Algorithmic Approaches for Biological Data, Lecture #7
|
|
|
- Gary Tucker
- 5 years ago
- Views:
Transcription
1 Algorithmic Approaches for Biological Data, Lecture #7 Katherine St. John City University of New York American Museum of Natural History 10 February 2016
2 Outline Patterns in Strings Recap: Files in and not in String methods: find() and count() Regular Expressions K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
3 Files Commands Opening a file: K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
4 Files Commands Opening a file: infile = open( data.txt, r ) K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
5 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
6 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
7 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
8 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
9 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. infile.readlines(): read the file into a list of strings. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
10 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. infile.readlines(): read the file into a list of strings. Closing a file: K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
11 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. infile.readlines(): read the file into a list of strings. Closing a file: infile.close() Writing to a file: K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
12 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. infile.readlines(): read the file into a list of strings. Closing a file: infile.close() Writing to a file: outfile.write(s) K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
13 Files Commands Opening a file: infile = open( data.txt, r ) outfile = open( log.txt, w ) Reading from a file: infile.read(): reads the entire file into a single string. infile.readline(): read the next line of the file. infile.readlines(): read the file into a list of strings. Closing a file: infile.close() Writing to a file: outfile.write(s) K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
14 Recap Write a program will double space a file. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
15 Recap Write a program will double space a file. f = open( first.txt, r ) data = f.read().replace( \n, \n\n ) print data f.close() K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
16 Recap Write a program will double space a file. f = open( first.txt, r ) data = f.read().replace( \n, \n\n ) print data f.close() Write a program that asks the user for a input and output file. Your program should copy the contents of the input file to the output and number the lines. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
17 Recap Write a program will double space a file. f = open( first.txt, r ) data = f.read().replace( \n, \n\n ) print data f.close() Write a program that asks the user for a input and output file. Your program should copy the contents of the input file to the output and number the lines. inname = raw input( Please enter input file: ) outname = raw input( Please enter output file: ) infile = open(inname, r ) outfile = open(outname, w ) lines = infile.readlines() for i in len(lines): print i+ :\t +lines[i], infile.close() outfile.close() K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
18 Recap Write a program will double space a file. f = open( first.txt, r ) data = f.read().replace( \n, \n\n ) print data f.close() Write a program that asks the user for a input and output file. Your program should copy the contents of the input file to the output and number the lines. inname = raw input( Please enter input file: ) outname = raw input( Please enter output file: ) infile = open(inname, r ) outfile = open(outname, w ) lines = infile.readlines() for i in len(lines): print i+ :\t +lines[i], infile.close() outfile.close() Write a program that takes as input a FASTA file and prints out the number of sequences in the file. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
19 Recap Write a program will double space a file. f = open( first.txt, r ) data = f.read().replace( \n, \n\n ) print data f.close() Write a program that asks the user for a input and output file. Your program should copy the contents of the input file to the output and number the lines. inname = raw input( Please enter input file: ) outname = raw input( Please enter output file: ) infile = open(inname, r ) outfile = open(outname, w ) lines = infile.readlines() for i in len(lines): print i+ :\t +lines[i], infile.close() outfile.close() Write a program that takes as input a FASTA file and prints out the number of sequences in the file. f = open( fasta.txt, r ) count = f.read().count( > ) print count f.close() K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
