of Manchester The University COMP14112 Markov Chains, HMMs and Speech Revision

Size: px
Start display at page:

Download "of Manchester The University COMP14112 Markov Chains, HMMs and Speech Revision"

Transcription

1 COMP14112 Lecture 11 Markov Chains, HMMs and Speech Revision 1

2 What have we covered in the speech lectures? Extracting features from raw speech data Classification and the naive Bayes classifier Training Sequence data Markov models Hidden Markov models 2

3 1. Features and data We have to represent sensory information in a useful way: sound waves and robust sensor data are two examples. Good features are domain specific,but we often end up with a vector of numbers called a feature vector or data point For speech we use MFCC features derived form segmented data Methods for processing the feature vectors are general Probabilistic approaches are popular-not the only approach, but certainly a leading one 3

4 2. Classification Given a data point x, what class does it belong to? You constructed probabilistic classifiers in Labs 2 and 3to distinguish between yes and no You should know what makes a good classifier how would you assess its performance? Lots of applications one of the key AI tools 4

5 2.1 Probabilistic classification For a data point x Estimate the probability density p(x C i )for each class i Apply Bayes theorem p ( C x) 1 = p ( x C ) 1 p ( C1 ) p( x C ) i p( C i ) i Apply classification rule: for two classes, p(c 1 x) > 0.5 Class of x= C 1 Multiple classes? 5

6 2.2 Naïve Bayesclassifier The naïve Bayesassumption can be used if data are vectors Feature vector components are conditionally independent given the class p ( x C ) = p( x C ) p( x C ) p( x C ) L p( x C ) i 1 i 2 See lecture notes and Lab 2 for application to time averaged MFCC features derived from speech i Examples sheet 6 for discrete valued data example 2 i d i 6

7 2.3 1-D Classification You ve seen some example classification rules For 1-D data, a single feature x 7

8 2.4 n-d Classification For 2-D data with feature vector x= [x 1, x 2 ] 8

9 3. Training When we fit a probability densityor probabilistic model to data, we have an example of training In the Labs, you ve seen data being used to estimate parameters of a normal distribution and a HMM The data that s used for this is training data Training is fundamental to machine learning, a large and important area of research in CS NB the performance ofthe Lab classifier would have improved with more training data 9

10 4. Sequence data In some cases the data arrives in a sequence We used speech data Other examples Video Sequential games Anything real-time DNA sequence data 10

11 5. Markov chains You should know Definition of a first order Markov process p ( s s s, L s ) p( s s ) t t 1, t 2, 1 = t t 1 Parameters are transition probabilities Normalisation condition Can be represented as a directed graph or a transition matrix Canbe unfolded in time to show all paths of a fixed length (Examples sheet 7 and past paper) How to do a simple probabilistic calculation 11

12 START 5. Markov chains 0.5 hh ay END 0.5 b What are the missing numbers? Unroll the model for exactly three time steps What is the probability that the sequence will be hi? What is the probability that a sequence of length 3 will be hi? 12

13 5. Markov chains Naïve application of probabilistic calculations is prohibitively slow in Markov chains In the lectures we saw a more efficient method based on recursion (Examples sheet 8) Don t need to remember the recursive algorithm used there, but should be able to apply it to a similar example Computationally efficient algorithms are very important imagine what happens when a problem is scaled up. 13

14 6. Hidden Markov models HMMs have two parts Markov chain model of states. The parameters of the Markovchain model are the transition probabilities: p(s t s t-1 ) t t-1 Emission probability distribution for feature vectors: p(x t s t ) In Lab 3 this is a normal density parameterised by mean and variance for each component of x 14

15 6. Hidden Markov models In Lab 3 you explored three things Training:constructing an HMM from labelled data (what is labelled data?) Classification: using the Forward algorithm to calculate p(x 1,x 2,,x T C) i and plugging it into Bayes theorem Decoding: using the Vitterbialgorithm to find the most likely path through the hidden states You should be able to understand the tasks, but don t have to recall details of the algorithms 15

16 6. Hidden Markov models Simple example of decoding (Lab 3) is removing the silence from speech signals The data withoutsilence is easier to classify (as in Lab 2) yes START 1.0 sil sil 0.04 STOP 0.02 no

17 7. Applications to speech Survey of tasks and performance (Examples sheet 5) Segmentation and MFCC features Phonemes and phoneme HMMs Triphones Decoding speech Simple language models 17

18 Other applications These methods can be generalised to many applications TrueSkill Ranking system in Xbox live Vision applications Speech Medicine Probabilistic graphical models to update probability of illness given symptoms Biology Standard way to determine gene function and location of genes in DNA sequence 18

19 How to revise Work through Example class sheets and past paper(s) Make sure you understand the relationship between the labs and the notes Notes, lectures, example sheet solutions and on the course website 19

COMP90051 Statistical Machine Learning

COMP90051 Statistical Machine Learning COMP90051 Statistical Machine Learning Semester 2, 2016 Lecturer: Trevor Cohn 20. PGM Representation Next Lectures Representation of joint distributions Conditional/marginal independence * Directed vs

