6 globs * wildcard matching {a,b,c} mul0ple choice [a-c], [1-5,9] range/set choice ^ nega0on ls l *.bam ls chr[1-23,x,y].bed environment variables $USER who you are $SHELL what shell you are running $PWD your current working dir $PATH where the shell will go to look for commands $EDITOR your default editor set in your.cshrc/.bashrc, set/setenv 6

7 UNIX editors: learn (at least) one nano simple, easy vi no mouse, use arrow keys how to quit: ctrl- X (all commands at screen bo^om) not so simple to use guaranteed to be on any UNIX machine o_en the default $EDITOR how to quit: [colon]q![enter] emacs also not so simple to use incredibly versa0le, customizable, programmable how to quit: ctrl- X ctrl- C Using emacs" sh>emacs! ^x^c!exit! sh>emacs filename! type some stuff! ^f,^b,^p,^n forward,back,prev, next! ^x^s!save it! ^x^c!exit! sh>! 7

8 Intermediate emacs" sh>emacs random.pl! ^s, ^r search forward, reverse! ^a, ^e start, end of line! esc = M-! M-<, M-> start, end of buffer! M-%!query-replace! ^k!kill-line (and put in kill buffer)! ^k^k!delete line and linefeed (EOL)! ^y!(yank insert kill buffer)! ^x 2, ^x 1, ^x o (multiple windows)! ^u!!(repeat number)! ^h!(help,^h-t tutorial, ^h-a apropos)! (bash) shell scripts files ending with.sh suffix shebang: #!/bin/bash or #!/bin/sh useful to capture (poten0ally long) history of UNIX commands into a reproducible analysis you will always need to repeat your analysis you will never remember all the necessary steps with some modifica0on, your script can be made generic, and reusable for other data 8

9 control flow statements for name in [ ] ; do [ ] ; done do something for each item in a list if [ ] ; then [ ] ; elif [ ]; then [ ]; else [ ] fi specify behavior depending on condi0ons alterna0ve scrip0ng languages Perl once the mainstay of WWW/CGI programming long history == lots of reusable packages PHP mainly limited to dynamic WWW pages Python extremely popular Ruby compact, expressive 9

10 Running Perl" Running a script: % perl myscript.pl Perl one-liners : % perl e 'print "Howdy\n";' Spontaneous Perl: % perl Print "Here we are.\n"; <ctrl-d> Executable scripts: % chmod +x myscript.pl % myscript.pl Literals: strings and numbers" % perl e 'print 2 + 2; print "\n";' % perl e 'print "abc"; print "def\n";' # string addition (concatenation operator) % perl e 'print "one two". " and three\n";' # mixing numbers and strings: % perl e 'print (2 * 2). \n ; % perl e 'print "2 + 2 = ". (2 + 2). "\n";' # decimals and concatenations: % perl e 'print "\n";' % perl e 'print "\n";' 10

11 Perl vs. bash scripts ".pl" file extension, e.g. "myscript.pl" begins with a "shebang" #!/usr/bin/perl.pl scripts need chmod +x to be executable: invoked with perl: perl myscript.pl or directly:./myscript.pl Perl variables scalar: begins with s: $ $name = "Aaron"; $day = "Friday"; $url = " array: begins = ("Mon", "Tue", "Wed","etc."); hash: begins with h: % %lookup = ( "key1" => "value1", "key2" => "value2" ); 11

12 use strict; always begin every Perl script with: use strict; use warnings; #for longer help: use diagnostics; now every variable must be declared with my my $name = "Aaron"; = ("Mon", "Tue", "etc."); strict ensures that the variable names you use are what you meant, not typos or accidental syntax errors warnings provides brief messages about inappropriate usage/syntax your first Perl script #!/usr/bin/perl use strict; use warnings; my $name = "Bob"; print "Hello world.\n"; print "My name is $name.\n"; 12

13 where to get help: perldoc perldoc perl provides list of all the "chapters" available perldoc perltoc gives more detail/searchable perldoc perlintro shows the intro to Perl chapter: read this! perldoc perlrequick introduc0on to regular expressions perldoc perlopentut how to open/read/write files/stdin/stdout 13

Bioinformatics and Functional Genomics Unix at the command line biol4230 Friday, Jan 19, 2018

Bioinformatics and Functional Genomics Unix at the command line biol4230 Friday, Jan 19, 2018 Bioinformatics and Functional Genomics Unix at the command line biol4230 Friday, Jan 19, 2018 Goals of today's lecture: introduction to the unix command line unix file manipulation ls, cp, mv, mkdir, cd,

More information

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

Perl and R Scripting for Biologists

Perl and R Scripting for Biologists Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications

More information

Introduction: What is Unix?