20 in and not in Another useful string method: in K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
21 in and not in Another useful string method: in Tests if a string is part of another. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
22 in and not in Another useful string method: in Tests if a string is part of another. e.g. if d in teddy : K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
23 in and not in Another useful string method: in Tests if a string is part of another. e.g. if d in teddy : Also not in K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
24 in and not in Another useful string method: in Tests if a string is part of another. e.g. if d in teddy : Also not in e.g. if a not in roosevelt : K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
25 in and not in Another useful string method: in Tests if a string is part of another. e.g. if d in teddy : Also not in e.g. if a not in roosevelt : Text book demo K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
26 String methods: find() and count() Very useful string methods. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
27 String methods: find() and count() Very useful string methods. Can find and count exact matches. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
28 String methods: find() and count() Very useful string methods. Can find and count exact matches. e.g. dna.find( TA ) or strand.count( AUG ). K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
29 String methods: find() and count() Very useful string methods. Can find and count exact matches. e.g. dna.find( TA ) or strand.count( AUG ). Harder to use for approximate matches or patterns with varying lengths. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
30 String methods: find() and count() Very useful string methods. Can find and count exact matches. e.g. dna.find( TA ) or strand.count( AUG ). Harder to use for approximate matches or patterns with varying lengths. e.g. many motifs or any number of TA: TA, TATA, TATATA K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
31 Finding Patterns Short-hand for writing down patterns: GET, NET, and SET all end in -ET. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
32 Finding Patterns Short-hand for writing down patterns: GET, NET, and SET all end in -ET. The pattern is [GNS]ET K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
33 Finding Patterns Short-hand for writing down patterns: GET, NET, and SET all end in -ET. The pattern is [GNS]ET [GNS] matches one letter of G, N, or S. The match must end in ET. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
34 Finding Patterns Short-hand for writing down patterns: GET, NET, and SET all end in -ET. The pattern is [GNS]ET [GNS] matches one letter of G, N, or S. The match must end in ET. Example of a regular expression. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
35 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
36 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
37 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
38 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
39 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.. matches any character K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
40 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.. matches any character ah+ matches ah, ahh, ahhh, ahhhh,... K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
41 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.. matches any character ah+ matches ah, ahh, ahhh, ahhhh,... ah* matches a, ah, ahh, ahhh, ahhhh,... K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
42 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.. matches any character ah+ matches ah, ahh, ahhh, ahhhh,... ah* matches a, ah, ahh, ahhh, ahhhh,... (Ha)+ matches Ha, HaHa, HaHaHa,... K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
![More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.](/docs-images/85/92264439/images/43-0.jpg ". matches any character ah+ matches ah, ahh, ahhh, ahhhh,... ah* matches a, ah, ahh, ahhh, ahhhh,... (Ha)+ matches Ha, HaHa, HaHaHa,... (Ha){3,5} matches HaHaHa, HaHaHaHa, HaHaHaHaHa. K. St.")
43 More Patterns Some ways to write patterns: [a-z] matches all lower case letters. [0-1][0-9] matches all two digit numbers 00 to 19. Alternatively [0-1]\d [0-9A-Fa-f] matches any hexadecimal digit.. matches any character ah+ matches ah, ahh, ahhh, ahhhh,... ah* matches a, ah, ahh, ahhh, ahhhh,... (Ha)+ matches Ha, HaHa, HaHaHa,... (Ha){3,5} matches HaHaHa, HaHaHaHa, HaHaHaHaHa. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