More information

Chapter 3. Speech segmentation. 3.1 Preprocessing

Chapter 3. Speech segmentation. 3.1 Preprocessing , as done in this dissertation, refers to the process of determining the boundaries between phonemes in the speech signal. No higher-level lexical information is used to accomplish this. This chapter presents

More information

HIDDEN MARKOV MODELS AND SEQUENCE ALIGNMENT

HIDDEN MARKOV MODELS AND SEQUENCE ALIGNMENT HIDDEN MARKOV MODELS AND SEQUENCE ALIGNMENT - Swarbhanu Chatterjee. Hidden Markov models are a sophisticated and flexible statistical tool for the study of protein models. Using HMMs to analyze proteins

More information

CPSC 340: Machine Learning and Data Mining. Probabilistic Classification Fall 2017

CPSC 340: Machine Learning and Data Mining. Probabilistic Classification Fall 2017 CPSC 340: Machine Learning and Data Mining Probabilistic Classification Fall 2017 Admin Assignment 0 is due tonight: you should be almost done. 1 late day to hand it in Monday, 2 late days for Wednesday.

More information

Time series, HMMs, Kalman Filters

Time series, HMMs, Kalman Filters Classic HMM tutorial see class website: *L. R. Rabiner, "A Tutorial on Hidden Markov Models and Selected Applications in Speech Recognition," Proc. of the IEEE, Vol.77, No.2, pp.257--286, 1989. Time series,

More information

Introduction to Hidden Markov models

Introduction to Hidden Markov models 1/38 Introduction to Hidden Markov models Mark Johnson Macquarie University September 17, 2014 2/38 Outline Sequence labelling Hidden Markov Models Finding the most probable label sequence Higher-order

More information

ECE521: Week 11, Lecture March 2017: HMM learning/inference. With thanks to Russ Salakhutdinov

ECE521: Week 11, Lecture March 2017: HMM learning/inference. With thanks to Russ Salakhutdinov ECE521: Week 11, Lecture 20 27 March 2017: HMM learning/inference With thanks to Russ Salakhutdinov Examples of other perspectives Murphy 17.4 End of Russell & Norvig 15.2 (Artificial Intelligence: A Modern

More information

Conditional Random Fields : Theory and Application

Conditional Random Fields : Theory and Application Conditional Random Fields : Theory and Application Matt Seigel (mss46@cam.ac.uk) 3 June 2010 Cambridge University Engineering Department Outline The Sequence Classification Problem Linear Chain CRFs CRF

More information

Hidden Markov Model for Sequential Data

Hidden Markov Model for Sequential Data Hidden Markov Model for Sequential Data Dr.-Ing. Michelle Karg mekarg@uwaterloo.ca Electrical and Computer Engineering Cheriton School of Computer Science Sequential Data Measurement of time series: Example:

More information

Structured Learning. Jun Zhu

Structured Learning. Jun Zhu Structured Learning Jun Zhu Supervised learning Given a set of I.I.D. training samples Learn a prediction function b r a c e Supervised learning (cont d) Many different choices Logistic Regression Maximum

More information

Density estimation. In density estimation problems, we are given a random from an unknown density. Our objective is to estimate

Density estimation. In density estimation problems, we are given a random from an unknown density. Our objective is to estimate Density estimation In density estimation problems, we are given a random sample from an unknown density Our objective is to estimate? Applications Classification If we estimate the density for each class,

More information

Lecture 5: Markov models

Lecture 5: Markov models Master s course Bioinformatics Data Analysis and Tools Lecture 5: Markov models Centre for Integrative Bioinformatics Problem in biology Data and patterns are often not clear cut When we want to make a

More information

Unsupervised Learning

Unsupervised Learning Unsupervised Learning Learning without Class Labels (or correct outputs) Density Estimation Learn P(X) given training data for X Clustering Partition data into clusters Dimensionality Reduction Discover

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics A statistical Markov model in which the system being modeled is assumed to be a Markov process with unobserved (hidden) states in the training data. First used in speech and handwriting recognition In

More information

Lab 4: Hybrid Acoustic Models

Lab 4: Hybrid Acoustic Models v. 1.0 Lab 4: Hybrid Acoustic Models University of Edinburgh March 13, 2017 This is the final lab, in which we will have a look at training hybrid neural network acoustic models using a frame-level cross-entropy

More information

Dynamic Time Warping

Dynamic Time Warping Centre for Vision Speech & Signal Processing University of Surrey, Guildford GU2 7XH. Dynamic Time Warping Dr Philip Jackson Acoustic features Distance measures Pattern matching Distortion penalties DTW

More information

Partitioning Data. IRDS: Evaluation, Debugging, and Diagnostics. Cross-Validation. Cross-Validation for parameter tuning

Partitioning Data. IRDS: Evaluation, Debugging, and Diagnostics. Cross-Validation. Cross-Validation for parameter tuning Partitioning Data IRDS: Evaluation, Debugging, and Diagnostics Charles Sutton University of Edinburgh Training Validation Test Training : Running learning algorithms Validation : Tuning parameters of learning

More information

Recurrent Neural Network (RNN) Industrial AI Lab.

