Local Run Manager Generate FASTQ Analysis Module
|
|
- Meghan Campbell
- 6 years ago
- Views:
Transcription
1 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide For Research Use Only. Not for se in diagnostic procedres. Overview 3 Set Parameters 3 Analysis Methods 5 View Analysis Reslts 5 Analysis Report 6 Analysis Otpt Files 6 Cstom Analysis Settings 9 Revision History 10 Technical Assistance 11 Docment # v01 Janary 2018 For Research Use Only. Not for se in diagnostic procedres. ILLUMINA PROPRIETARY
2 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"), and are intended solely for the contractal se of its cstomer in connection with the se of the prodct(s) described herein and for no other prpose. This docment and its contents shall not be sed or distribted for any other prpose and/or otherwise commnicated, disclosed, or reprodced in any way whatsoever withot the prior written consent of Illmina. Illmina does not convey any license nder its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this docment. The instrctions in this docment mst be strictly and explicitly followed by qalified and properly trained personnel in order to ensre the proper and safe se of the prodct(s) described herein. All of the contents of this docment mst be flly read and nderstood prior to sing sch prodct(s). FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY, AND WILL VOID ANY WARRANTY APPLICABLE TO THE PRODUCT(S). ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) Illmina, Inc. All rights reserved. All trademarks are the property of Illmina, Inc. or their respective owners. For specific trademark information, see Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 2
3 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Overview The Local Rn Manager Generate FASTQ analysis modle first demltiplexes indexed reads, if present, generates intermediate analysis files in the FASTQ file format, and then exits the workflow. No alignment or frther analysis is performed. FASTQ files are reqired inpt for analysis with third-party analysis tools. Compatible Library Types The Generate FASTQ analysis modle is compatible with specific library types represented by library kit categories on the Create Rn screen. For a crrent list of compatible library kits, see the Local Rn Manager spport page on the Illmina website. Inpt Reqirements The Generate FASTQ analysis modle reqires the base call files (*.bcl) and the rn smmary files generated dring the seqencing rn. Becase the workflow ends after FASTQ file generation, no other inpt files are reqired. Abot This Gide This gide provides instrctions for setting p rn parameters for seqencing and analysis parameters for the Generate FASTQ analysis modle. For information abot the Local Rn Manager dashboard and system settings, see the Local Rn Manager Software Gide (docment # ). Set Parameters 1 Select Create Rn, and then select Generate FASTQ. 2 Enter a rn name that identifies the rn from seqencing throgh analysis. The rn name can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. 3 [Optional] Enter a rn description to frther identify the rn. The rn description can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. Specify Rn Settings 1 Select a library prep kit from the Library Prep Kit drop-down list. 2 Specify the nmber of index reads. 0 for a rn with no indexing 1 for a single-indexed rn 2 for a dal-indexed rn If yor library prep kit spports only one option, the index read is atomatically selected. 3 Specify a read type: Single Read or Paired End. If yor library prep kit spports only one option, the read type is atomatically selected. 4 Enter the nmber of cycles for the rn. 5 [Optional] If sing cstom primers, specify their information. Cstom primer options may vary based on yor instrment or Local Rn Manager implementation. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 3
