STP, Unix, SAC tutorial, Ge167 Winter 2014
|
|
- Alban Fletcher
- 6 years ago
- Views:
Transcription
1 STP, Unix, SAC tutorial, Ge167 Winter 2014 Asaf Inbal 1 Downloading waveforms In this tutorial we ll learn how to download waveforms using a tool called STP (Seismic Transfer Program) and manipulate them with SAC (Seismic Analysis Code). We ll also write some basic shell scripts that will help us on our way to becoming seismologists/engineers. Throughout this tutorial, lines starting with # indicate comments. Let s start: We d like to look at waveforms from the M7.2 El Mayor-Cucapah earthquake, which was well recorded by the Southern California Seismic Network (SCSN). To download the waveforms using STP open a terminal (press the small TV on top left-hand side of your screen) and type the following commands: > STP now, let s have a look at the available commands within STP: > help or, for a more detailed description: > help command name To download waveforms for a specific event we need to know the event id number. Let s search the SCSN catalog for events that will match some search criteria. The EQ happened on April 4th, 2010, so we ll look for large events (magnitude 6.5 and above) that had occurred within 24 hours of midnight of 03/11/2011. The command is: > event -mag t0 2010/04/04 +24h and the output should be: uk 2010/04/04,22:40: w ts 2010/04/04,22:40: w le 2010/04/04,22:40: w uk 2010/04/04,22:41: l 0.5 with the event id as the first number on the left. The event id we will use is the one the 1
2 corresponds with the word le, which stands for local event. The next fields are the origin time, coordinates, magnitude, magnitude type, and location quality. Now that we have the event id we can download the waveforms. We would like to correct for the instrument gain: > gain on followed by: > trig The trig command will download the waveforms for stations in CA that were triggered by the EQ. While we wait for STP to finish, let s practice using Unix. Open another window (Shift+Ctrl+N) or tab (Shift+Ctrl+T). You can move between tabs by pressing Alt+num., where num. is the tab s number. To look at the contents of the directory: >ls -l You should see a new directory called Question: How do you know if this is a directory or a file? On Linux machines, directories names are usually printed in blue color. Another way is to find out is to look at the first letter of the first column of the output ( d for directory - for file). The rest of that row contains the permissions, which tells us who can do what with this file, the size and the date it was created. To look inside this new directory type: >ls which will list the directory contents. Note that the file names follow a specific format: eventid.network.station.channel.sac. According to the SCSN convention, channel names starting with BH or EH(???) indicate broad-band sensors. The third letter contains the component (vertical, east-west, north-south). If you want to change from the current directory to type: >cd To go back to the parent directory: >cd.. If you what to know the name of the current directory type: >pwd 2
3 On Unix based machines,.. and. are synonymous with parent and current directories. To count the files in type: >ls wc -l Here we are issuing two command in a row. The first command outputs the contents of We then use the symbol to pipe the to another command called wc (shorthand for word-count), with the -l flag signaling we are only interested in the number of lines. Issue this command twice and to see whether the waveform download is finished. By now STP should have finished downloading the files, so let s log out from our STP session by typing: >quit in the STP window. 2 Analyzing Waveforms and making nice figures Now we are going to look at some seismograms. Our main objective is to identify prominent phases (body waves, surface waves) associated with the EQ. First, let s have a look at a single station. SAC files are written in binary format, which contains a header followed by the actual data. The header contains always contain information about the length of the segment, the sampling rate, maximum and minimum values, the start time, and the offset with respect to that time. The header section will sometimes contain information about the station (name, location etc.) and the event. Since we used the trig command to download the data, the station and event data are written in the header section. Some of the commands in SAC will only work if event and station information are present. >r /file name #where file name is the name of a file in the directory #List the file s header. Pay attention to the sampling rate, begin times, length of segment, station and event information. >lh As you noticed in the former section, the EQ triggered hundreds of stations, of which only a subset should be used in this exercise. Working with a small number of stations shortens the processing time and makes the plots more readable. To choose this subset we are going to narrow down our search to the vertical sensors at the broad-band stations. This will leave us with (only) a few tens of stations. To be able to see the move-out we will sort the stations with respect to the hypocentral distance before we plot. We re going to write a short script that 3