Recurrent Neural Network (RNN) Industrial AI Lab. Recurrent Neural Network (RNN) Industrial AI Lab. For example (Deterministic) Time Series Data Closed- form Linear difference equation (LDE) and initial condition High order LDEs 2 (Stochastic) Time Series

More information

Lecture 3: Conditional Independence - Undirected

Lecture 3: Conditional Independence - Undirected CS598: Graphical Models, Fall 2016 Lecture 3: Conditional Independence - Undirected Lecturer: Sanmi Koyejo Scribe: Nate Bowman and Erin Carrier, Aug. 30, 2016 1 Review for the Bayes-Ball Algorithm Recall

More information

An Introduction to Pattern Recognition

An Introduction to Pattern Recognition An Introduction to Pattern Recognition Speaker : Wei lun Chao Advisor : Prof. Jian-jiun Ding DISP Lab Graduate Institute of Communication Engineering 1 Abstract Not a new research field Wide range included

More information

Hidden Markov Models. Slides adapted from Joyce Ho, David Sontag, Geoffrey Hinton, Eric Xing, and Nicholas Ruozzi

Hidden Markov Models. Slides adapted from Joyce Ho, David Sontag, Geoffrey Hinton, Eric Xing, and Nicholas Ruozzi Hidden Markov Models Slides adapted from Joyce Ho, David Sontag, Geoffrey Hinton, Eric Xing, and Nicholas Ruozzi Sequential Data Time-series: Stock market, weather, speech, video Ordered: Text, genes Sequential

More information

Density estimation. In density estimation problems, we are given a random from an unknown density. Our objective is to estimate

Density estimation. In density estimation problems, we are given a random from an unknown density. Our objective is to estimate Density estimation In density estimation problems, we are given a random sample from an unknown density Our objective is to estimate? Applications Classification If we estimate the density for each class,

More information

Conditional Random Fields - A probabilistic graphical model. Yen-Chin Lee 指導老師 : 鮑興國

Conditional Random Fields - A probabilistic graphical model. Yen-Chin Lee 指導老師 : 鮑興國 Conditional Random Fields - A probabilistic graphical model Yen-Chin Lee 指導老師 : 鮑興國 Outline Labeling sequence data problem Introduction conditional random field (CRF) Different views on building a conditional

More information

Chapter 8 of Bishop's Book: Graphical Models

Chapter 8 of Bishop's Book: Graphical Models Chapter 8 of Bishop's Book: Graphical Models Review of Probability Probability density over possible values of x Used to find probability of x falling in some range For continuous variables, the probability

More information

Bayesian Networks Inference

Bayesian Networks Inference Bayesian Networks Inference Machine Learning 10701/15781 Carlos Guestrin Carnegie Mellon University November 5 th, 2007 2005-2007 Carlos Guestrin 1 General probabilistic inference Flu Allergy Query: Sinus

More information

CS 188: Artificial Intelligence Fall Machine Learning

CS 188: Artificial Intelligence Fall Machine Learning CS 188: Artificial Intelligence Fall 2007 Lecture 23: Naïve Bayes 11/15/2007 Dan Klein UC Berkeley Machine Learning Up till now: how to reason or make decisions using a model Machine learning: how to select

More information

Conditional Random Fields and beyond D A N I E L K H A S H A B I C S U I U C,

Conditional Random Fields and beyond D A N I E L K H A S H A B I C S U I U C, Conditional Random Fields and beyond D A N I E L K H A S H A B I C S 5 4 6 U I U C, 2 0 1 3 Outline Modeling Inference Training Applications Outline Modeling Problem definition Discriminative vs. Generative

More information

Machine Learning for. Artem Lind & Aleskandr Tkachenko

Machine Learning for. Artem Lind & Aleskandr Tkachenko Machine Learning for Object Recognition Artem Lind & Aleskandr Tkachenko Outline Problem overview Classification demo Examples of learning algorithms Probabilistic modeling Bayes classifier Maximum margin

More information

Lecture 21 : A Hybrid: Deep Learning and Graphical Models

Lecture 21 : A Hybrid: Deep Learning and Graphical Models 10-708: Probabilistic Graphical Models, Spring 2018 Lecture 21 : A Hybrid: Deep Learning and Graphical Models Lecturer: Kayhan Batmanghelich Scribes: Paul Liang, Anirudha Rayasam 1 Introduction and Motivation

More information

Quiz Section Week 8 May 17, Machine learning and Support Vector Machines

Quiz Section Week 8 May 17, Machine learning and Support Vector Machines Quiz Section Week 8 May 17, 2016 Machine learning and Support Vector Machines Another definition of supervised machine learning Given N training examples (objects) {(x 1,y 1 ), (x 2,y 2 ),, (x N,y N )}

