STAMPS ARB Tutorial 8/6/11

Transcription

1 STAMPS ARB Tutorial 8/6/11 NOTES: - Throughout the tutorials, items requiring actions from you are denoted by >> and items which you should select or click on are bolded. - Your cursor must be in the window you are typing in for any keyboard command to work. STARTING ARB >> Open a terminal, log onto the server (ssh X username@grendel-0#.mbl.edu) and type arb at the command line. >> ARB should now be open. Browse the class files to locate the LTP_s104_SSU.arb database (contains 8545 sequences). Select Open Selected.

2 >> The ARB_NT window should open. This is your main viewing screen in ARB, and the display should look something like this: The ARB_NT window contains all of the functional commands as well as a view of the database s phylogenetic tree. >> Scroll down on the right side of the ARB window to get a feel for how many sequences and what phylogenetic groups are present in your database. To examine the number of bacterial and archaeal sequences in the database, choose Tree Collapse/Expand tree Group all. You can now use the Select button and the left click on your mouse (MACS: command + mouse click) to unfold the different groups of sequences. >> Click on the different tree view options to see how the groups can be represented.

3 >> Using the Select tool, select a species on the tree and click on Info. Info describes the metadata associated with that species, including taxonomic classifications from RDP, Silva, Greengenes, Embl, etc. IMPORTING ALIGNED SEQUENCES We will first work with sequences in ARB that were aligned using the SINA (SILVA INcremental Aligner) web-aligner ( It is advantageous to align remotely in SINA if you have limited computing power. Note: your aligned file should be saved in the FASTA, not ARB format. >> Go to: File Import Import sequences and fields. Browse to highlight the on the SINAaligned.txt file. Note: file names or folders cannot contain any spaces, or they will not be recognized in ARB. >> Under Import Selected Format, click Auto detect, and change the format to Fasta_wgap.ift (use this ONLY if sequences are already aligned). Leave the Name, Type, and Protection levels as the defaults. Click Go. A question box will come up asking about the names:

4 >> Click use found names. Note: ARB recommends generating new short names, and this is especially important if you are working with a large database that may contain species with the same name. For the purpose of this exercise, just use the found names. You are now presented with a SEARCH AND QUERY menu. This menu is very useful for locating certain sequences (more later about this), and we will use it now to provide additional identification information about our sequences. >> Click the button Mark Listed Unmark Rest. This feature marks, or highlights the newly imported sequences and allows you to only work with these sequences. If the sequences are marked, an asterisk (*) appears to the left of the sequence name. >> Click the Write to Fields of Listed button. This menu option is very useful because it allows you to provide information about your newly imported sequence. Add the following information: For the Select field name, scroll down the fields until you see author, and highlight it. Move your cursor into the Enter new field value and type your last name (note, your cursor must be in the box to type). After entering your name, click Write. Close the window.

5 The other fields that are frequently useful to fill out include isolation source, lat_lon, group_name, remark etc. These fields allow you to search for and compare sequences belonging to a unique field. Your sequence is now searchable in the software program! >> Save your database using File Save whole database as. Rename your database with your name, put it into your directiory, and Click Save. Note: ARB has a tendency to crash, so save your work frequently!! CHECKING SEQUENCE ALIGNMENTS >>To check your sequence alignments, click on the alignment tool button at the top of the screen: >> This button opens the alignment viewer. A warning menu may pop up. Select Create. From top to bottom, the ARB_Edit4 window has 5 main sections: A. Menu B. Positions C. Primer and Probe search functions D. E.coli alignment E. Filters and alignments for marked species

6 >> At the bottom of the page, click the arrow beside More sequences to open and view your unaligned sequence. First, check the ends of the sequence. Lines should (--) represent internal gaps and periods (.) represent missing data at the ends of sequences. Make sure the ends of the sequence have periods and not lines present. >> To change lines to periods at the end of sequences, move your cursor to the double dashed lines beside More sequences and type period (.). Now you are ready to manually edit your alignment. Below are some tools that are useful for editing the alignment: Keyboard commands Arrow keys Ctrl + arrow keys Ctrl + O Ctrl + P Ctrl + J Ctrl + arrow keys Spacebar Actions Use to move the cursor within the sequence. Use to move the cursor over blocks of bases or gaps. Useful to quickly move within the sequence. Pulls bases from the left to the right Pulls bases from the right to the left Jumps to the other side of the stem (should be a complementary basepair) Jump to the end of the helix Inserts a space and moves your entire sequence out of alignment USE CAREFULLY!! The alignment is coded with helix symbols which denote the sequence properties with respect to the secondary structure information.