Introduction: What is Unix? Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up

More information

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines

Introduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical

More information

Mills HPC Tutorial Series. Linux Basics I

Mills HPC Tutorial Series. Linux Basics I Mills HPC Tutorial Series Linux Basics I Objectives Command Line Window Anatomy Command Structure Command Examples Help Files and Directories Permissions Wildcards and Home (~) Redirection and Pipe Create

More information

Linux Command Line Primer. By: Scott Marshall

Linux Command Line Primer. By: Scott Marshall Linux Command Line Primer By: Scott Marshall Draft: 10/21/2007 Table of Contents Topic Page(s) Preface 1 General Filesystem Background Information 2 General Filesystem Commands 2 Working with Files and

More information

Unix basics exercise MBV-INFX410

Unix basics exercise MBV-INFX410 Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.

More information

1) Introduc,on to unix command line and perl. Ma5 Webster IMBIM, BMC

1) Introduc,on to unix command line and perl. Ma5 Webster IMBIM, BMC 1) Introduc,on to unix command line and perl Ma5 Webster IMBIM, BMC ma5hew.webster@imbim.uu.se Perl course details course book Learning Perl (6 ed.) lectures cover chapters morning lectures + aiernoon

More information

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University

Unix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )

More information

The Unix Shell. Pipes and Filters

The Unix Shell. Pipes and Filters The Unix Shell Copyright Software Carpentry 2010 This work is licensed under the Creative Commons Attribution License See http://software-carpentry.org/license.html for more information. shell shell pwd

More information

Useful Unix Commands Cheat Sheet

Useful Unix Commands Cheat Sheet Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List

More information

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater)

CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) CS 3410 Intro to Unix, shell commands, etc... (slides from Hussam Abu-Libdeh and David Slater) 28 January 2013 Jason Yosinski Original slides available under Creative Commons Attribution-ShareAlike 3.0

More information

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen

Introduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen Introduction to Unix The Windows User perspective Wes Frisby Kyle Horne Todd Johansen What is Unix? Portable, multi-tasking, and multi-user operating system Software development environment Hardware independent

More information

Introduction to UNIX. Introduction. Processes. ps command. The File System. Directory Structure. UNIX is an operating system (OS).

Introduction to UNIX. Introduction. Processes. ps command. The File System. Directory Structure. UNIX is an operating system (OS). Introduction Introduction to UNIX CSE 2031 Fall 2012 UNIX is an operating system (OS). Our goals: Learn how to use UNIX OS. Use UNIX tools for developing programs/ software, specifically shell programming.

More information

Introduction to UNIX. CSE 2031 Fall November 5, 2012

Introduction to UNIX. CSE 2031 Fall November 5, 2012 Introduction to UNIX CSE 2031 Fall 2012 November 5, 2012 Introduction UNIX is an operating system (OS). Our goals: Learn how to use UNIX OS. Use UNIX tools for developing programs/ software, specifically

More information

Part 1: Basic Commands/U3li3es

Part 1: Basic Commands/U3li3es Final Exam Part 1: Basic Commands/U3li3es May 17 th 3:00~4:00pm S-3-143 Same types of questions as in mid-term 1 2 ls, cat, echo ls -l e.g., regular file or directory, permissions, file size ls -a cat

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

The Unix Shell & Shell Scripts

The Unix Shell & Shell Scripts The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises

More information

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT

Unix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking

More information

Linux Command Line Interface. December 27, 2017

Linux Command Line Interface. December 27, 2017 Linux Command Line Interface December 27, 2017 Foreword It is supposed to be a refresher (?!) If you are familiar with UNIX/Linux/MacOS X CLI, this is going to be boring... I will not talk about editors