More information

Bayes Net Learning. EECS 474 Fall 2016

Bayes Net Learning. EECS 474 Fall 2016 Bayes Net Learning EECS 474 Fall 2016 Homework Remaining Homework #3 assigned Homework #4 will be about semi-supervised learning and expectation-maximization Homeworks #3-#4: the how of Graphical Models

More information

Expectation Maximization. Machine Learning 10701/15781 Carlos Guestrin Carnegie Mellon University

Expectation Maximization. Machine Learning 10701/15781 Carlos Guestrin Carnegie Mellon University Expectation Maximization Machine Learning 10701/15781 Carlos Guestrin Carnegie Mellon University April 10 th, 2006 1 Announcements Reminder: Project milestone due Wednesday beginning of class 2 Coordinate

More information

Hidden Markov Models. Gabriela Tavares and Juri Minxha Mentor: Taehwan Kim CS159 04/25/2017

Hidden Markov Models. Gabriela Tavares and Juri Minxha Mentor: Taehwan Kim CS159 04/25/2017 Hidden Markov Models Gabriela Tavares and Juri Minxha Mentor: Taehwan Kim CS159 04/25/2017 1 Outline 1. 2. 3. 4. Brief review of HMMs Hidden Markov Support Vector Machines Large Margin Hidden Markov Models

More information

Modeling Phonetic Context with Non-random Forests for Speech Recognition

Modeling Phonetic Context with Non-random Forests for Speech Recognition Modeling Phonetic Context with Non-random Forests for Speech Recognition Hainan Xu Center for Language and Speech Processing, Johns Hopkins University September 4, 2015 Hainan Xu September 4, 2015 1 /

More information

Modeling Sequence Data

Modeling Sequence Data Modeling Sequence Data CS4780/5780 Machine Learning Fall 2011 Thorsten Joachims Cornell University Reading: Manning/Schuetze, Sections 9.1-9.3 (except 9.3.1) Leeds Online HMM Tutorial (except Forward and

More information

An Introduction to Hidden Markov Models

An Introduction to Hidden Markov Models An Introduction to Hidden Markov Models Max Heimel Fachgebiet Datenbanksysteme und Informationsmanagement Technische Universität Berlin http://www.dima.tu-berlin.de/ 07.10.2010 DIMA TU Berlin 1 Agenda

More information

Cheng Soon Ong & Christian Walder. Canberra February June 2018

Cheng Soon Ong & Christian Walder. Canberra February June 2018 Cheng Soon Ong & Christian Walder Research Group and College of Engineering and Computer Science Canberra February June 2018 Outlines Overview Introduction Linear Algebra Probability Linear Regression

More information

Machine Learning / Jan 27, 2010

Machine Learning / Jan 27, 2010 Revisiting Logistic Regression & Naïve Bayes Aarti Singh Machine Learning 10-701/15-781 Jan 27, 2010 Generative and Discriminative Classifiers Training classifiers involves learning a mapping f: X -> Y,

More information

Homework 2: HMM, Viterbi, CRF/Perceptron

Homework 2: HMM, Viterbi, CRF/Perceptron Homework 2: HMM, Viterbi, CRF/Perceptron CS 585, UMass Amherst, Fall 2015 Version: Oct5 Overview Due Tuesday, Oct 13 at midnight. Get starter code from the course website s schedule page. You should submit

More information

Sequence Modeling: Recurrent and Recursive Nets. By Pyry Takala 14 Oct 2015

Sequence Modeling: Recurrent and Recursive Nets. By Pyry Takala 14 Oct 2015 Sequence Modeling: Recurrent and Recursive Nets By Pyry Takala 14 Oct 2015 Agenda Why Recurrent neural networks? Anatomy and basic training of an RNN (10.2, 10.2.1) Properties of RNNs (10.2.2, 8.2.6) Using

More information

27: Hybrid Graphical Models and Neural Networks

27: Hybrid Graphical Models and Neural Networks 10-708: Probabilistic Graphical Models 10-708 Spring 2016 27: Hybrid Graphical Models and Neural Networks Lecturer: Matt Gormley Scribes: Jakob Bauer Otilia Stretcu Rohan Varma 1 Motivation We first look

More information

Naïve Bayes Classification. Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others

Naïve Bayes Classification. Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others Naïve Bayes Classification Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others Things We d Like to Do Spam Classification Given an email, predict

More information

CPSC 340: Machine Learning and Data Mining. Ranking Fall 2016

CPSC 340: Machine Learning and Data Mining. Ranking Fall 2016 CPSC 340: Machine Learning and Data Mining Ranking Fall 2016 Assignment 5: Admin 2 late days to hand in Wednesday, 3 for Friday. Assignment 6: Due Friday, 1 late day to hand in next Monday, etc. Final:

More information

School of Computing and Information Systems The University of Melbourne COMP90042 WEB SEARCH AND TEXT ANALYSIS (Semester 1, 2017)