7 >> To view the helix symbols, go to Properties Helix Settings. The most important properties to remember: ~ represents a strong pair (a good alignment) - represents a normal pair = represents a weak pair # mostly represents a bad alignment >> Move through the sequence and look for # (potentially bad basepair alignments). Sometimes these can be corrected by moving basepairs using the Control O or Control P commands. Note: your cursor must be in the alignment window for any keyboard command to work. For the alignment, pay special consideration to the ends of the sequences, which often do not align correctly. You will continue to refine your alignment after adding your sequence to the tree and looking at the closest relatives, so don t worry too much if the alignment is not perfect now. >> Close the alignment window and save your database. ADDING SEQUENCES TO THE REFERENCE TREE >> Mark the sequences you want to add to the tree using SPECIES SEARCH and QUERY. Search for the sequences using the identifying term you assigned to the sequences (your last name, tutorial, etc.). Next, select Mark Listed Unmark Rest. >> To add your sequences to the big tree, select Tree Add Species to Existing Tree ARB parsimony (quick add marked). Select the tree_ltps104_ssu. Select the default alignment (ali_16s) alignment and the default (Ecoli) filter. Select Close. For weight, choose none. Start the program by pressing GO. A question box may appear stating that this action will require a lot of memory. Choose Yes to continue. It may take a few moments to add your sequences to the tree be patient! >> To find your sequences, go to Tree Collapse/Expand tree Group all except marked. Next, use the scroll at the right side of the screen to locate your sequences in the tree. They should appear in yellow color. REFINING SEQUENCE ALIGNMENTS >> It is a good idea to check the alignment of your sequence. To do this, first scroll throughout the big tree to find your first sequence in the tree. Unmark all sequences by selecting Species Mark Species Unmark all Species. Next,

8 manually mark your one sequence and also mark several species surrounding that sequence. >> Open the alignment window, and scroll across the sequence to compare your sequence to the sequences in the database. Move any basepair positions in your sequence that may fit better into a different position. If you identify mistakes in the reference sequences, you will need to increase the protection level to make any changes (generally, it is best to leave the references sequences in a well-aligned database such as the Living Tree Project alone, but you may find mistakes in the SILVA or Greengenes databases). >> Once you have refined the alignment of your sequence, mark ONLY your sequence (to unmark the other sequences, click on the box beside the sequence name). Close the alignment window. >> Now that your alignment is refined, you need to remove it from the tree and then add it back to the tree to view its new position on the tree. Go to Tree Remove Species from Tree Remove marked. Next, add the sequence back into the tree using Tree Add Species to Existing Tree ARB parsimony (quick add marked). If you changed the alignment of your sequence, the sequence should now be placed tighter or move completely in the tree compared to the surrounding species. If you want more practice, refine the alignment of 5 additional sequences. If you were working with real data, you may spend hours to days refining alignments, depending on the purpose of your work. The PT_SERVER (Positional Tree Server) The PT_Server is a different format of your database that is necessary for faster search functions which are useful for sequence alignments and primer and probe designs. Specifically, the PT_Server is used by the Fast_Aligner, Probe_Design and Probe_Match tools. The PT_Server must be updated independently of your database, and saving your ARB database does not affect your PT_Server. In fact, you should only update your PT_Server when the sequences in your database are wellaligned. For this exercise, the PT_Server is already built and you will use the user2 server. IMPORTING UNALIGNED SEQUENCES USING ARB Next, you will import 3 unaligned sequences and align them in ARB.

9 >> Go to: File Import Import sequences and fields. Import the manual_sequences.txt file. >> Under Import Selected Format, click Auto detect, and make sure the format to Fasta.ift (DO NOT use Fasta_wgap.ift because these sequences are unaligned). Leave the Name, Type, and Protection levels as the defaults. Click Go. >> Click use found names. >> In the SEARCH AND QUERY menu, click the button Mark Listed Unmark Rest. >> Click the Write to Fields of Listed button. For the Select field name, scroll down the fields until you see author, and highlight it. Move your cursor into the Enter new field value and type your last name (note, your cursor must be in the box to type). After entering your name, click Write. Close the window. ALIGNING SEQUENCES USING ARB >> To align your sequences, first make sure they are marked. Use the SEARCH and QUERY menu and search for sequences matching your last name under the author field. Once your sequence names appear in the HITLIST, select Mark Listed Unmark Rest. >>To align your marked sequence, click on the alignment tool button at the top of the screen: >> Click the Edit Integrated Aligners menu to open the Integrated Aligners window. Click on Fast aligner to select that aligner. >> In the Align what? section, click on the Marked Species button to align only the species which are marked. >> The Reference section allows you to designate which species to use as alignment templates. To utilize your whole database, select Auto search by pt_server and click on the probe_server.arb button and choose the PT_SERVER which corresponds to your database from the pull-down menu, user 2.