4 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Specify Modle-Specific Settings 1 Set the Adapter Trimming option. Adapter trimming is enabled by defalt. 2 Set the Reverse Complement option. Enabling this setting makes all reads reverse-complemented as they are written to FASTQ files. By defalt, the reverse complement setting is trned off. The availability of these settings depend on yor Library Prep kit, they are not available for every library prep kit option. Specify Samples for the Rn Specify samples for the rn sing the following options: Enter samples manally Use the blank table at the bottom of the Create Rn screen. Import sample sheet Navigate to an external file in a comma-separated vales (*.csv) format. After yo have poplated the samples table, yo can export the sample information to an external file. Yo can se this file as a reference when preparing libraries or import the file when configring another rn. Enter Samples Manally 1 Adjst the samples table to an appropriate nmber of rows. In the Rows field, se the p/down arrows or enter a nmber to specify the nmber of rows to add to the table. Select the + icon to add the rows to the table. Select the x icon to delete a row. Right-click on a row in the table and se the commands in the contextal men. 2 Enter a niqe sample ID in the Sample ID field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 3 [Optional] Enter a sample description in the Sample Description field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 4 If yo have a plated kit, select an index plate well from the Index well drop-down list. 5 Select an Index 1 adapter from the Index 1 (i7) drop-down list. Select Show Index Seqence/Show Index Names to toggle between showing the name of the index and the index seqence. 6 Select an Index 2 adapter from the Index 2 (i5) drop-down list. 7 Select a manifest file from the Manifest drop-down list. 8 [Optional] Enter a project name in the Sample Project field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 9 [Optional] Select Export Sample Sheet to export the sample information in *.csv format. The exported sample sheet can be sed as a template when creating new rns or imported for another rn. 10 Select Save Rn. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 4
5 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Import Sample Sheet 1 If yo do not have a sample sheet to import, see Enter Samples Manally on page 4 for instrctions on how to create and export a sample sheet. Edit the file as follows. a b c Open the sample sheet in a text editor. Enter the sample information in the [Data] section of the file. Save the file. Make sre that the sample IDs are niqe. 2 Select Import Sample Sheet at the top of the Create Rn screen and browse to the location of the sample information file. Make sre that the information in the manifest and sample sheet is correct. Incorrect information can impact the seqencing rn. 3 When finished, select Save Rn. Analysis Methods The Generate FASTQ analysis modle performs the following analysis steps and then writes analysis otpt files to the folder. Demltiplexes index reads Generates FASTQ files Demltiplexing Demltiplexing compares each Index Read seqence to the index seqences specified for the rn. No qality vales are considered in this step. Index reads are identified sing the following steps: Samples are nmbered starting from 1 based on the order they are listed for the rn. Sample nmber 0 is reserved for clsters that were not assigned to a sample. Clsters are assigned to a sample when the index seqence matches exactly. FASTQ File Generation After demltiplexing, the software generates intermediate analysis files in the FASTQ format, which is a text format sed to represent seqences. FASTQ files contain reads for each sample and the associated qality scores. Any controls sed for the rn and clsters that did not pass filter are exclded. Each FASTQ file contains reads for only one sample, and the name of that sample is inclded in the FASTQ file name. FASTQ files are the primary inpt for alignment. View Analysis Reslts 1 From the Local Rn Manager dashboard, select the rn name. 2 From the Rn Overview tab, review the seqencing rn metrics. 3 [Optional] Select the Copy to Clipboard icon to copy the otpt rn folder file path. 4 If yo want to change the file location of the analysis data for any ftre rns, select the Edit icon, and edit the otpt rn folder file path. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 5