School of Computing and Information Systems The University of Melbourne COMP90042 WEB SEARCH AND TEXT ANALYSIS (Semester 1, 2017) Discussion School of Computing and Information Systems The University of Melbourne COMP9004 WEB SEARCH AND TEXT ANALYSIS (Semester, 07). What is a POS tag? Sample solutions for discussion exercises: Week

More information

Profiles and Multiple Alignments. COMP 571 Luay Nakhleh, Rice University

Profiles and Multiple Alignments. COMP 571 Luay Nakhleh, Rice University Profiles and Multiple Alignments COMP 571 Luay Nakhleh, Rice University Outline Profiles and sequence logos Profile hidden Markov models Aligning profiles Multiple sequence alignment by gradual sequence

More information

Pattern Recognition. Kjell Elenius. Speech, Music and Hearing KTH. March 29, 2007 Speech recognition

Pattern Recognition. Kjell Elenius. Speech, Music and Hearing KTH. March 29, 2007 Speech recognition Pattern Recognition Kjell Elenius Speech, Music and Hearing KTH March 29, 2007 Speech recognition 2007 1 Ch 4. Pattern Recognition 1(3) Bayes Decision Theory Minimum-Error-Rate Decision Rules Discriminant

More information

CS 188: Artificial Intelligence Fall Announcements

CS 188: Artificial Intelligence Fall Announcements CS 188: Artificial Intelligence Fall 2006 Lecture 22: Naïve Bayes 11/14/2006 Dan Klein UC Berkeley Announcements Optional midterm On Tuesday 11/21 in class Review session 11/19, 7-9pm, in 306 Soda Projects

More information

Announcements. CS 188: Artificial Intelligence Fall Machine Learning. Classification. Classification. Bayes Nets for Classification

Announcements. CS 188: Artificial Intelligence Fall Machine Learning. Classification. Classification. Bayes Nets for Classification CS 88: Artificial Intelligence Fall 00 Lecture : Naïve Bayes //00 Announcements Optional midterm On Tuesday / in class Review session /9, 7-9pm, in 0 Soda Projects. due /. due /7 Dan Klein UC Berkeley

More information

Note Set 4: Finite Mixture Models and the EM Algorithm

Note Set 4: Finite Mixture Models and the EM Algorithm Note Set 4: Finite Mixture Models and the EM Algorithm Padhraic Smyth, Department of Computer Science University of California, Irvine Finite Mixture Models A finite mixture model with K components, for

More information

Nearest Neighbors Classifiers

Nearest Neighbors Classifiers Nearest Neighbors Classifiers Raúl Rojas Freie Universität Berlin July 2014 In pattern recognition we want to analyze data sets of many different types (pictures, vectors of health symptoms, audio streams,

More information

CSEP 573: Artificial Intelligence

CSEP 573: Artificial Intelligence CSEP 573: Artificial Intelligence Machine Learning: Perceptron Ali Farhadi Many slides over the course adapted from Luke Zettlemoyer and Dan Klein. 1 Generative vs. Discriminative Generative classifiers:

More information

INF4820, Algorithms for AI and NLP: Hierarchical Clustering

INF4820, Algorithms for AI and NLP: Hierarchical Clustering INF4820, Algorithms for AI and NLP: Hierarchical Clustering Erik Velldal University of Oslo Sept. 25, 2012 Agenda Topics we covered last week Evaluating classifiers Accuracy, precision, recall and F-score

More information

COMP Page Rank

COMP Page Rank COMP 4601 Page Rank 1 Motivation Remember, we were interested in giving back the most relevant documents to a user. Importance is measured by reference as well as content. Think of this like academic paper

More information

Feature Extractors. CS 188: Artificial Intelligence Fall Some (Vague) Biology. The Binary Perceptron. Binary Decision Rule.

Feature Extractors. CS 188: Artificial Intelligence Fall Some (Vague) Biology. The Binary Perceptron. Binary Decision Rule. CS 188: Artificial Intelligence Fall 2008 Lecture 24: Perceptrons II 11/24/2008 Dan Klein UC Berkeley Feature Extractors A feature extractor maps inputs to feature vectors Dear Sir. First, I must solicit

More information

Intelligent Hands Free Speech based SMS System on Android

Intelligent Hands Free Speech based SMS System on Android Intelligent Hands Free Speech based SMS System on Android Gulbakshee Dharmale 1, Dr. Vilas Thakare 3, Dr. Dipti D. Patil 2 1,3 Computer Science Dept., SGB Amravati University, Amravati, INDIA. 2 Computer

More information

Machine Learning. Computational biology: Sequence alignment and profile HMMs

Machine Learning. Computational biology: Sequence alignment and profile HMMs 10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth

More information

CS 188: Artificial Intelligence Fall 2008

CS 188: Artificial Intelligence Fall 2008 CS 188: Artificial Intelligence Fall 2008 Lecture 22: Naïve Bayes 11/18/2008 Dan Klein UC Berkeley 1 Machine Learning Up until now: how to reason in a model and how to make optimal decisions Machine learning:

More information

Assignment 4 CSE 517: Natural Language Processing

Assignment 4 CSE 517: Natural Language Processing Assignment 4 CSE 517: Natural Language Processing University of Washington Winter 2016 Due: March 2, 2016, 1:30 pm 1 HMMs and PCFGs Here s the definition of a PCFG given in class on 2/17: A finite set

More information

K-Means and Gaussian Mixture Models

K-Means and Gaussian Mixture Models K-Means and Gaussian Mixture Models David Rosenberg New York University June 15, 2015 David Rosenberg (New York University) DS-GA 1003 June 15, 2015 1 / 43 K-Means Clustering Example: Old Faithful Geyser

More information

Learning Bayesian Networks (part 3) Goals for the lecture

Learning Bayesian Networks (part 3) Goals for the lecture Learning Bayesian Networks (part 3) Mark Craven and David Page Computer Sciences 760 Spring 2018 www.biostat.wisc.edu/~craven/cs760/ Some of the slides in these lectures have been adapted/borrowed from

More information

Exact Inference: Elimination and Sum Product (and hidden Markov models)

Exact Inference: Elimination and Sum Product (and hidden Markov models) Exact Inference: Elimination and Sum Product (and hidden Markov models) David M. Blei Columbia University October 13, 2015 The first sections of these lecture notes follow the ideas in Chapters 3 and 4

More information

ECE521 Lecture 18 Graphical Models Hidden Markov Models

ECE521 Lecture 18 Graphical Models Hidden Markov Models ECE521 Lecture 18 Graphical Models Hidden Markov Models Outline Graphical models Conditional independence Conditional independence after marginalization Sequence models hidden Markov models 2 Graphical

More information

Minimum Redundancy and Maximum Relevance Feature Selec4on. Hang Xiao

Minimum Redundancy and Maximum Relevance Feature Selec4on. Hang Xiao Minimum Redundancy and Maximum Relevance Feature Selec4on Hang Xiao Background Feature a feature is an individual measurable heuris4c property of a phenomenon being observed In character recogni4on: horizontal

More information

Eukaryotic Gene Finding: The GENSCAN System

Eukaryotic Gene Finding: The GENSCAN System Eukaryotic Gene Finding: The GENSCAN System BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC

More information

Short Survey on Static Hand Gesture Recognition

Short Survey on Static Hand Gesture Recognition Short Survey on Static Hand Gesture Recognition Huu-Hung Huynh University of Science and Technology The University of Danang, Vietnam Duc-Hoang Vo University of Science and Technology The University of

More information

Naïve Bayes Classification. Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others

Naïve Bayes Classification. Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others Naïve Bayes Classification Material borrowed from Jonathan Huang and I. H. Witten s and E. Frank s Data Mining and Jeremy Wyatt and others Things We d Like to Do Spam Classification Given an email, predict

More information

Week 4. COMP62342 Sean Bechhofer, Uli Sattler

Week 4. COMP62342 Sean Bechhofer, Uli Sattler Week 4 COMP62342 Sean Bechhofer, Uli Sattler sean.bechhofer@manchester.ac.uk, uli.sattler@manchester.ac.uk Today Some clarifications from last week s coursework More on reasoning: extension of the tableau

More information

Chapter 1. Introduction

Chapter 1. Introduction Chapter 1 Introduction A Monte Carlo method is a compuational method that uses random numbers to compute (estimate) some quantity of interest. Very often the quantity we want to compute is the mean of

More information

Speech Recogni,on using HTK CS4706. Fadi Biadsy April 21 st, 2008

Speech Recogni,on using HTK CS4706. Fadi Biadsy April 21 st, 2008 peech Recogni,on using HTK C4706 Fadi Biadsy April 21 st, 2008 1 Outline peech Recogni,on Feature Extrac,on HMM 3 basic problems HTK teps to Build a speech recognizer 2 peech Recogni,on peech ignal to

More information

Exam Topics. Search in Discrete State Spaces. What is intelligence? Adversarial Search. Which Algorithm? 6/1/2012

Exam Topics. Search in Discrete State Spaces. What is intelligence? Adversarial Search. Which Algorithm? 6/1/2012 Exam Topics Artificial Intelligence Recap & Expectation Maximization CSE 473 Dan Weld BFS, DFS, UCS, A* (tree and graph) Completeness and Optimality Heuristics: admissibility and consistency CSPs Constraint

More information

Classification Algorithms in Data Mining

Classification Algorithms in Data Mining August 9th, 2016 Suhas Mallesh Yash Thakkar Ashok Choudhary CIS660 Data Mining and Big Data Processing -Dr. Sunnie S. Chung Classification Algorithms in Data Mining Deciding on the classification algorithms

More information

Day 3 Lecture 1. Unsupervised Learning

Day 3 Lecture 1. Unsupervised Learning Day 3 Lecture 1 Unsupervised Learning Semi-supervised and transfer learning Myth: you can t do deep learning unless you have a million labelled examples for your problem. Reality You can learn useful representations

More information

Announcements. CS 188: Artificial Intelligence Spring Generative vs. Discriminative. Classification: Feature Vectors. Project 4: due Friday.