4 outputs every tenth station in a list sorted according to the hypocentral distance. Open another window/tab. Open a text file you will call script.sh. To do that from within the shell we re going to invoke Vi, a powerful text editor. > vi script.sh To write text to our new file you ll need to go into insert mode, so press i. Note that the word INSERT appeared in the bottom left-hand side of the screen. To exit insert mode press the escape button. In that file you ve just opened type in the following lines: # a script to sort stations. first switch to use bash: #!/bin/bash # run script until you reach END, output to file sta list.txt sac << END > sta list.txt # read broad-band, vertical channels r./ /.bhz. # sort according to distance sort dist descend # from now on print output echo # list header files, station names, station latitudes lh columns 2 KSTNM STLA quit END #find "FILE" in sta list.txt,pipe to awk, print every 10th line. This should be writtem as one line #of code grep FILE sta list.txt awk NR%10==0 {printf "%s ",$2} END {printf \n } In Vi, press the escape button to leave insert mode. Typing : will transfer you to normal mode, where you can save the file and quit by entering: :w followed by :q. The first few lines of code will actually run SAC, perform the sorting and write the output to a new file called sta list.txt. This new file contains some text we are not interested in, followed by the filenames, the station name, and the station latitude. Note that the lines containing the file names start with the word FILE. We ll use grep and awk, two unix tools for searching and performing numerical operations on ascii files. The awk syntax is a bit involved, so we ll leave that for another time. Before we can run the script we need to make the file executable by typing: > chmod +x We then run the script by using: 4
5 >./script.sh The output is the list of files in that correspond to stations sorted with respect to the hypocenter. Copy this line. You also created a file called sta list.txt. If you want to check out it contents you can open it with Vi or run: > more sta list.txt Now we are going to read the list of files you ve just created. In in your sac window run these commands (don t enter the comments): #read in the files. By default, each read command writes over any previously stored files. > r the list of stations you ve just copied #turn off quick dirty plot >qdp off #plot the seismograms. The figure appears in a new window. Can you identify P and S arrivals? >p1 #enter sss mode to compute the predicted travel times >sss >prs orient landscape #compute travel times. write to header >traveltime picks 0 #plot new figure with trave time >prs ttime on #save the plot >bd sgf >prs ttime on #convert to postscript file. >sgftops./f001.sgf 1.ps #quit >quit To view the figure run: > gv 1.ps & Seismometers at short hypocentral distances clip when the ground motion exceeds the instrument s dynamic gain. For this reason we mainly use accelerometers to measure strong ground motions near large earthquakes. Let s see how these two types of instruments compare: >sac #read a broad-band channel and a accelerometer 5
6 >r / CI.ERR.BHZ.sac / NP.5062.HLZ.sac >qdp off #plot the traces >p # now zoom in at a window containing large motions to see the clipped wiggles >xlim >p #zoom out >xlim off >q 3 Spectral analysis In this section we would like to see how the amplitude of different frequencies decays with distance from the source. To do that we ll plot the spectra recorded at these three stations: BK.JCC, CI.MLAC and CI.CAR. First, you ll need to read the three components of each station and pick the P-and S-wave arrivals. Once you do that, you should write the files to disk. Here s an example >r./ / ci.mlac.bh?.sac >chnhdr T0 150 T1 200 # write new files to disk and quit > w MLAC.BHE.sac MLAC.BHN.sac MLAC.BHZ.sac I usually use xlim xmin xmax to zoom in and xlim off to zoom out. You can also use plotpk command for picking the phases. Read the three channels, and run plotpk, and help plotpktable to see how to use the manual picker. At this point you should have 9 new files in you current directory, with the P and S arrivals stored in the header variables T0 and T1 in each file. Next, we are going to create time windows around the S-arrivals, take the fft and plot: >cut T # note the use of * as wild card >r *.BHE.sac >chnhdr B 0 #remove trend >rtr #remove mean >rmean #take fft 6
7 >fft #turn on logarithmic scales >xlog ; ylog >qdp off >color on inc >p2 7
Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...
Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing
More informationCENG 334 Computer Networks. Laboratory I Linux Tutorial
CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction
More informationLecture 5. Essential skills for bioinformatics: Unix/Linux
Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular
More informationPractice of Seismic Analysis Code
IISEE Lecture Note 2007-2008 Practice of Seismic Analysis Code Waveforam stacking(sss) Determination of Mwp(macro) by Kenji Kanjo Kuninori Okamoto Mar.25.26.2008 2007-2008 International Institute of Seismology
More informationThe Unix Shell & Shell Scripts
The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose
More informationPhase picking, Blackboard Variables & Macros
Phase picking, Blackboard Variables & Macros Event Analysis Module: This module is used to pick seismic phases. An automatic phase picking algorithm can be applied using APK. Event Analysis Module: You
More informationEssentials for Scientific Computing: Bash Shell Scripting Day 3
Essentials for Scientific Computing: Bash Shell Scripting Day 3 Ershaad Ahamed TUE-CMS, JNCASR May 2012 1 Introduction In the previous sessions, you have been using basic commands in the shell. The bash
More informationLesson 1-2: The SAC data format
Lesson 1-2: The SAC data format i. Philosophy and structure ii. Converting to, within, and from SAC format Lesson 1-3: SAC processing philosophy SAC has a complete set of reliable and welltested processing
More informationBash Programming for Geophysicists
First NIGS workshop on Bash Programming for Geophysicists Abdolreza Ghods Institute of Advanced Studies in Basic Sciences, IASBS, Iran Version 1.0 June 2013 1 Why Bash Scripting? As geophysicists, we are
More informationChapter-3. Introduction to Unix: Fundamental Commands
Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system
More informationIntroduction to Unix: Fundamental Commands
Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating
More informationCSCI 211 UNIX Lab. Shell Programming. Dr. Jiang Li. Jiang Li, Ph.D. Department of Computer Science
CSCI 211 UNIX Lab Shell Programming Dr. Jiang Li Why Shell Scripting Saves a lot of typing A shell script can run many commands at once A shell script can repeatedly run commands Help avoid mistakes Once
More informationLOG ON TO LINUX AND LOG OFF
EXPNO:1A LOG ON TO LINUX AND LOG OFF AIM: To know how to logon to Linux and logoff. PROCEDURE: Logon: To logon to the Linux system, we have to enter the correct username and password details, when asked,
More informationTable of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs
Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing
More information5/8/2012. Exploring Utilities Chapter 5
Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More informationUnix as a Platform Exercises. Course Code: OS-01-UNXPLAT
Unix as a Platform Exercises Course Code: OS-01-UNXPLAT Working with Unix 1. Use the on-line manual page to determine the option for cat, which causes nonprintable characters to be displayed. Run the command
More informationShells and Shell Programming
Shells and Shell Programming 1 Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed
More informationIntroduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines
Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical
More informationOn successful completion of the course, the students will be able to attain CO: Experiment linked. 2 to 4. 5 to 8. 9 to 12.
CIE- 25 Marks Government of Karnataka Department of Technical Education Bengaluru Course Title: Linux Lab Scheme (L:T:P) : 0:2:4 Total Contact Hours: 78 Type of Course: Tutorial, Practical s & Student
More informationShells and Shell Programming
Shells and Shell Programming Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed
More information1. Open VirtualBox and start your linux VM. Boot the machine and log in with the user account you created in Lab #1. Open the Terminal application.