6 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide The file path leading p to the otpt rn folder is editable. The otpt rn folder name cannot be changed. 5 Select the Seqencing Information tab to review rn parameters and consmables information. 6 Select the Samples and Reslts tab to view the analysis report. If analysis was reqeed, select the appropriate analysis from the Select Analysis drop-down list. From the left navigation bar, select a sample name to view the report for another sample. 7 [Optional] Select the Copy to Clipboard icon to copy the Analysis folder file path. Analysis Report Analysis reslts are provided on the Samples and Reslts tab. Indexing Table 1 Indexing Table Colmn Heading Index Nmber Sample ID Sample Description Index 1 (i7) Index 2 (i5) Description An assigned ID based on the order that samples are listed in the sample table. The sample ID provided when the rn was created. The sample description provided when the rn was created. The Index 1 adapter sed with the sample. The Index 2 adapter sed with the sample. Analysis Otpt Files The following analysis otpt files are generated for the Generate FASTQ analysis modle. File Name Demltiplexing (*.demx) FASTQ (*.fastq.gz) Description Intermediate files containing demltiplexing reslts. Intermediate files containing qality scored base calls. FASTQ files are the primary inpt for the alignment step. Demltiplexing File Format The process of demltiplexing reads the index seqence attached to each clster to determine from which sample the clster originated. The mapping between clsters and sample nmber is written to a demltiplexing (*.demx) file for each tile of the flow cell. The demltiplexing file naming format is s_1_x.demx, where X is the tile nmber. Demltiplexing files start with a header: Version (4 byte integer), crrently 1 Clster cont (4 byte integer) The remainder of the file consists of sample nmbers for each clster from the tile. When the demltiplexing step is complete, the software generates a demltiplexing file named DemltiplexSmmaryF1L1.txt. In the file name, F1 represents the flow cell nmber. In the file name, L1 represents the lane nmber. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 6
7 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Demltiplexing reslts in a table with one row per tile and one colmn per sample, inclding sample 0. The most commonly occrring seqences in index reads. FASTQ File Format FASTQ is a text-based file format that contains base calls and qality vales per read. Each record contains 4 lines: The identifier The seqence A pls sign (+) The Phred qality scores in an ASCII + 33 encoded format The identifier is formatted ReadNm:FilterFlag:0:SampleNmber 1:N:0:2 TCGCACTCAACGCCCTGCATATGACAAGACAGAATC + <>;##=><9=AAAAAAAAAA9#:<#<;<<<????#= FASTQ File Names FASTQ files are named with the sample name and the sample nmber. The sample nmber is a nmeric assignment based on the order that the sample is listed for the rn. For example:...\samplename_s1_l001_r1_001.fastq.gz samplename The sample name listed for the sample. If a sample name is not provided, the file name incldes the sample ID. S1 The sample nmber based on the order that samples are listed for the rn starting with 1. In this example, S1 indicates that this sample is the first sample listed for the rn. NOTE Reads that cannot be assigned to any sample are written to a FASTQ file for sample nmber 0, and exclded from downstream analysis. L001 The lane nmber. R1 The read. In this example, R1 means Read 1. For a paired-end rn, a file from Read 2 incldes R2 in the file name. When generated, the Index Reads are I1 or I The last segment is always 001. FASTQ files are compressed in the GNU zip format, as indicated by *.gz in the file name. FASTQ files can be ncompressed sing tools sch as gzip (command-line) or 7-zip (GUI). Spplementary Otpt Files The following otpt files provide spplementary information, or smmarize rn reslts and analysis errors. Althogh these files are not reqired for assessing analysis reslts, they can be sed for trobleshooting prposes. All files are located in the Alignment folder nless otherwise specified. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 7