44 Biomolecular Sequence Challenges (wiki) Many interesting patterns in biomolecular sequences Codons (3 letter sequences) correspond to amino acids. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
45 Biomolecular Sequence Challenges (wiki) Many interesting patterns in biomolecular sequences Codons (3 letter sequences) correspond to amino acids. Open reading frames (ORF) can potentially code for a protein: start codon codon, codon,..., codon, codon stop codon (ATG) (TAA, TAG, or TGA) K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
46 Group Work In pairs/triples: Fill in the table: K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
47 Group Work In pairs/triples: Fill in the table: Regular Expression [ACGT]* [AT]+ Description of Matching Strings A DNA sequence any string consisting only of A, C, G, and T A RNA sequence any string consisting only of A, C, G, and U ATG[ATGC]{30,1000}A{5,10} A DNA sequence that exactly breaks into codons (3-letter sequences). An open reading frame (ORF): a sequence that starts with the start codon ATG, followed by any number of codons, and ending with a stop codon (TAA, TAG, or TGA). K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
48 Recap Grand Prismatic Spring (amnh) Lab at 3pm. K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
49 Recap Grand Prismatic Spring (amnh) Lab at 3pm. lab reports to K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
50 Recap Grand Prismatic Spring (amnh) Lab at 3pm. lab reports to Challenges available at rosalind.info K. St. John (CUNY & AMNH) Algorithms #7 10 February / 11
Algorithmic Approaches for Biological Data, Lecture #8
Algorithmic Approaches for Biological Data, Lecture #8 Katherine St. John City University of New York American Museum of Natural History 17 February 2016 Outline More on Pattern Finding: Regular Expressions
Algorithmic Approaches for Biological Data, Lecture #20
Algorithmic Approaches for Biological Data, Lecture #20 Katherine St. John City University of New York American Museum of Natural History 20 April 2016 Outline Aligning with Gaps and Substitution Matrices
Algorithmic Approaches for Biological Data, Lecture #15
Algorithmic Approaches for Biological Data, Lecture #15 Katherine St. John City University of New York American Museum of Natural History 23 March 2016 Outline Sorting by Keys K. St. John (CUNY & AMNH)
Algorithmic Approaches for Biological Data, Lecture #1
Algorithmic Approaches for Biological Data, Lecture #1 Katherine St. John City University of New York American Museum of Natural History 20 January 2016 Outline Course Overview Introduction to Python Programs:
Files. CSE 1310 Introduction to Computers and Programming Vassilis Athitsos University of Texas at Arlington
Files CSE 1310 Introduction to Computers and Programming Vassilis Athitsos University of Texas at Arlington 1 The Need for Files Suppose that we have to write a program that: takes a book (or a set of
Python Programming: An Introduction to Computer Science
Python Programming: An Introduction to Computer Science Chapter 4 (End of Chapter) File IO Coming up: File Processing 1 File Processing! The process of opening a file involves associating a file on disk
File Processing. CS 112: Introduction to Programming: File Processing Sequence. File Processing. File IO
File Processing CS 112: Introduction to Programming: File IO Coming up: File Processing 1 File Processing Sequence 1. Open the file 2. Read from the file 3. Close the file In some cases, not properly closing
Programming Applications. What is Computer Programming?
Programming Applications What is Computer Programming? An algorithm is a series of steps for solving a problem A programming language is a way to express our algorithm to a computer Programming is the
ECS Baruch Lab 9 Spring 2019 Name
ECS 102 - Baruch Lab 9 Spring 2019 Name I. Reading input files A. infile.read() Copy the file exploreinputfiles.txt from the webpage, change to.py. Run it. I hope you got an error FileNotFoundError: [Errno
Chapter 6: Files and Exceptions. COSC 1436, Summer 2016 Dr. Ling Zhang 06/23/2016
Chapter 6: Files and Exceptions COSC 1436, Summer 2016 Dr. Ling Zhang 06/23/2016 Introduction to File Input and Output Concept: When a program needs to save data for later use, it writes the data in a
File I/O in Python Formats for Outputs CS 8: Introduction to Computer Science, Winter 2018 Lecture #12