CIT 210L Name: Lab #2 1. Open VirtualBox and start your linux VM. Boot the machine and log in with the user account you created in Lab #1. Open the Terminal application. 2. Listing installed packages -
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationReview of Fundamentals
Review of Fundamentals 1 The shell vi General shell review 2 http://teaching.idallen.com/cst8207/14f/notes/120_shell_basics.html The shell is a program that is executed for us automatically when we log
More informationBasic SeismicHandler Introduction
Basic SeismicHandler Introduction Sebastian Rost October 2006 SeismicHandler (SH) is a tool for analyzing digital seismograms. It can be used for the analysis of earthquake records, as well as for examining
More informationWhen talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:
Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt
More informationWorking with Basic Linux. Daniel Balagué
Working with Basic Linux Daniel Balagué How Linux Works? Everything in Linux is either a file or a process. A process is an executing program identified with a PID number. It runs in short or long duration
More informationBasic Linux Command Line Interface Guide
This basic Linux Command-Line Interface (CLI) Guide provides a general explanation of commonly used Bash shell commands for the Barracuda NG Firewall. You can access the command-line interface by connecting
More information1 Data Portal Tutorial
Introduction EEG@UCSB 1 Data Portal Tutorial The EEG@UCSB web data-portal gives anyone access to sensor waveform data from our seismic monitoring stations. This is data primarily from accelerometers, seismometers
More informationUnix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT
Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking
More informationBasic Linux (Bash) Commands
Basic Linux (Bash) Commands Hint: Run commands in the emacs shell (emacs -nw, then M-x shell) instead of the terminal. It eases searching for and revising commands and navigating and copying-and-pasting
More informationUseful Unix Commands Cheat Sheet
Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List
More informationCS CS Tutorial 2 2 Winter 2018
CS CS 230 - Tutorial 2 2 Winter 2018 Sections 1. Unix Basics and connecting to CS environment 2. MIPS Introduction & CS230 Interface 3. Connecting Remotely If you haven t set up a CS environment password,
More informationCS 460 Linux Tutorial
CS 460 Linux Tutorial http://ryanstutorials.net/linuxtutorial/cheatsheet.php # Change directory to your home directory. # Remember, ~ means your home directory cd ~ # Check to see your current working
More informationbash Scripting Introduction COMP2101 Winter 2019
bash Scripting Introduction COMP2101 Winter 2019 Command Lists A command list is a list of one or more commands on a single command line in bash Putting more than one command on a line requires placement
More informationLinux shell & shell scripting - II
IBS 574 - Computational Biology & Bioinformatics Spring 2018, Tuesday (02/01), 2:00-4:00PM Linux shell & shell scripting - II Ashok R. Dinasarapu Ph.D Scientist, Bioinformatics Dept. of Human Genetics,
More informationCSE 391 Lecture 5. Intro to shell scripting
CSE 391 Lecture 5 Intro to shell scripting slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/391/ 1 2 Lecture summary basic script syntax and running
More information5/20/2007. Touring Essential Programs
Touring Essential Programs Employing fundamental utilities. Managing input and output. Using special characters in the command-line. Managing user environment. Surveying elements of a functioning system.
More informationA Big Step. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers
A Big Step Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers Copyright 2006 2009 Stewart Weiss What a shell really does Here is the scoop on shells. A shell is a program
More informationIntro to GMT Part 1. Beth Meyers Matt Herman
Intro to GMT Part 1 Beth Meyers Matt Herman By the end of of this tutorial you will be able to create the following figures: By the end of of this tutorial you will be able to create the following figures:
More informationBasic Linux Command Line Interface Guide
This basic Linux Command-Line Interface (CLI) Guide provides a general explanation of commonly used Bash shell commands for the Barracuda NG Firewall. You can access the command-line interface by connecting
More informationIntroduction to Linux Part 1. Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017
Introduction to Linux Part 1 Anita Orendt and Wim Cardoen Center for High Performance Computing 24 May 2017 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system kp001 kp002. kpxxx FastX
More informationShells & Shell Programming (Part B)
Shells & Shell Programming (Part B) Software Tools EECS2031 Winter 2018 Manos Papagelis Thanks to Karen Reid and Alan J Rosenthal for material in these slides CONTROL STATEMENTS 2 Control Statements Conditional
More informationUNIX, GNU/Linux and simple tools for data manipulation
UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka
More information2-1. i. The SAC command ii. Reading and wri,ng data iii. Plo1ng and windowing iv. Picking travel-,mes v. Header manipula,on
2-1 i. The SAC command ii. Reading and wri,ng data iii. Plo1ng and windowing iv. Picking travel-,mes v. Header manipula,on SAC commands SAC commands are single verbs (e.g., read, write) or compound words
More informationUNIX Shell Programming
$!... 5:13 $$ and $!... 5:13.profile File... 7:4 /etc/bashrc... 10:13 /etc/profile... 10:12 /etc/profile File... 7:5 ~/.bash_login... 10:15 ~/.bash_logout... 10:18 ~/.bash_profile... 10:14 ~/.bashrc...