More information

Linux II and III. Douglas Scofield. Crea-ng directories and files 18/01/14. Evolu5onary Biology Centre, Uppsala University

Linux II and III. Douglas Scofield. Crea-ng directories and files 18/01/14. Evolu5onary Biology Centre, Uppsala University Linux II and III Douglas Scofield Evolu5onary Biology Centre, Uppsala University douglas.scofield@ebc.uu.se slides at Crea-ng directories and files mkdir 1 Crea-ng directories and files touch if file does

More information

A Brief Introduction to Unix

A Brief Introduction to Unix A Brief Introduction to Unix Sean Barag Drexel University March 30, 2011 Sean Barag (Drexel University) CS 265 - A Brief Introduction to Unix March 30, 2011 1 / 17 Outline 1 Directories

More information

Introduction to UNIX. Introduction EECS l UNIX is an operating system (OS). l Our goals:

Introduction to UNIX. Introduction EECS l UNIX is an operating system (OS). l Our goals: Introduction to UNIX EECS 2031 13 November 2017 Introduction l UNIX is an operating system (OS). l Our goals: Learn how to use UNIX OS. Use UNIX tools for developing programs/ software, specifically shell

More information

Basic Linux (Bash) Commands

Basic Linux (Bash) Commands Basic Linux (Bash) Commands Hint: Run commands in the emacs shell (emacs -nw, then M-x shell) instead of the terminal. It eases searching for and revising commands and navigating and copying-and-pasting

More information

This lab exercise is to be submitted at the end of the lab session! passwd [That is the command to change your current password to a new one]

This lab exercise is to be submitted at the end of the lab session! passwd [That is the command to change your current password to a new one] Data and Computer Security (CMPD414) Lab II Topics: secure login, moving into HOME-directory, navigation on Unix, basic commands for vi, Message Digest This lab exercise is to be submitted at the end of

More information

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80

CSE 303 Lecture 2. Introduction to bash shell. read Linux Pocket Guide pp , 58-59, 60, 65-70, 71-72, 77-80 CSE 303 Lecture 2 Introduction to bash shell read Linux Pocket Guide pp. 37-46, 58-59, 60, 65-70, 71-72, 77-80 slides created by Marty Stepp http://www.cs.washington.edu/303/ 1 Unix file system structure

More information

Unix/Linux Operating System. Introduction to Computational Statistics STAT 598G, Fall 2011

Unix/Linux Operating System. Introduction to Computational Statistics STAT 598G, Fall 2011 Unix/Linux Operating System Introduction to Computational Statistics STAT 598G, Fall 2011 Sergey Kirshner Department of Statistics, Purdue University September 7, 2011 Sergey Kirshner (Purdue University)

More information

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program

Using UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the

More information

Introduction to Linux

Introduction to Linux Introduction to Linux University of Bristol - Advance Computing Research Centre 1 / 47 Operating Systems Program running all the time Interfaces between other programs and hardware Provides abstractions

More information

Linux Shell Script. J. K. Mandal

Linux Shell Script. J. K. Mandal Linux Shell Script J. K. Mandal Professor, Department of Computer Science & Engineering, Faculty of Engineering, Technology & Management University of Kalyani Kalyani, Nadia, West Bengal E-mail: jkmandal@klyuniv.ac.in,

More information

Introduction to the shell Part II

Introduction to the shell Part II Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility

More information

Introduc)on to Linux Session 2 Files/Filesystems/Data. Pete Ruprecht Research Compu)ng Group University of Colorado Boulder

Introduc)on to Linux Session 2 Files/Filesystems/Data. Pete Ruprecht Research Compu)ng Group University of Colorado Boulder Introduc)on to Linux Session 2 Files/Filesystems/Data Pete Ruprecht Research Compu)ng Group University of Colorado Boulder www.rc.colorado.edu Outline LeHover from last week redirec)on Filesystem layout

More information

Introduction to Linux Environment. Yun-Wen Chen

Introduction to Linux Environment. Yun-Wen Chen Introduction to Linux Environment Yun-Wen Chen 1 The Text (Command) Mode in Linux Environment 2 The Main Operating Systems We May Meet 1. Windows 2. Mac 3. Linux (Unix) 3 Windows Command Mode and DOS Type

More information

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2

CSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2 CSE Linux VM For Microsoft Windows Based on opensuse Leap 42.2 Dr. K. M. Flurchick February 2, 2017 Contents 1 Introduction 1 2 Requirements 1 3 Procedure 1 4 Usage 3 4.1 Start/Stop.................................................