8 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide File Name AdapterConts.txt AdapterTrimming.txt AnalysisLog.txt AnalysisError.txt CompletedJobInfo.xml DemltiplexSmmaryF1L1.txt GenerateFASTQRnStatistics.xml Description Contains a smmary of the nmber of reads that had adapter trimming performed per sample. Lists the nmber of trimmed bases and percentage of bases for each tile. This file is present only if adapter trimming was specified for the rn. Processing log that describes every step that occrred dring analysis of the crrent rn folder. This file does not contain error messages. Processing log that lists any errors that occrred dring analysis. This file will be empty if no errors occrred. Written after analysis is complete, contains information abot the rn, sch as date, flow cell ID, software version, and other parameters. Reports demltiplexing reslts in a table with 1 row per tile and 1 colmn per sample. Contains smmary statistics specific to the rn. Analysis Folder The analysis folder holds the files generated by the Local Rn Manager software. The relationship between the otpt folder and analysis folder is smmarized as follows: Dring seqencing, Real-Time Analysis (RTA) poplates the otpt folder with files generated dring image analysis, base calling, and qality scoring. RTA copies files to the analysis folder in real time. After RTA assigns a qality score to each base for each cycle, the software writes the file RTAComplete.xml to both folders. When the file RTAComplete.txt is present, analysis begins. As analysis contines, Local Rn Manager writes otpt files to the analysis folder, and then copies the files back to the otpt folder. Folder Strctre Data Alignment_## or Alignment_Imported_## [Timestamp of Rn] DataAccessFiles Fastq FastqSmmaryF1L1.txt Sample1_S1_L001_R1_001.fastq.gz Sample2_S2_L001_R2_001.fastq.gz Undetermined_S0_L001_R1_001.fastq.gz Undetermined_S0_L001_R2_001.fastq.gz Logging BildFastq0.stdot.txt BildFastq1.stdot.txt Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 8
9 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Plots commands.txt AdapterConts.txt AdapterTrimming.txt AnalysisError.txt AnalysisLog.txt Checkpoint.txt CompletedJobInfo.xml DemltiplexSmmaryF1L1.txt GenerateFASTQRnStatistics.xml SampleSheetUsed.csv Cstom Analysis Settings Cstom analysis settings are intended for technically advanced sers. If settings are applied incorrectly, serios problems can occr. Add a Cstom Analysis Setting 1 From the Modle-Specific Settings section of the Create Rn screen, select Show advanced modle settings. 2 Select Add cstom setting. 3 In the cstom setting field, enter the setting name as listed in the Available Analysis Settings section. 4 In the setting vale field, enter the setting vale. 5 To remove a setting, select the x icon. Available Analysis Settings Adapter Trimming By defalt, adapter trimming is enabled in the Generate FASTQ analysis modle. To specify a different adapter, se the Adapter setting. The same adapter seqence is trimmed for Read 1 and Read 2. To specify 2 adapter seqences, separate the seqences with a pls (+) sign. To specify a different adapter seqence for Read 2, se the AdapterRead2 setting. Setting Name Adapter AdapterRead2 Setting Vale Enter the seqence of the adapter to be trimmed. Enter the seqence of the adapter to be trimmed. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 9
10 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Revision History Docment Date Description of Change Docment # v01 Docment # v00 Janary 2018 Janary 2016 Updated software descriptions for Generate FASTQ v2.0, which incldes pdates to: Sample sheet import Otpt folder strctre Indexing table Removed Most Poplar Index Seqences table Spplementary otpt files Initial release. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 10
11 Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Technical Assistance For technical assistance, contact Illmina Technical Spport. Website: Illmina Cstomer Spport Telephone Nmbers Region Toll Free Regional North America Astralia Astria Belgim China Denmark Finland France Germany Hong Kong Ireland Italy Japan Netherlands New Zealand Norway Singapore Spain Sweden Switzerland Taiwan United Kingdom Other contries Safety data sheets (SDSs) Available on the Illmina website at spport.illmina.com/sds.html. Prodct docmentation Available for download in PDF from the Illmina website. Go to spport.illmina.com, select a prodct, then select Docmentation & Literatre. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 11
12 Docment # v01 Illmina 5200 Illmina Way San Diego, California U.S.A ILMN (4566) (otside North America) techspport@illmina.com For Research Use Only. Not for se in diagnostic procedres Illmina, Inc. All rights reserved.