More informationIntroduction to the shell Part II
Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationScripting. Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers
Scripting Shell Scripts, I/O Redirection, Ownership and Permission Concepts, and Binary Numbers Adapted from Practical Unix and Programming Hunter College Copyright 2006 2009 Stewart Weiss What a shell
More informationMore Raspian. An editor Configuration files Shell scripts Shell variables System admin
More Raspian An editor Configuration files Shell scripts Shell variables System admin Nano, a simple editor Nano does not require the mouse. You must use your keyboard to move around the file and make
More informationLinux Shell Script. J. K. Mandal
Linux Shell Script J. K. Mandal Professor, Department of Computer Science & Engineering, Faculty of Engineering, Technology & Management University of Kalyani Kalyani, Nadia, West Bengal E-mail: jkmandal@klyuniv.ac.in,
More informationReview of Fundamentals. Todd Kelley CST8207 Todd Kelley 1
Review of Fundamentals Todd Kelley kelleyt@algonquincollege.com CST8207 Todd Kelley 1 GPL the shell SSH (secure shell) the Course Linux Server RTFM vi general shell review 2 These notes are available on
More informationCOL100 Lab 2. I semester Week 2, Open the web-browser and visit the page and visit the COL100 course page.
COL100 Lab 2 I semester 2017-18 Week 2, 2017 Objective More familiarisation with Linux and its standard commands Part 1 1. Login to your system and open a terminal window. 2. Open the web-browser and visit
More informationUnix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University
Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )
More informationCSE 390a Lecture 5. Intro to shell scripting
CSE 390a Lecture 5 Intro to shell scripting slides created by Marty Stepp, modified by Jessica Miller & Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture summary basic script syntax and running
More informationShell Programming Overview
Overview Shell programming is a way of taking several command line instructions that you would use in a Unix command prompt and incorporating them into one program. There are many versions of Unix. Some
More informationCOMP 4/6262: Programming UNIX
COMP 4/6262: Programming UNIX Lecture 12 shells, shell programming: passing arguments, if, debug March 13, 2006 Outline shells shell programming passing arguments (KW Ch.7) exit status if (KW Ch.8) test
More informationLab #8: Introduction to UNIX and GMT
Geol 335.3 1 Lab #8: Introduction to UNIX and GMT In this lab, you ll familiarize yourself with some of the leading components of scientific computing: UNIX operating system, and a free, open-source, GIS/plotting
More informationCOMS 6100 Class Notes 3
COMS 6100 Class Notes 3 Daniel Solus September 1, 2016 1 General Remarks The class was split into two main sections. We finished our introduction to Linux commands by reviewing Linux commands I and II
More informationIntroduction: What is Unix?
Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix
More informationINd_rasN SOME SHELL SCRIPTING PROGRAMS. 1. Write a shell script to check whether the name passed as first argument is the name of a file or directory.
1. Write a shell script to check whether the name passed as rst argument is the name of a le or directory. Ans: #!/bin/bash if [ -f $1 ] echo "$1 is a le" echo "$1 is not a le" 2. Write a shell script
More information: the User (owner) for this file (your cruzid, when you do it) Position: directory flag. read Group.