More information

Linux II and III. Douglas Scofield. Crea-ng directories and files 15/08/16. Evolu6onary Biology Centre, Uppsala University

Linux II and III. Douglas Scofield. Crea-ng directories and files 15/08/16. Evolu6onary Biology Centre, Uppsala University Linux II and III Douglas Scofield Evolu6onary Biology Centre, Uppsala University douglas.scofield@ebc.uu.se Crea-ng directories and files mkdir 1 Crea-ng directories and files touch if file does not exist,

More information

Introduction To Linux. Rob Thomas - ACRC

Introduction To Linux. Rob Thomas - ACRC Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free

More information

Shell Programming Systems Skills in C and Unix

Shell Programming Systems Skills in C and Unix Shell Programming 15-123 Systems Skills in C and Unix The Shell A command line interpreter that provides the interface to Unix OS. What Shell are we on? echo $SHELL Most unix systems have Bourne shell

More information

Linux environment. Graphical interface X-window + window manager. Text interface terminal + shell

Linux environment. Graphical interface X-window + window manager. Text interface terminal + shell Linux environment Graphical interface X-window + window manager Text interface terminal + shell ctrl-z put running command to background (come back via command fg) Terminal basics Two basic shells - slightly

More information

Unix Tools / Command Line

Unix Tools / Command Line Unix Tools / Command Line An Intro 1 Basic Commands / Utilities I expect you already know most of these: ls list directories common options: -l, -F, -a mkdir, rmdir make or remove a directory mv move/rename

More information

Command Line Interface The basics

Command Line Interface The basics Command Line Interface The basics Marco Berghoff, SCC, KIT Steinbuch Centre for Computing (SCC) Funding: www.bwhpc-c5.de Motivation In the Beginning was the Command Line by Neal Stephenson In contrast

More information

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP Unix Guide Meher Krishna Patel Created on : Octorber, 2017 Last updated : December, 2017 More documents are freely available at PythonDSP Table of contents Table of contents i 1 Unix commands 1 1.1 Unix

More information

Linux Systems Administration Getting Started with Linux

Linux Systems Administration Getting Started with Linux Linux Systems Administration Getting Started with Linux Network Startup Resource Center www.nsrc.org These materials are licensed under the Creative Commons Attribution-NonCommercial 4.0 International

More information

UNIX System Programming Lecture 3: BASH Programming

UNIX System Programming Lecture 3: BASH Programming UNIX System Programming Outline Filesystems Redirection Shell Programming Reference BLP: Chapter 2 BFAQ: Bash FAQ BMAN: Bash man page BPRI: Bash Programming Introduction BABS: Advanced Bash Scripting Guide

More information

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words

1. What statistic did the wc -l command show? (do man wc to get the answer) A. The number of bytes B. The number of lines C. The number of words More Linux Commands 1 wc The Linux command for acquiring size statistics on a file is wc. This command provides the line count, word count and number of bytes in a file. Open up a terminal, make sure you

More information

unix intro Documentation

unix intro Documentation unix intro Documentation Release 1 Scott Wales February 21, 2013 CONTENTS 1 Logging On 2 1.1 Users & Groups............................................. 2 1.2 Getting Help...............................................

More information

CENG 334 Computer Networks. Laboratory I Linux Tutorial

CENG 334 Computer Networks. Laboratory I Linux Tutorial CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction

More information

System Administration

System Administration Süsteemihaldus MTAT.08.021 System Administration UNIX shell basics Name service DNS 1/69 Command Line Read detailed manual for specific command using UNIX online documentation or so called manual (man)

More information

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:

When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt

More information

Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny.

Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny. Bioinformatics? Reads, assembly, annotation, comparative genomics and a bit of phylogeny stefano.gaiarsa@unimi.it Linux and the command line PART 1 Survival kit for the bash environment Purpose of the

More information

Command-line interpreters

Command-line interpreters Command-line interpreters shell Wiki: A command-line interface (CLI) is a means of interaction with a computer program where the user (or client) issues commands to the program in the form of successive

More information

Introduc)on to Unix and Perl programming

Introduc)on to Unix and Perl programming CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Department of Systems Biology Technical University of Denmark Introduc)on to Unix and Perl programming EDITA KAROSIENE PhD student edita@cbs.dtu.dk www.cbs.dtu.dk

More information

Open up a terminal, make sure you are in your home directory, and run the command.

Open up a terminal, make sure you are in your home directory, and run the command. More Linux Commands 0.1 wc The Linux command for acquiring size statistics on a file is wc. This command can provide information from line count, to bytes in a file. Open up a terminal, make sure you are

More information

CSCI 2132: Software Development. Norbert Zeh. Faculty of Computer Science Dalhousie University. Shell Scripting. Winter 2019

CSCI 2132: Software Development. Norbert Zeh. Faculty of Computer Science Dalhousie University. Shell Scripting. Winter 2019 CSCI 2132: Software Development Shell Scripting Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Reading Glass and Ables, Chapter 8: bash Your Shell vs Your File Manager File manager

More information

Essential Unix and Linux! Perl for Bioinformatics, ! F. Pineda

Essential Unix and Linux! Perl for Bioinformatics, ! F. Pineda Essential Unix and Linux! Perl for Bioinformatics, 140.636! F. Pineda Generic computer architecture Memory Storage Fig. 1.2 From Designing Embedded Hardware, 2 nd Ed. by John Catsoulis OS concepts Shell

More information

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow

More information

Week 2 Lecture 3. Unix

Week 2 Lecture 3. Unix Lecture 3 Unix Terminal and Shell 2 Terminal Prompt Command Argument Result 3 Shell Intro A system program that allows a user to execute: shell functions (e.g., ls -la) other programs (e.g., eclipse) shell

More information

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version... Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,

More information

Getting Started With UNIX Lab Exercises

Getting Started With UNIX Lab Exercises Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.

More information

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview

More information

9.2 Linux Essentials Exam Objectives

9.2 Linux Essentials Exam Objectives 9.2 Linux Essentials Exam Objectives This chapter will cover the topics for the following Linux Essentials exam objectives: Topic 3: The Power of the Command Line (weight: 10) 3.3: Turning Commands into

More information

CSCI 2132 Software Development. Lecture 5: File Permissions

CSCI 2132 Software Development. Lecture 5: File Permissions CSCI 2132 Software Development Lecture 5: File Permissions Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 14-Sep-2018 (5) CSCI 2132 1 Files and Directories Pathnames Previous

More information

CSE 15L Winter Midterm :) Review

CSE 15L Winter Midterm :) Review CSE 15L Winter 2015 Midterm :) Review Makefiles Makefiles - The Overview Questions you should be able to answer What is the point of a Makefile Why don t we just compile it again? Why don t we just use

More information

Lec 1 add-on: Linux Intro

Lec 1 add-on: Linux Intro Lec 1 add-on: Linux Intro Readings: - Unix Power Tools, Powers et al., O Reilly - Linux in a Nutshell, Siever et al., O Reilly Summary: - Linux File System - Users and Groups - Shell - Text Editors - Misc

More information

Processes. Shell Commands. a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms:

Processes. Shell Commands. a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms: Processes The Operating System, Shells, and Python Shell Commands a Command Line Interface accepts typed (textual) inputs and provides textual outputs. Synonyms: - Command prompt - Shell - CLI Shell commands

More information

Files and Directories

Files and Directories CSCI 2132: Software Development Files and Directories Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Files and Directories Much of the operation of Unix and programs running on

More information

Recap From Last Time: Setup Checklist BGGN 213. Todays Menu. Introduction to UNIX.