Local Run Manager. Software Reference Guide for MiSeqDx
Local Rn Manager Software Reference Gide for MiSeqDx Local Rn Manager Overview 3 Dashboard Overview 4 Administrative Settings and Tasks 7 Workflow Overview 12 Technical Assistance 17 Docment # 1000000011880
More informationLocal Run Manager RNA Fusion
Local Rn Manager RNA Fsion Workflow Gide Overview 3 Install the RNA Fsion Analysis Modle 3 Set Parameters 4 Analysis Methods 6 View Analysis Reslts 7 Analysis Report 8 Analysis Otpt Files 9 Revision History
More informationIndexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
More informationIllumina LIMS. Software Guide. For Research Use Only. Not for use in diagnostic procedures. Document # June 2017 ILLUMINA PROPRIETARY
Illmina LIMS Software Gide Jne 2017 ILLUMINA PROPRIETARY This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"), and are intended solely for the contractal se of
More informationSequence Genotyper Reference Guide
Sequence Genotyper Reference Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Installation 4 Dashboard Overview 5 Projects 6 Targets 7 Samples 9 Reports 12 Revision History
More informationIndexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
More informationMiSeq. System Guide. For Research Use Only. Not for use in diagnostic procedures. Document # v04 Material # July 2018
MiSeq System Gide Docment # 15027617 v04 Material # 20024228 Jly 2018 ILLUMINA PROPRIETARY MiSeq System Gide This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"),
More informationMiniSeq. System Guide. For Research Use Only. Not for use in diagnostic procedures. Document # v02 Material # March 2018
MiniSeq System Gide Docment # 1000000002695 v02 Material # 20014309 March 2018 For Research Use Only. Not for se in diagnostic procedres. ILLUMINA PROPRIETARY MiniSeq System Gide This docment and its contents
More informationBlueFuse Multi v4.4 Installation Guide
BlueFuse Multi v4.4 Installation Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 3 Introduction 4 Supported Operating Systems 5 Hardware Requirements 6 Deployment Modes
More informationNextSeq 550. System Guide. For Research Use Only. Not for use in diagnostic procedures. Document # v04 May 2018 ILLUMINA PROPRIETARY
NextSeq 550 System Gide Docment # 15069765 v04 May 2018 For Research Use Only. Not for se in diagnostic procedres. ILLUMINA PROPRIETARY NextSeq 550 System Gide This docment and its contents are proprietary
More informationEMC ViPR. User Guide. Version
EMC ViPR Version 1.1.0 User Gide 302-000-481 01 Copyright 2013-2014 EMC Corporation. All rights reserved. Pblished in USA. Pblished Febrary, 2014 EMC believes the information in this pblication is accrate
More informationEMC M&R (Watch4net ) Installation and Configuration Guide. Version 6.4 P/N REV 02
EMC M&R (Watch4net ) Version 6.4 Installation and Configration Gide P/N 302-001-045 REV 02 Copyright 2012-2014 EMC Corporation. All rights reserved. Pblished in USA. Pblished September, 2014 EMC believes
More informationmtdna Variant Processor v1.0 BaseSpace App Guide
mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters
More informationEMC VNX Series. Problem Resolution Roadmap for VNX with ESRS for VNX and Connect Home. Version VNX1, VNX2 P/N REV. 03
EMC VNX Series Version VNX1, VNX2 Problem Resoltion Roadmap for VNX with ESRS for VNX and Connect Home P/N 300-014-335 REV. 03 Copyright 2012-2014 EMC Corporation. All rights reserved. Pblished in USA.
More informationIsilon InsightIQ. Version 2.5. User Guide
Isilon InsightIQ Version 2.5 User Gide Pblished March, 2014 Copyright 2010-2014 EMC Corporation. All rights reserved. EMC believes the information in this pblication is accrate as of its pblication date.
More informationHiSeq X. System Guide. For Research Use Only. Not for use in diagnostic procedures. Document # v06 Material # October 2017
HiSeq X System Gide Docment # 15050091 v06 Material # 20023569 October 2017 ILLUMINA PROPRIETARY HiSeq X System Gide This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"),
More informationComputer User s Guide 4.0
Compter User s Gide 4.0 2001 Glenn A. Miller, All rights reserved 2 The SASSI Compter User s Gide 4.0 Table of Contents Chapter 1 Introdction...3 Chapter 2 Installation and Start Up...5 System Reqirements
More informationiseq 100 Sequencing System Guide For Research Use Only. Not for use in diagnostic procedures. Document # v04 October 2018
iseq 100 Seqencing System Gide October 2018 ILLUMINA PROPRIETARY This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"), and are intended solely for the contractal
More informationEMC AppSync. User Guide. Version REV 01
EMC AppSync Version 1.5.0 User Gide 300-999-948 REV 01 Copyright 2012-2013 EMC Corporation. All rights reserved. Pblished in USA. EMC believes the information in this pblication is accrate as of its pblication
More informationL EGAL NOTICES. ScanSoft, Inc. 9 Centennial Drive Peabody, MA 01960, United States of America
L EGAL NOTICES Copyright 2002 by ScanSoft, Inc. All rights reserved. No part of this pblication may be transmitted, transcribed, reprodced, stored in any retrieval system or translated into any langage
More informationLDAP Configuration Guide
LDAP Configration Gide Content Content LDAP directories on Gigaset phones............................................... 3 Configration.....................................................................