Announcements. CS 188: Artificial Intelligence Spring Generative vs. Discriminative. Classification: Feature Vectors. Project 4: due Friday. CS 188: Artificial Intelligence Spring 2011 Lecture 21: Perceptrons 4/13/2010 Announcements Project 4: due Friday. Final Contest: up and running! Project 5 out! Pieter Abbeel UC Berkeley Many slides adapted

More information

Discriminative training and Feature combination

Discriminative training and Feature combination Discriminative training and Feature combination Steve Renals Automatic Speech Recognition ASR Lecture 13 16 March 2009 Steve Renals Discriminative training and Feature combination 1 Overview Hot topics

More information

1 : Introduction to GM and Directed GMs: Bayesian Networks. 3 Multivariate Distributions and Graphical Models

1 : Introduction to GM and Directed GMs: Bayesian Networks. 3 Multivariate Distributions and Graphical Models 10-708: Probabilistic Graphical Models, Spring 2015 1 : Introduction to GM and Directed GMs: Bayesian Networks Lecturer: Eric P. Xing Scribes: Wenbo Liu, Venkata Krishna Pillutla 1 Overview This lecture

More information

Regularization and model selection

Regularization and model selection CS229 Lecture notes Andrew Ng Part VI Regularization and model selection Suppose we are trying select among several different models for a learning problem. For instance, we might be using a polynomial

More information

A problem - too many features. TDA 231 Dimension Reduction: PCA. Features. Making new features

A problem - too many features. TDA 231 Dimension Reduction: PCA. Features. Making new features A problem - too many features TDA 1 Dimension Reduction: Aim: To build a classifier that can diagnose leukaemia using Gene expression data. Data: 7 healthy samples,11 leukaemia samples (N = 8). Each sample

More information

Dynamic Programming. Ellen Feldman and Avishek Dutta. February 27, CS155 Machine Learning and Data Mining

Dynamic Programming. Ellen Feldman and Avishek Dutta. February 27, CS155 Machine Learning and Data Mining CS155 Machine Learning and Data Mining February 27, 2018 Motivation Much of machine learning is heavily dependent on computational power Many libraries exist that aim to reduce computational time TensorFlow

More information

Hidden Markov Models in the context of genetic analysis

Hidden Markov Models in the context of genetic analysis Hidden Markov Models in the context of genetic analysis Vincent Plagnol UCL Genetics Institute November 22, 2012 Outline 1 Introduction 2 Two basic problems Forward/backward Baum-Welch algorithm Viterbi

More information

Applications of inductive types in artificial intelligence and inductive reasoning

Applications of inductive types in artificial intelligence and inductive reasoning Applications of inductive types in artificial intelligence and inductive reasoning Ekaterina Komendantskaya School of Computing, University of Dundee Presentation at CiE 2010 Computational Logic in Neural

More information

Modeling time series with hidden Markov models

Modeling time series with hidden Markov models Modeling time series with hidden Markov models Advanced Machine learning 2017 Nadia Figueroa, Jose Medina and Aude Billard Time series data Barometric pressure Temperature Data Humidity Time What s going

More information

DISCRETE HIDDEN MARKOV MODEL IMPLEMENTATION

DISCRETE HIDDEN MARKOV MODEL IMPLEMENTATION DIGITAL SPEECH PROCESSING HOMEWORK #1 DISCRETE HIDDEN MARKOV MODEL IMPLEMENTATION Date: March, 28 2018 Revised by Ju-Chieh Chou 2 Outline HMM in Speech Recognition Problems of HMM Training Testing File

More information

Artificial Intelligence Naïve Bayes

Artificial Intelligence Naïve Bayes Artificial Intelligence Naïve Bayes Instructors: David Suter and Qince Li Course Delivered @ Harbin Institute of Technology [M any slides adapted from those created by Dan Klein and Pieter Abbeel for CS188

More information

Introduction to Machine Learning Prof. Mr. Anirban Santara Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur

Introduction to Machine Learning Prof. Mr. Anirban Santara Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur Introduction to Machine Learning Prof. Mr. Anirban Santara Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur Lecture - 19 Python Exercise on Naive Bayes Hello everyone.

More information

CS839: Probabilistic Graphical Models. Lecture 10: Learning with Partially Observed Data. Theo Rekatsinas

CS839: Probabilistic Graphical Models. Lecture 10: Learning with Partially Observed Data. Theo Rekatsinas CS839: Probabilistic Graphical Models Lecture 10: Learning with Partially Observed Data Theo Rekatsinas 1 Partially Observed GMs Speech recognition 2 Partially Observed GMs Evolution 3 Partially Observed

More information

A Visualization Tool to Improve the Performance of a Classifier Based on Hidden Markov Models

A Visualization Tool to Improve the Performance of a Classifier Based on Hidden Markov Models A Visualization Tool to Improve the Performance of a Classifier Based on Hidden Markov Models Gleidson Pegoretti da Silva, Masaki Nakagawa Department of Computer and Information Sciences Tokyo University