File I/O in Python Formats for Outputs CS 8: Introduction to Computer Science, Winter 2018 Lecture #12 Ziad Matni Dept. of Computer Science, UCSB Administrative Homework #7 is DUE on MONDAY (3/12) Lab
Introduction to Computer Programming for Non-Majors
Introduction to Computer Programming for Non-Majors CSC 2301, Fall 2015 Chapter 5 Part 3 & Review The Department of Computer Science Multi-Line Strings Files: Multi-line Strings A file is a sequence of
Introduction to Computer Programming for Non-Majors
Introduction to Computer Programming for Non-Majors CSC 2301, Fall 2014 Chapter 5 Part 3 & Review The Department of Computer Science Multi-Line Strings -2-1 Files: Multi-line Strings A file is a sequence
Chapter 6: Files and Exceptions. COSC 1436, Spring 2017 Hong Sun 3/6/2017
Chapter 6: Files and Exceptions COSC 1436, Spring 2017 Hong Sun 3/6/2017 Function Review: A major purpose of functions is to group code that gets executed multiple times. Without a function defined, you
PROGRAMMING, DATA STRUCTURES AND ALGORITHMS IN PYTHON
NPTEL MOOC PROGRAMMING, DATA STRUCTURES AND ALGORITHMS IN PYTHON Week 5, Lecture 3 Madhavan Mukund, Chennai Mathematical Institute http://www.cmi.ac.in/~madhavan Dealing with files Standard input and output
Finding Selection in All the Right Places TA Notes and Key Lab 9
Objectives: Finding Selection in All the Right Places TA Notes and Key Lab 9 1. Use published genome data to look for evidence of selection in individual genes. 2. Understand the need for DNA sequence
BCH339N Systems Biology/Bioinformatics Spring 2018 Marcotte A Python programming primer
BCH339N Systems Biology/Bioinformatics Spring 2018 Marcotte A Python programming primer Python: named after Monty Python s Flying Circus (designed to be fun to use) Python documentation: http://www.python.org/doc/
Lecture 2, Introduction to Python. Python Programming Language
BINF 3360, Introduction to Computational Biology Lecture 2, Introduction to Python Young-Rae Cho Associate Professor Department of Computer Science Baylor University Python Programming Language Script
File processing and decision structures
File processing and decision structures Michael Mandel Lecture 4 Methods in Computational Linguistics I The City University of New York, Graduate Center https://github.com/ling78100/lectureexamples/blob/master/lecture04final.ipynb
Outline. gzip and gunzip data compression archiving files and pipes in Unix. format conversions encrypting text
Outline 1 Compressing Files gzip and gunzip data compression archiving files and pipes in Unix 2 File Methods in Python format conversions encrypting text 3 Using Buffers counting and replacing words using
INTRODUCTION TO BIOINFORMATICS
Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
Lab 11. A sample of the class is:
Lab 11 Lesson 11-2: Exercise 1 Exercise 2 A sample of the class is: public class List // Methods public void store(int item) values[length] = item; length++; public void printlist() // Post: If the list
INTRODUCTION TO BIOINFORMATICS
Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
Files. Reading from a file
Files We often need to read data from files and write data to files within a Python program. The most common type of files you'll encounter in computational biology, are text files. Text files contain
Uploading sequences to GenBank
A primer for practical phylogenetic data gathering. Uconn EEB3899-007. Spring 2015 Session 5 Uploading sequences to GenBank Rafael Medina (rafael.medina.bry@gmail.com) Yang Liu (yang.liu@uconn.edu) confirmation
Overview.
Overview day one 0. getting set up 1. text output and manipulation day two 2. reading and writing files 3. lists and loops day three 4. writing functions 5. conditional statements day four today day six
Welcome to. Python 2. Session #5. Michael Purcaro, Chris MacKay, Nick Hathaway, and the GSBS Bootstrappers February 2014
Welcome to Python 2 Session #5 Michael Purcaro, Chris MacKay, Nick Hathaway, and the GSBS Bootstrappers February 2014 michael.purcaro@umassmed.edu 1 Building Blocks: modules To more easily reuse code,
Übung: Breakdown of sequence homology
Übung: Breakdown of sequence homology WS 2008/09 Übung zu Anwendungen der Strukturanalyse 4-Feb-09 1. Addresses... 1 2. Gathering sequences... 1 2.1. Collection of your PDB sequence... 1 2.2. Your random
Introduction Programming Using Python Lecture 8. Dr. Zhang COSC 1437 Fall 2017 Nov 30, 2017
Introduction Programming Using Python Lecture 8 Dr. Zhang COSC 1437 Fall 2017 Nov 30, 2017 Chapter 12 Inheritance and Class Design Review Suppose you will define classes to model circles, rectangles, and
Electronically Filed - City of St. Louis - May 27, :02 PM