10 >> For Number of relatives to use: enter the maximum value of 10. During the alignment, ARB will look for the 10 best neighbors from the PT_SERVER with which to align the new sequence. >> In the Range section, select the Whole sequence button. If you were only interested in aligning a portion of the sequence, you could designate a portion of the sequence using the Selected Range option. >> In the Protection section, we must set the level to meet or exceed that of the sequence data. You should not need to change anything for now. >> For Turn check, set the pull-down list to User acknowledgement. In this mode, ARB attempts to align sequences in their current orientation and also the reverse complement, and then offers you the option of turning the sequence if it comes up with a better alignment. Alternatively, you could choose to Automatically turn sequence if you always wanted to take ARB s recommendation without prompting, or to Never turn the sequence to keep the sequence in the current orientation. >> In the Reports section, select No report. >> In the Reports section, uncheck the Show messages about missing gaps box. If you select this option, ARB will report all the gaps it needed to invoke in reference species during the alignment process. >> Click GO for the alignment to begin. The alignment will be quick if you are working with a relatively small number of sequences in your PT_SERVER. It is common for the program to choke and fail during the alignment. If this happens, try the alignment a second time. Close the window. Skip this now, but come back later for more practice: - Manually checking your alignment and determining if there are any inaccuracies (especially at the ends). - Adding your sequences to the reference tree. - Refining the alignments. EVALUATING PRIMERS/PROBES NOTE: Normally, you would make sure you were working with a well-aligned database AND your PT_Server was updated before beginning. For the purposes of this exercise, skip the PT_Server update. First, If you have already have a primer and you would like to evaluate its specificity using the database, you will want to use the Probe Match function.

11 >> Select Probes Match Probes >> Under Target String, enter a 27F primer: AGAGTTTGATCCTGGCTCAG, and choose user2.arb as your PT-SERVER. Change Search Depth to Search up to 0 mismatches. Next, press MATCH (in the top, middle of window). This window allows you to evaluate the sequences that match with your primer. They are also marked in the database. If you want to evaluate sequences mismatching to your primers, you can increase the Search depth. DESIGNING NEW PRIMERS >> Choose one or several closely related sequences as your target sequence(s) for probe design. Only choose full-length sequences. Mark the sequences by clicking on the mark icon and left clicking on the species >> Launch the probe design tool by selecting Probes Design probes. Identify your PT-Server (user 2) Change Min. group hits % to 100% to target all members of the group Keep in mind: if you have short sequences, increase the number beside Max non group hits to allow for unmarked short target group members which may be present in your dataset (none present for this exercise)

12 Leave all other criteria as the default. Select GO. A status window will appear. Be patient, as the probe search may take several minutes. When the search is complete, a PD result window should appear. Below is an overview of the PD Result window: Target string: The sequence the probe is targeting. This is the reverse complement sequence of your probe. le: Length of the probe apos: absolute probe position, probes are grouped by letters (A, B, C, etc.) according to target site with the best probes listed first. Overlapping probes are represented as + or -. The best criteria takes into account the theoretical melting temperature and specificity. ecol: probe position relative to the E. coli alignment grps: number of sequences covered by the probe G+C: GC content of the probe 4GC + 2AT: theoretical melting temperature Probe sequence: this is the probe sequence written 5 3 Decrease T by n*.3c: provides information about the theoretical specificity of the probe. By decreasing the optimal hybridization temperature n x 0.3 C (n = sum of the columns), the numbers indicate non-target sequences in the database which would theoretically hybridize with the probe. >> Match and review the probe design results by highlighting a probe sequence and selecting the Match button. When the PROBE MATCH window opens, select the Match button. The PROBE MATCH window opens and displays the sequences which match the selected criteria. For the below example, only two sequences contain zero mismatches to the probe:

13 Each time you update the Match window by pressing the Match button, the species that the probe matches will be marked on the currently viewed tree. While examining the different probe varieties (A+, A-, B+, etc.). >> If you find a good primer, you can print the mismatch table to a postscript file and save it on your computer for future reference. Now that you know the basics, spending time with ARB is the best way to learn it! THE END