Recap From Last Time: Setup Checklist   BGGN 213. Todays Menu. Introduction to UNIX. Recap From Last Time: BGGN 213 Introduction to UNIX Barry Grant http://thegrantlab.org/bggn213 Substitution matrices: Where our alignment match and mis-match scores typically come from Comparing methods:

More information

Introduction to the Linux Command Line

Introduction to the Linux Command Line Introduction to the Linux Command Line May, 2015 How to Connect (securely) ssh sftp scp Basic Unix or Linux Commands Files & directories Environment variables Not necessarily in this order.? Getting Connected

More information

Basic UNIX Commands BASIC UNIX COMMANDS. 1. cat command. This command is used to create a file in unix. Syntax: $ cat filename

Basic UNIX Commands BASIC UNIX COMMANDS. 1. cat command. This command is used to create a file in unix. Syntax: $ cat filename Basic UNIX Commands BASIC UNIX COMMANDS 1. cat This is used to create a file in unix. $ cat >filename This is also used for displaying contents in a file. $ cat filename 2. ls It displays the list of files

More information

Exercise 1: Basic Tools

Exercise 1: Basic Tools Exercise 1: Basic Tools This exercise is created so everybody can learn the basic tools we will use during this course. It is really more like a tutorial than an exercise and, you are not required to submit

More information

Introduction to Linux

Introduction to Linux Introduction to Linux January 2011 Don Bahls User Consultant (Group Leader) bahls@arsc.edu (907) 450-8674 Overview The shell Common Commands File System Organization Permissions Environment Variables I/O

More information

Practical Session 0 Introduction to Linux

Practical Session 0 Introduction to Linux School of Computer Science and Software Engineering Clayton Campus, Monash University CSE2303 and CSE2304 Semester I, 2001 Practical Session 0 Introduction to Linux Novell accounts. Every Monash student

More information

Review of Fundamentals

Review of Fundamentals Review of Fundamentals 1 The shell vi General shell review 2 http://teaching.idallen.com/cst8207/14f/notes/120_shell_basics.html The shell is a program that is executed for us automatically when we log

More information

Basic Linux Command Line Interface Guide

Basic Linux Command Line Interface Guide This basic Linux Command-Line Interface (CLI) Guide provides a general explanation of commonly used Bash shell commands for the Barracuda NG Firewall. You can access the command-line interface by connecting

More information

Recap From Last Time:

Recap From Last Time: Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Files

Files http://www.cs.fsu.edu/~langley/cop3353-2013-1/reveal.js-2013-02-11/02.html?print-pdf 02/11/2013 10:55 AM Files A normal "flat" file is a collection of information. It's usually stored somewhere reasonably

More information

Shell scripting and system variables. HORT Lecture 5 Instructor: Kranthi Varala

Shell scripting and system variables. HORT Lecture 5 Instructor: Kranthi Varala Shell scripting and system variables HORT 59000 Lecture 5 Instructor: Kranthi Varala Text editors Programs built to assist creation and manipulation of text files, typically scripts. nano : easy-to-learn,

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

CS 25200: Systems Programming. Lecture 11: *nix Commands and Shell Internals

CS 25200: Systems Programming. Lecture 11: *nix Commands and Shell Internals CS 25200: Systems Programming Lecture 11: *nix Commands and Shell Internals Dr. Jef Turkstra 2018 Dr. Jeffrey A. Turkstra 1 Lecture 11 Shell commands Basic shell internals 2018 Dr. Jeffrey A. Turkstra

More information

Windshield. Language Reference Manual. Columbia University COMS W4115 Programming Languages and Translators Spring Prof. Stephen A.

Windshield. Language Reference Manual. Columbia University COMS W4115 Programming Languages and Translators Spring Prof. Stephen A. Windshield Language Reference Manual Columbia University COMS W4115 Programming Languages and Translators Spring 2007 Prof. Stephen A. Edwards Team members Wei-Yun Ma wm2174 wm2174@columbia.edu Tony Wang

More information

Basic Linux Command Line Interface Guide

Basic Linux Command Line Interface Guide This basic Linux Command-Line Interface (CLI) Guide provides a general explanation of commonly used Bash shell commands for the Barracuda NG Firewall. You can access the command-line interface by connecting

More information

BGGN 213 Working with UNIX Barry Grant

BGGN 213 Working with UNIX Barry Grant BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Chapter-3. Introduction to Unix: Fundamental Commands