More information

Introduction to Machine Learning CMU-10701

Introduction to Machine Learning CMU-10701 Introduction to Machine Learning CMU-10701 Clustering and EM Barnabás Póczos & Aarti Singh Contents Clustering K-means Mixture of Gaussians Expectation Maximization Variational Methods 2 Clustering 3 K-

More information

Features: representation, normalization, selection. Chapter e-9

Features: representation, normalization, selection. Chapter e-9 Features: representation, normalization, selection Chapter e-9 1 Features Distinguish between instances (e.g. an image that you need to classify), and the features you create for an instance. Features

More information

Assignment 2. Unsupervised & Probabilistic Learning. Maneesh Sahani Due: Monday Nov 5, 2018

Assignment 2. Unsupervised & Probabilistic Learning. Maneesh Sahani Due: Monday Nov 5, 2018 Assignment 2 Unsupervised & Probabilistic Learning Maneesh Sahani Due: Monday Nov 5, 2018 Note: Assignments are due at 11:00 AM (the start of lecture) on the date above. he usual College late assignments

More information

Confidence Intervals. Dennis Sun Data 301

Confidence Intervals. Dennis Sun Data 301 Dennis Sun Data 301 Statistical Inference probability Population / Box Sample / Data statistics The goal of statistics is to infer the unknown population from the sample. We ve already seen one mode of

More information

COMP 161 Lecture Notes 16 Analyzing Search and Sort

COMP 161 Lecture Notes 16 Analyzing Search and Sort COMP 161 Lecture Notes 16 Analyzing Search and Sort In these notes we analyze search and sort. Counting Operations When we analyze the complexity of procedures we re determine the order of the number of

More information

CS273: Algorithms for Structure Handout # 4 and Motion in Biology Stanford University Thursday, 8 April 2004

CS273: Algorithms for Structure Handout # 4 and Motion in Biology Stanford University Thursday, 8 April 2004 CS273: Algorithms for Structure Handout # 4 and Motion in Biology Stanford University Thursday, 8 April 2004 Lecture #4: 8 April 2004 Topics: Sequence Similarity Scribe: Sonil Mukherjee 1 Introduction

More information

Hands On: Multimedia Methods for Large Scale Video Analysis (Lecture) Dr. Gerald Friedland,

Hands On: Multimedia Methods for Large Scale Video Analysis (Lecture) Dr. Gerald Friedland, Hands On: Multimedia Methods for Large Scale Video Analysis (Lecture) Dr. Gerald Friedland, fractor@icsi.berkeley.edu 1 Today Recap: Some more Machine Learning Multimedia Systems An example Multimedia

More information

ECG782: Multidimensional Digital Signal Processing

ECG782: Multidimensional Digital Signal Processing ECG782: Multidimensional Digital Signal Processing Object Recognition http://www.ee.unlv.edu/~b1morris/ecg782/ 2 Outline Knowledge Representation Statistical Pattern Recognition Neural Networks Boosting

More information

CS 543: Final Project Report Texture Classification using 2-D Noncausal HMMs

CS 543: Final Project Report Texture Classification using 2-D Noncausal HMMs CS 543: Final Project Report Texture Classification using 2-D Noncausal HMMs Felix Wang fywang2 John Wieting wieting2 Introduction We implement a texture classification algorithm using 2-D Noncausal Hidden

More information

Evaluation of Moving Object Tracking Techniques for Video Surveillance Applications

Evaluation of Moving Object Tracking Techniques for Video Surveillance Applications International Journal of Current Engineering and Technology E-ISSN 2277 4106, P-ISSN 2347 5161 2015INPRESSCO, All Rights Reserved Available at http://inpressco.com/category/ijcet Research Article Evaluation

More information

HMM-Based Handwritten Amharic Word Recognition with Feature Concatenation

HMM-Based Handwritten Amharic Word Recognition with Feature Concatenation 009 10th International Conference on Document Analysis and Recognition HMM-Based Handwritten Amharic Word Recognition with Feature Concatenation Yaregal Assabie and Josef Bigun School of Information Science,

More information

COMP90051 Statistical Machine Learning

COMP90051 Statistical Machine Learning COMP90051 Statistical Machine Learning Semester 2, 2016 Lecturer: Trevor Cohn 21. Independence in PGMs; Example PGMs Independence PGMs encode assumption of statistical independence between variables. Critical

More information

Classification and K-Nearest Neighbors

Classification and K-Nearest Neighbors Classification and K-Nearest Neighbors Administrivia o Reminder: Homework 1 is due by 5pm Friday on Moodle o Reading Quiz associated with today s lecture. Due before class Wednesday. NOTETAKER 2 Regression

More information

STA 4273H: Statistical Machine Learning

STA 4273H: Statistical Machine Learning STA 4273H: Statistical Machine Learning Russ Salakhutdinov Department of Statistics! rsalakhu@utstat.toronto.edu! http://www.utstat.utoronto.ca/~rsalakhu/ Sidney Smith Hall, Room 6002 Lecture 5 Inference

More information