Electronically Filed - City of St. Louis - May 27, 2014-03:02 PM Electronically Filed - City of St. Louis - May 27, 2014-03:02 PM Electronically Filed - City of St. Louis - May 27, 2014-03:02 PM Electronically
Principles of Computer Science I
Principles of Computer Science I Prof. Nadeem Abdul Hamid CSC 120A - Fall 2004 Lecture Unit 7 Review Chapter 4 Boolean data type and operators (&&,,) Selection control flow structure if, if-else, nested
Introduction to programming using Python
Introduction to programming using Python Matthieu Choplin matthieu.choplin@city.ac.uk http://moodle.city.ac.uk/ Session 6-2 1 Objectives To open a file, read/write data from/to a file To use file dialogs
Tutorial 4 BLAST Searching the CHO Genome
Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar
A Python programming primer for biochemists. BCH364C/394P Systems Biology/Bioinformatics Edward Marcotte, Univ of Texas at Austin
A Python programming primer for biochemists (Named after Monty Python s Flying Circus& designed to be fun to use) BCH364C/394P Systems Biology/Bioinformatics Edward Marcotte, Univ of Texas at Austin Science
Answer Key: CMP 167 Final Exam, Version 4, Spring 2015
CMP 167 Final Exam, Version 4, Spring 2015 1. What will the following code print: s = "List (Processing (John (McCarthy" a = s[0:3] print(a.lower()) names = s.split(" (") print(names) b = names[1] c =
CSI33 Data Structures
Outline Department of Mathematics and Computer Science Bronx Community College October 2, 2017 Outline Outline 1 Chapter 5: Stacks and Outline Chapter 5: Stacks and 1 Chapter 5: Stacks and Chapter 5: Stacks
Answer Key: CIS 166 Final Exam, Version 3, Spring 2015
CIS 166 Final Exam, Version 3, Spring 2015 1. What will the following code print: s = "haskell::curry::utrecht::glasgow" a = s[0:3] print(a.upper()) names = s.split("::") print(names) b,c,d = names[1],names[2],names[3]
Spring 2011 PROGRAMMING ASSIGNMENT Encrypted Message Program Due Tuesday, May 17th
COSC 175 Spring 2011 PROGRAMMING ASSIGNMENT Encrypted Message Program Due Tuesday, May 17th Dierbach For this programming assignment, you are to develop a Python program that can both encrypt a message
MLiB - Mandatory Project 2. Gene finding using HMMs
MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
W13:Homework:H08. CS40 Foundations of Computer Science W13. From 40wiki
W13:Homework:H08 From 40wiki CS40 Foundations of Computer Science W13 W13:Exams W13:Homework in Class and Web Work W13:Calendar W13:Syllabus and Lecture Notes UCSB-CS40-W13 on Facebook (https://www.facebook.com/groups/ucsb.cs40.w13/)
Lecture 3 The character, string data Types Files
Lecture 3 The character, string data Types Files The smallest integral data type Used for single characters: letters, digits, and special symbols Each character is enclosed in single quotes 'A', 'a', '0',
What is the minimum number of letters that could have been changed?
Homework 4, CSE 232 Due September 24 Note: On most of the problem sets through the semester, I ll put a horizontal line with Optional under it. Any problems below this section are encouraged - I think
24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:
24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid
Sequence alignment theory and applications Session 3: BLAST algorithm
Sequence alignment theory and applications Session 3: BLAST algorithm Introduction to Bioinformatics online course : IBT Sonal Henson Learning Objectives Understand the principles of the BLAST algorithm
: Intro Programming for Scientists and Engineers Assignment 3: Molecular Biology
Assignment 3: Molecular Biology Page 1 600.112: Intro Programming for Scientists and Engineers Assignment 3: Molecular Biology Peter H. Fröhlich phf@cs.jhu.edu Joanne Selinski joanne@cs.jhu.edu Due Dates:
Summary of chapters 1-5 (part 1)
Summary of chapters 1-5 (part 1) Ole Christian Lingjærde, Dept of Informatics, UiO 6 October 2017 Today s agenda Exercise A.14, 5.14 Quiz Hint: Section A.1.8 explains how this task can be solved for the
3. Open Vector NTI 9 (note 2) from desktop. A three pane window appears.
SOP: SP043.. Recombinant Plasmid Map Design Vector NTI Materials and Reagents: 1. Dell Dimension XPS T450 Room C210 2. Vector NTI 9 application, on desktop 3. Tuberculist database open in Internet Explorer
Reading data from a file. INF1100 Lectures, Chapter 6: Files, Strings, and Dictionaries. Example: reading a file with numbers (part 1)
5mm. Reading data from a file INF1100 Lectures, Chapter 6: Files, Strings, and Dictionaries Hans Petter Langtangen Simula Research Laboratory University of Oslo, Dept. of Informatics A file is a sequence
DM536 Programming A. Peter Schneider-Kamp.