More informationdss-ip Manual digitalstrom Server-IP Operation & Settings
dss-ip digitalstrom Server-IP Manal Operation & Settings Table of Contents digitalstrom Table of Contents 1 Fnction and Intended Use... 3 1.1 Setting p, Calling p and Operating... 3 1.2 Reqirements...
More informationEMC NetWorker Module for SAP
EMC NetWorker Modle for SAP Version 8.2 Installation Gide P/N 302-000-390 REV 02 Copyright 2009-2014 EMC Corporation. All rights reserved. Pblished in USA. Pblished Agst, 2014 EMC believes the information
More informationContent Safety Precaution... 4 Getting started... 7 Input method... 9 Using the Menus Use of USB Maintenance & Safety...
STAR -1- Content 1. Safety Precation... 4 2. Getting started... 7 Installing the cards and the Battery... 7 Charging the Battery... 8 3. Inpt method... 9 To Shift Entry Methods... 9 Nmeric and English
More informationEcoStudy Software User Guide
EcoStudy Software User Guide FOR RESEARCH USE ONLY What is EcoStudy? 3 Setting Up a Study 4 Specifying Analysis Settings for your Study 6 Reviewing the Data in your Study 8 Exporting Study Data to a Report
More informationContent Content Introduction
Content Content Introdction...................................................................... 3 Roles in the provisioning process............................................................... 4 Server
More informationCAPL Scripting Quickstart
CAPL Scripting Qickstart CAPL (Commnication Access Programming Langage) For CANalyzer and CANoe V1.01 2015-12-03 Agenda Important information before getting started 3 Visal Seqencer (GUI based programming
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationDSCS6020: SQLite and RSQLite
DSCS6020: SQLite and RSQLite SQLite History SQlite is an open sorce embedded database, meaning that it doesn t have a separate server process. Reads and writes to ordinary disk files. The original implementation
More informationNortel DECT Handset 4025 User Guide
DECT 4025 Nortel DECT Handset 4025 User Gide Revision history Revision history October 2005 Standard 2.00. This docment is p-issed to spport Nortel Commnication Server 1000 Release 4.5. Febrary 2005 Standard
More informationDoctor Web. All rights reserved
Enterprise Site 2004-2009 Doctor Web. All rights reserved This docment is the property of Doctor Web. No part of this docment may be reprodced, pblished or transmitted in any form or by any means for any
More informationTdb: A Source-level Debugger for Dynamically Translated Programs
Tdb: A Sorce-level Debgger for Dynamically Translated Programs Naveen Kmar, Brce R. Childers, and Mary Lo Soffa Department of Compter Science University of Pittsbrgh Pittsbrgh, Pennsylvania 15260 {naveen,
More informationUSER S GUIDE: SPRINT RELAY CUSTOMER PROFILE
USER S GUIDE: SPRINT RELAY CUSTOMER PROFILE www.mysprintrelay.com/login n Log-in Go to www.mysprintrelay.com/login. If yo don t have a sername or password, click the gray men btton Cstomer New Profile/Call
More informationRequirements Engineering. Objectives. System requirements. Types of requirements. FAQS about requirements. Requirements problems
Reqirements Engineering Objectives An introdction to reqirements Gerald Kotonya and Ian Sommerville To introdce the notion of system reqirements and the reqirements process. To explain how reqirements
More informationGigaset M34 USB Ya-LBA / englisch / A31008-M403-R / cover_front.fm / User Manual
User Manal Contents Contents For yor safety.............................. 4 Notes on the operating instrctions....................................... 4 Safety precations.....................................................