Chapter-3. Introduction to Unix: Fundamental Commands Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system

More information

Introduction to Linux Organizing Files

Introduction to Linux Organizing Files Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing

More information

Introduction to UNIX Command Line

Introduction to UNIX Command Line Introduction to UNIX Command Line Files and directories Some useful commands (echo, cat, grep, find, diff, tar) Redirection Pipes Variables Background processes Remote connections (e.g. ssh, curl) Scripts

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

CS CS Tutorial 2 2 Winter 2018

CS CS Tutorial 2 2 Winter 2018 CS CS 230 - Tutorial 2 2 Winter 2018 Sections 1. Unix Basics and connecting to CS environment 2. MIPS Introduction & CS230 Interface 3. Connecting Remotely If you haven t set up a CS environment password,

More information

Intro to Linux. this will open up a new terminal window for you is super convenient on the computers in the lab

Intro to Linux. this will open up a new terminal window for you is super convenient on the computers in the lab Basic Terminal Intro to Linux ssh short for s ecure sh ell usage: ssh [host]@[computer].[otheripstuff] for lab computers: ssh [CSID]@[comp].cs.utexas.edu can get a list of active computers from the UTCS

More information

Introduc)on to Unix and Perl programming

Introduc)on to Unix and Perl programming CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Department of Systems Biology Technical University of Denmark Introduc)on to Unix and Perl programming EDITA KAROSIENE PhD student edita@cbs.dtu.dk www.cbs.dtu.dk

More information

Computer Systems and Architecture

Computer Systems and Architecture Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,

More information

Introduction. File System. Note. Achtung!

Introduction. File System. Note. Achtung! 3 Unix Shell 1: Introduction Lab Objective: Explore the basics of the Unix Shell. Understand how to navigate and manipulate file directories. Introduce the Vim text editor for easy writing and editing

More information

Answers to AWK problems. Shell-Programming. Future: Using loops to automate tasks. Download and Install: Python (Windows only.) R

Answers to AWK problems. Shell-Programming. Future: Using loops to automate tasks. Download and Install: Python (Windows only.) R Today s Class Answers to AWK problems Shell-Programming Using loops to automate tasks Future: Download and Install: Python (Windows only.) R Awk basics From the command line: $ awk '$1>20' filename Command

More information

Chapter 1 - Introduction. September 8, 2016

Chapter 1 - Introduction. September 8, 2016 Chapter 1 - Introduction September 8, 2016 Introduction Overview of Linux/Unix Shells Commands: built-in, aliases, program invocations, alternation and iteration Finding more information: man, info Help

More information

Introduction in Unix. Linus Torvalds Ken Thompson & Dennis Ritchie

Introduction in Unix. Linus Torvalds Ken Thompson & Dennis Ritchie Introduction in Unix Linus Torvalds Ken Thompson & Dennis Ritchie My name: John Donners John.Donners@surfsara.nl Consultant at SURFsara And Cedric Nugteren Cedric.Nugteren@surfsara.nl Consultant at SURFsara

More information

Unix. Examples: OS X and Ubuntu

Unix. Examples: OS X and Ubuntu The Command Line A terminal is at the end of an electric wire, a shell is the home of a turtle, tty is a strange abbreviation, and a console is a kind of cabinet. - Some person on SO Learning Resources

More information

UNIX Quick Reference

UNIX Quick Reference UNIX Quick Reference This card represents a brief summary of some of the more frequently used UNIX commands that all users should be at least somewhat familiar with. Some commands listed have much more

More information

Unix tutorial. Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based.

Unix tutorial. Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based. Unix tutorial Thanks to Michael Wood-Vasey (UPitt) and Beth Willman (Haverford) for providing Unix tutorials on which this is based. Terminal windows You will use terminal windows to enter and execute

More information

Introduction to UNIX I: Command Line 1 / 21

Introduction to UNIX I: Command Line 1 / 21 Introduction to UNIX I: Command Line 1 / 21 UNIX Command line The UNIX Shell: command line interface Navigating Directories and Files Running applications Reminder about helpful tutorial: http://korflab.ucdavis.edu/unix_and_perl/current.html

More information