DM536 Programming A Peter Schneider-Kamp petersk@imada.sdu.dk! http://imada.sdu.dk/~petersk/dm536/! PROJECT PART 1 2 Organizational Details 2 possible projects, each consisting of 2 parts for 1 st part,
Computational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
University of Utah School of Computing
University of Utah School of Computing CS 4960 Project #2 Spring 2016 Due Feb 16, 2016 at the start of class Please contact the instructor Bei beiwang@sci.utah.edu) or TA Vikram at vikram.raj@utah.edu)
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
Managing Your Biological Data with Python
Chapman & Hall/CRC Mathematical and Computational Biology Series Managing Your Biological Data with Python Ailegra Via Kristian Rother Anna Tramontano CRC Press Taylor & Francis Group Boca Raton London
Here is a hierarchy of classes to deal with Input and Output streams.
PART 25 25. Files and I/O 25.1 Reading and Writing Files A stream can be defined as a sequence of data. The InputStream is used to read data from a source and the OutputStream is used for writing data
UNCA CSCI 255 Exam 1 Spring February, This is a closed book and closed notes exam. It is to be turned in by 1:45 PM.
UNCA CSCI 255 Exam 1 Spring 2017 27 February, 2017 This is a closed book and closed notes exam. It is to be turned in by 1:45 PM. Communication with anyone other than the instructor is not allowed during
Massachusetts Institute of Technology. Problem Set 2 Solutions
Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science Department of Mechanical Engineering 6.050J/2.110J Information and Entropy Spring 2004 Problem Set 2 Solutions
Reading and writing files. V. Orgogozo Jan
Reading and writing files V. Orgogozo Jan 6 2012 Our goal today : transform a text file into a Google Earth.kml file Dive Date Lat Lon Depth Notes Tiburon 596 19-Jul-03 36 36.12 N 122 22.48 W 1190 holotype
Chapter 5: Loops and Files
Chapter 5: Loops and Files 5.1 The Increment and Decrement Operators The Increment and Decrement Operators ++ is the increment operator. It adds one to a variable. val++; is the same as val = val + 1;
Lecture 5 Advanced BLAST
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 5 Advanced BLAST BLAST Recap Sequence Alignment Complexity and indexing BLASTN and BLASTP Basic parameters
ASSIGNMENT 4. COMP-202, Summer 2017, All Sections. Due: Friday, June 16 th, 11:59pm
ASSIGNMENT 4 COMP-202, Summer 2017, All Sections Due: Friday, June 16 th, 11:59pm Please read the entire PDF before starting. You must do this assignment individually. Question 1: 100 points 100 points
Chapter 5: Prefix vs. Postfix 8/19/2018. The Increment and Decrement Operators. Increment and Decrement Operators in Program 5-1
Chapter 5: Loops and Files The Increment and Decrement Operators ++ is the increment operator. It adds one to a variable. val++; is the same as val = val + 1; ++ can be used before (prefix) or after (postfix)
6.00 Introduction to Computer Science and Programming Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.00 Introduction to Computer Science and Programming Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher
Glimmer Release Notes Version 3.01 (Beta) Arthur L. Delcher 10 October 2005 1 Introduction This document describes Version 3 of the Glimmer gene-finding software. This version incorporates a nearly complete
Database Searching Using BLAST
Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain
Level 3 Computing Year 2 Lecturer: Phil Smith
Level 3 Computing Year 2 Lecturer: Phil Smith We looked at: Previously Reading and writing files. BTEC Level 3 Year 2 Unit 16 Procedural programming Now Now we will look at: Appending data to existing
Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.
Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the
DM536 Introduction to Programming. Peter Schneider-Kamp.