More informationUnit Testing with VectorCAST and AUTOSAR
Unit Testing with VectorCAST and AUTOSAR Vector TechDay Software Testing with VectorCAST V1.0 2018-11-15 Agenda Introdction Unit Testing Demo Working with AUTOSAR Generated Code Unit Testing AUTOSAR SWCs
More informationDI-80. When Accuracy Counts
DI-80 Indi cator When Accracy Conts Operation Manal 73357 CONTENTS 1. INTRODUCTION...3 1.1. Display...3 1.2. A/D Section...3 1.3. Item Memory...3 1.4. Environment...4 1.5. Interface...4 1.6. Option...4
More informationWhat s New in AppSense Management Suite Version 7.0?
What s New in AMS V7.0 What s New in AppSense Management Site Version 7.0? AppSense Management Site Version 7.0 is the latest version of the AppSense prodct range and comprises three prodct components,
More informationBIS - Access Engine (ACE)
Engineered Soltions BIS - Access Engine (ACE) BIS - Access Engine (ACE) www.boschsecrity.com Sophisticated access control with direct alarm management Seamless integration and interaction with video, fire,
More informationBIS - Basic package V4.3
Engineered Soltions BIS - Basic package V4.3 BIS - Basic package V4.3 www.boschsecrity.com Integration of Bosch and third party systems throgh deployment of OPC All relevant information in one ser interface
More informationCOPYRIGHTED MATERIAL. Recording Macros and Getting Started with VBA. Part 1
Part 1 Recording Macros and Getting Started with VBA Chapter 1: Recording and Rnning Macros in the Office Applications Chapter 2: Getting Started with the Visal Basic Editor Chapter 3: Editing Recorded
More information(2, 4) Tree Example (2, 4) Tree: Insertion
Presentation for se with the textbook, Algorithm Design and Applications, by M. T. Goodrich and R. Tamassia, Wiley, 2015 B-Trees and External Memory (2, 4) Trees Each internal node has 2 to 4 children:
More informationBIS - Basic Package V4.4
Engineered Soltions BIS - Basic Package V4.4 BIS - Basic Package V4.4 www.boschsecrity.com Integration of Bosch and third party systems via open interfaces and SDK All relevant information in one ser interface
More informationAbout This Manual Copyright Copyright 2017 ZTE CORPORATION All rights reserved. Notice Disclaimer
User Manal 1 Abot This Manal Thank yo for choosing this ZTE mobile device. In order to keep yor device in its best condition, please read this manal and keep it for ftre reference. Copyright Copyright
More informationMulti-lingual Multi-media Information Retrieval System
Mlti-lingal Mlti-media Information Retrieval System Shoji Mizobchi, Sankon Lee, Fmihiko Kawano, Tsyoshi Kobayashi, Takahiro Komats Gradate School of Engineering, University of Tokshima 2-1 Minamijosanjima,
More informationBIS - Basic package V4.2
Engineered Soltions BIS - Basic package V4.2 BIS - Basic package V4.2 www.boschsecrity.com Integration of Bosch and third party systems throgh deployment of OPC All relevant information in one ser interface
More informationPeristaltic Cased Tube Pump
Peristaltic Cased Tbe Pmp Original Operating Manal Version Print-No. 01 1.1v-09/2016 Version 1.1v-09/2016 Print-No. 01 The information in this docment is essential for the safe operation and servicing
More informationDPDK s Best Kept Secret: Micro-benchmarks. M Jay DPDK Summit - San Jose 2017
DPDK s Best Kept Secret: Micro-benchmarks M Jay Mthrajan.Jayakmar@intel.com DPDK Smmit - San Jose 2017 Legal Information Optimization Notice: Intel s compilers may or may not optimize to the same degree
More informationDialog 4106 Basic/Dialog 4147 Medium
Analog Telephones for MD110 and MX-ONE Telephony System User Gide Cover Page Graphic Place the graphic directly on the page, do not care abot ptting it in the text flow. Select Graphics > Properties and
More informationHardware-Accelerated Free-Form Deformation