CMPS 12L Introduction to Programming Lab Assignment 2 We have three goals in this assignment: to learn about file permissions in Unix, to get a basic introduction to the Andrew File System and it s directory
More informationCreating a Shell or Command Interperter Program CSCI411 Lab
Creating a Shell or Command Interperter Program CSCI411 Lab Adapted from Linux Kernel Projects by Gary Nutt and Operating Systems by Tannenbaum Exercise Goal: You will learn how to write a LINUX shell
More informationLinux Shell Scripting. Linux System Administration COMP2018 Summer 2017
Linux Shell Scripting Linux System Administration COMP2018 Summer 2017 What is Scripting? Commands can be given to a computer by entering them into a command interpreter program, commonly called a shell
More informationLinux shell programming for Raspberry Pi Users - 2
Linux shell programming for Raspberry Pi Users - 2 Sarwan Singh Assistant Director(S) NIELIT Chandigarh 1 SarwanSingh.com Education is the kindling of a flame, not the filling of a vessel. - Socrates SHELL
More informationScripting Languages Course 1. Diana Trandabăț
Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language
More informationReading and manipulating files
Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort
More informationUnix Introduction to UNIX
Unix Introduction to UNIX Get Started Introduction The UNIX operating system Set of programs that act as a link between the computer and the user. Developed in 1969 by a group of AT&T employees Various
More informationShell scripting and system variables. HORT Lecture 5 Instructor: Kranthi Varala
Shell scripting and system variables HORT 59000 Lecture 5 Instructor: Kranthi Varala Text editors Programs built to assist creation and manipulation of text files, typically scripts. nano : easy-to-learn,
More informationAn Introductory Tutorial on UNIX
An Introductory Tutorial on UNIX Kevin Keay February 6 2009 Introduction The purpose of this document is to guide you through the sequence of: 1. Describing a quick method of connecting to a remote UNIX
More informationCOMP2100/2500 Lecture 17: Shell Programming II
[ANU] [DCS] [COMP2100/2500] [Description] [Schedule] [Lectures] [Labs] [Homework] [Assignments] [COMP2500] [Assessment] [PSP] [Java] [Reading] [Help] COMP2100/2500 Lecture 17: Shell Programming II Summary
More informationIf you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC
If you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC sample). All examples use your Workshop directory (e.g. /Users/peggy/workshop)
More informationLab 3a Using the vi editor
Lab 3a Using the vi editor Objectives: Become familiar with the vi Editor Review the three vi Modes Review keystrokes to move between vi modes Create a new file with vi Editor Invoke vi with show mode
More information1Z Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions
1Z0-409 Oracle Linux Fundamentals (Oracle Partner Network) Exam Summary Syllabus Questions Table of Contents Introduction to 1Z0-409 Exam on Oracle Linux Fundamentals (Oracle Partner Network)... 2 Oracle
More informationBash scripting basics
Bash scripting basics prepared by Anatoliy Antonov for ESSReS community September 2012 1 Outline Definitions Foundations Flow control References and exercises 2 Definitions 3 Definitions Script - [small]
More informationPractical 02. Bash & shell scripting
Practical 02 Bash & shell scripting 1 imac lab login: maclab password: 10khem 1.use the Finder to visually browse the file system (single click opens) 2.find the /Applications folder 3.open the Utilities
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationEssential Linux Shell Commands
Essential Linux Shell Commands Special Characters Quoting and Escaping Change Directory Show Current Directory List Directory Contents Working with Files Working with Directories Special Characters There
More informationVi & Shell Scripting
Vi & Shell Scripting Comp-206 : Introduction to Week 3 Joseph Vybihal Computer Science McGill University Announcements Sina Meraji's office hours Trottier 3rd floor open area Tuesday 1:30 2:30 PM Thursday
More informationUnix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois
Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No
More informationBash Programming. Student Workbook
Student Workbook Bash Programming Published by ITCourseware, LLC, 7245 South Havana Street, Suite 100, Englewood, CO 80112 Contributing Authors: Julie Johnson, Rob Roselius Editor: Jeff Howell Special
More information9.2 Linux Essentials Exam Objectives
9.2 Linux Essentials Exam Objectives This chapter will cover the topics for the following Linux Essentials exam objectives: Topic 3: The Power of the Command Line (weight: 10) 3.3: Turning Commands into
More informationhttp://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT
More informationThe Shell. EOAS Software Carpentry Workshop. September 20th, 2016
The Shell EOAS Software Carpentry Workshop September 20th, 2016 Getting Started You need to download some files to follow this lesson. These files are found on the shell lesson website (see etherpad) 1.