DM536 Introduction to Programming Peter Schneider-Kamp petersk@imada.sdu.dk! http://imada.sdu.dk/~petersk/dm536/! Python & Linux Install Party next week (Tuesday 14-17) NEW Fredagsbar ( Nedenunder ) Participants
Text Data, File I/O, and Exceptions
Text Data, File I/O, and Exceptions Strings, revisited Formatted output File Input/Output Errors and Exceptions String representations Introduction to Computing Using Python A string value is represented
Constrained Sequence Alignment
Western Washington University Western CEDAR WWU Honors Program Senior Projects WWU Graduate and Undergraduate Scholarship 12-5-2017 Constrained Sequence Alignment Kyle Daling Western Washington University
Unix, Perl and BioPerl
Unix, Perl and BioPerl III: Sequence Analysis with Perl - Modules and BioPerl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence analysis with Perl Modules and BioPerl Regular expressions
Bio3D: Interactive Tools for Structural Bioinformatics.
Bio3D: Interactive Tools for Structural Bioinformatics http://thegrantlab.org/bio3d/ What is Bio3D A freely distributed and widely used R package for structural bioinformatics. Provides a large number
Page 1.1 Guidelines 2 Requirements JCoDA package Input file formats License. 1.2 Java Installation 3-4 Not required in all cases
JCoDA and PGI Tutorial Version 1.0 Date 03/16/2010 Page 1.1 Guidelines 2 Requirements JCoDA package Input file formats License 1.2 Java Installation 3-4 Not required in all cases 2.1 dn/ds calculation
Overview.
Overview day one 0. getting set up 1. text output and manipulation day two 2. reading and writing files 3. lists and loops today 4. writing functions 5. conditional statements day four day five day six
Sequence analysis with Perl Modules and BioPerl. Unix, Perl and BioPerl. Regular expressions. Objectives. Some uses of regular expressions
Unix, Perl and BioPerl III: Sequence Analysis with Perl - Modules and BioPerl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence analysis with Perl Modules and BioPerl Regular expressions
Unit 2: Boolean Logic
AP Computer Science Mr. Haytock Unit 2: Boolean Logic Topics: I. Syllogisms and propositional logic II. Logical operators III. Constructing truth tables IV. Laws of Boolean algebra V. Boolean operations
The Lattice BOINC Project Public Computing for the Tree of Life
The Lattice BOINC Project Public Computing for the Tree of Life Presented by Adam Bazinet Center for Bioinformatics and Computational Biology Institute for Advanced Computer Studies University of Maryland
File Practice Problems
1) Write a method reads in from two files and writes them, alternating lines, to an output file. The three file names should be passed into the method as Strings, and then method should NOT thrown any
Designing Loops and General Debug Pre-Defined Functions in C++ CS 16: Solving Problems with Computers I Lecture #6
Designing Loops and General Debug Pre-Defined Functions in C++ CS 16: Solving Problems with Computers I Lecture #6 Ziad Matni Dept. of Computer Science, UCSB Announcements Homework #5 due today Lab #3
(DNA#): Molecular Biology Computation Language Proposal
(DNA#): Molecular Biology Computation Language Proposal Aalhad Patankar, Min Fan, Nan Yu, Oriana Fuentes, Stan Peceny {ap3536, mf3084, ny2263, oif2102, skp2140} @columbia.edu Motivation Inspired by the
Special course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 8: Multiple alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
Scientific Computing: Lecture 3
Scientific Computing: Lecture 3 Functions Random Numbers More I/O Practice Exercises CLASS NOTES Ò You should be finishing Chap. 2 this week. Ò HW00 due by midnight Friday into the Box folder Ò You should
Topics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
Answer Key: CIS 166 Final Exam, Version 1, Spring 2015
CIS 166 Final Exam, Version 1, Spring 2015 1. What will the following code print: s = "Ada=>Lovelace=>Charles=>Babbage" a = s[0:3] print(a.upper()) names = s.split("=>") print(names) b,c,d = names[1],names[2],names[3]
BLAST - Basic Local Alignment Search Tool
Lecture for ic Bioinformatics (DD2450) April 11, 2013 Searching 1. Input: Query Sequence 2. Database of sequences 3. Subject Sequence(s) 4. Output: High Segment Pairs (HSPs) Sequence Similarity Measures:
DNASIS MAX V2.0. Tutorial Booklet
Sequence Analysis Software DNASIS MAX V2.0 Tutorial Booklet CONTENTS Introduction...2 1. DNASIS MAX...5 1-1: Protein Translation & Function...5 1-2: Nucleic Acid Alignments(BLAST Search)...10 1-3: Vector
Module 4 Python and Regular Expressions. What is Python?