More informationOperating System Interaction via bash
Operating System Interaction via bash bash, or the Bourne-Again Shell, is a popular operating system shell that is used by many platforms bash uses the command line interaction style generally accepted
More informationUsing LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12)
Using LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12) Objective: Learn some basic aspects of the UNIX operating system and how to use it. What is UNIX? UNIX is the operating system used by most computers
More informationTopic 2: More Shell Skills. Sub-Topic 1: Quoting. Sub-Topic 2: Shell Variables. Difference Between Single & Double Quotes
Topic 2: More Shell Skills Sub-Topic 1: Quoting Sub-topics: 1 quoting 2 shell variables 3 sub-shells 4 simple shell scripts (no ifs or loops yet) 5 bash initialization files 6 I/O redirection & pipes 7
More informationPractical Session 0 Introduction to Linux
School of Computer Science and Software Engineering Clayton Campus, Monash University CSE2303 and CSE2304 Semester I, 2001 Practical Session 0 Introduction to Linux Novell accounts. Every Monash student
More informationCS 25200: Systems Programming. Lecture 11: *nix Commands and Shell Internals
CS 25200: Systems Programming Lecture 11: *nix Commands and Shell Internals Dr. Jef Turkstra 2018 Dr. Jeffrey A. Turkstra 1 Lecture 11 Shell commands Basic shell internals 2018 Dr. Jeffrey A. Turkstra
More informationUnix System Architecture, File System, and Shell Commands
Unix System Architecture, File System, and Shell Commands Prof. (Dr.) K.R. Chowdhary, Director COE Email: kr.chowdhary@iitj.ac.in webpage: http://www.krchowdhary.com JIET College of Engineering August
More informationScripting. More Shell Scripts. Adapted from Practical Unix and Programming Hunter College
Scripting More Shell Scripts Adapted from Practical Unix and Programming Hunter College Copyright 2006 2009 Stewart Weiss Back to shell scripts Now that you've learned a few commands and can edit files,
More informationExercise sheet 1 To be corrected in tutorials in the week from 23/10/2017 to 27/10/2017
Einführung in die Programmierung für Physiker WS 207/208 Marc Wagner Francesca Cuteri: cuteri@th.physik.uni-frankfurt.de Alessandro Sciarra: sciarra@th.physik.uni-frankfurt.de Exercise sheet To be corrected
More informationEssential Unix and Linux! Perl for Bioinformatics, ! F. Pineda
Essential Unix and Linux! Perl for Bioinformatics, 140.636! F. Pineda Generic computer architecture Memory Storage Fig. 1.2 From Designing Embedded Hardware, 2 nd Ed. by John Catsoulis OS concepts Shell
More information28-Nov CSCI 2132 Software Development Lecture 33: Shell Scripting. 26 Shell Scripting. Faculty of Computer Science, Dalhousie University
Lecture 33 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 33: Shell Scripting 28-Nov-2018 Location: Chemistry 125 Time: 12:35 13:25 Instructor: Vla Keselj
More informationAppendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc.
Appendix B WORKSHOP SYS-ED/ Computer Education Techniques, Inc. 1 Introduction There are no workshops for this chapter. The instructor will provide demonstrations and examples. SYS-ED/COMPUTER EDUCATION
More informationGrep and Shell Programming
Grep and Shell Programming Comp-206 : Introduction to Software Systems Lecture 7 Alexandre Denault Computer Science McGill University Fall 2006 Teacher's Assistants Michael Hawker Monday, 14h30 to 16h30
More informationLab 4: Bash Scripting
Lab 4: Bash Scripting February 20, 2018 Introduction This lab will give you some experience writing bash scripts. You will need to sign in to https://git-classes. mst.edu and git clone the repository for
More informationIntroduction to the UNIX command line
Introduction to the UNIX command line Steven Abreu Introduction to Computer Science (ICS) Tutorial Jacobs University s.abreu@jacobs-university.de September 19, 2017 Overview What is UNIX? UNIX Shell Commands
More informationChapter 9. Shell and Kernel
Chapter 9 Linux Shell 1 Shell and Kernel Shell and desktop enviroment provide user interface 2 1 Shell Shell is a Unix term for the interactive user interface with an operating system A shell usually implies
More information