Module 4 Python and Regular Expressions Module 4 contains only an individual assignment Due Monday Feb 26 th Do not wait until the last minute to start on this module Read the WIKI before starting along
This exam has 10 pages including the title page. Please check to make sure all pages are included.
CS1301 - Exam3 Name: Section or Grading TA: Instructions: Please write clearly. What I cannot read, I will not grade. Show all your work in detail. I give partial credit. This exam has 10 pages including
Previously. Iteration. Date and time structures. Modularisation.
2017 2018 Previously Iteration. Date and time structures. Modularisation. Today File handling. Reading and writing files. In order for a program to work with a file, the program must create a file object
Lecture 5: Markov models
Master s course Bioinformatics Data Analysis and Tools Lecture 5: Markov models Centre for Integrative Bioinformatics Problem in biology Data and patterns are often not clear cut When we want to make a
Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
A CAM(Content Addressable Memory)-based architecture for molecular sequence matching
A CAM(Content Addressable Memory)-based architecture for molecular sequence matching P.K. Lala 1 and J.P. Parkerson 2 1 Department Electrical Engineering, Texas A&M University, Texarkana, Texas, USA 2
NGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
SYLLABUS BIOLOGY 1107: Principles of Biology I Fall Semester Section 001: (9:05-9:55AM, Mon, Wed and Fri) Bldg.: Laurel Hall, Room 102
SYLLABUS BIOLOGY 1107: Principles of Biology I Fall Semester 2016 Section 001: (9:05-9:55AM, Mon, Wed and Fri) Bldg.: Laurel Hall, Room 102 Section 020: (10:10-11:00AM, Mon, Wed and Fri) Bldg.: Laurel
Counting: Basics. A simple counting problem. Counting: the product rule. Relation to Cartesian products. Relation to Cartesian products
A simple counting problem Counting: Basics Possible answers: 6 x 10 6 + 10 Rosen, Chapter 6.1 Counting: the product rule If there are n1 ways of doing one task, and for each of those there are n2 ways
File Input/Output. Learning Outcomes 10/8/2012. CMSC 201 Fall 2012 Instructor: John Park Lecture Section 01. Discussion Sections 02-08, 16, 17
CMSC 201 Fall 2012 Instructor: John Park Lecture Section 01 1 Discussion Sections 02-08, 16, 17 Adapted from slides by Sue Evans et al. 2 Learning Outcomes Become familiar with input and output (I/O) from
NUMERIC SYSTEMS USED IN NETWORKING
NUMERIC SYSTEMS USED IN NETWORKING Decimal - Binary - Hexadecimal Table ASCII Code 128 64 32 16 8 4 2 1 The Letter A 0 1 0 0 0 0 0 1 Data Units Base 10 Numbering System Base 2 Numbering System Decimal
The Future of Scientific Software. BioTuple v1.0 User Guide
The Future of Scientific Software BioTuple v1.0 User Guide Copyright 2006-2014 ichemlabs, LLC. All Rights Reserved. No part of this document may be reproduced or transmitted in any form or by any means,
Functions Defining Calling (invoking) Parameters Returned values
As you arrive: 1. Start up your computer and plug it in 2. Log into Angel and go to CSSE 120 3. Do the Attendance Widget the PIN is on the board 4. Go to the course Schedule Page From your bookmark, or
File I/O. File Names and Types. I/O Streams. Stream Extraction and Insertion. A file name should reflect its contents
File I/O 1 File Names and Types A file name should reflect its contents Payroll.dat Students.txt Grades.txt A file s extension indicates the kind of data the file holds.dat,.txt general program input or
Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary
Outline Hash Tables Repeat Finding Exact Pattern Matching Keyword Trees Suffix Trees Heuristic Similarity Search Algorithms Approximate String Matching Filtration Comparing a Sequence Against a Database