Hardware-Accelerated Free-Form Deformation Clint Cha and Ulrich Nemann Compter Science Department Integrated Media Systems Center University of Sothern California Abstract Hardware-acceleration for geometric
More informationBIS - Basic Package V4.6
Engineered Soltions BIS - Basic Package V4.6 BIS - Basic Package V4.6 www.boschsecrity.com The Bilding Integration System (BIS) BIS is a flexible, scalable secrity and safety management system that can
More informationLTC 8500 Series Allegiant Matrix/Control Systems - Modular
Video LTC 85 Series Allegiant Matrix/Control Systems - Modlar LTC 85 Series Allegiant Matrix/Control Systems - Modlar www.boschsecrity.com 64 Camera by 8 monitor switching 8 Independent keyboards Modlar
More informationAccess Professional Edition 2.1
Engineered Soltions Access Professional Edition 2.1 Access Professional Edition 2.1 www.boschsecrity.com Compact access control based on Bosch s innovative AMC controller family Integrated Video Verification
More informationMembership Library in DPDK Sameh Gobriel & Charlie Tai - Intel DPDK US Summit - San Jose
Membership Library in DPDK 17.11 Sameh Gobriel & Charlie Tai - Intel DPDK US Smmit - San Jose - 2017 Contribtors Yipeng Wang yipeng1.wang@intel.com Ren Wang ren.wang@intel.com John Mcnamara john.mcnamara@intel.com
More informationDIVAR IP U. Video DIVAR IP U.
Video DIVAR IP 6000 2U DIVAR IP 6000 2U RAID-5 protected (standard configration), all-in-one recording soltion for p to 128 channels Pre-installed, pre-configred IP storage soltion with p to 32 TB storage
More informationDIVAR IP U. Video DIVAR IP U.
Video DIVAR IP 6000 3U DIVAR IP 6000 3U www.boschsecrity.com RAID-5 protected (standard configration), all-in-one recording soltion for p to 128 channels Pre-installed, pre-configred IP storage soltion
More informationA choice relation framework for supporting category-partition test case generation
Title A choice relation framework for spporting category-partition test case generation Athor(s) Chen, TY; Poon, PL; Tse, TH Citation Ieee Transactions On Software Engineering, 2003, v. 29 n. 7, p. 577-593
More informationLocal Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
More informationLTC 8500 Series Allegiant Matrix/Control Systems - Modular
Video LTC 85 Series Allegiant Matrix/Control Systems - Modlar LTC 85 Series Allegiant Matrix/Control Systems - Modlar www.boschsecrity.com 64 Camera by 8 monitor switching 8 Independent keyboards Modlar
More informationRKP6200 S32 Server License
Engineered Soltions RKP6200 S32 Server License RKP6200 S32 Server License wwwboschsecritycom Enhanced Imaging Image export Spport for 64 bit credential nmbers iclass integration with Smart Card encoding
More informationMaster for Co-Simulation Using FMI
Master for Co-Simlation Using FMI Jens Bastian Christoph Claß Ssann Wolf Peter Schneider Franhofer Institte for Integrated Circits IIS / Design Atomation Division EAS Zenerstraße 38, 69 Dresden, Germany
More informationEMC ViPR. Controller REST API Developer Guide. Version
EMC ViPR Version 1.1.0 Controller REST API Developer Gide 302-000-496 01 Copyright 2013-2014 EMC Corporation. All rights reserved. Pblished in USA. Pblished Febrary, 2014 EMC believes the information in
More informationFeatures. ICMS Integrated Corrosion Management System
ICMS Integrated Corrosion System Featres Total Corrosion Data Data Exhange with DCS/PCS/SCADA Systems Correlate Corrosion & Process Data Enables Highly Cost-Effective Asset Designed Specifically for Corrosion
More informationHP 9000 Series 300 Computers. Using and Administering NFS Services
HP 9000 Series 300 Compters Using and Administering NFS Services Using and Administering NFS Services HP 9000 Series 300 FJ/o- HEWLETT ~all PACKARD Manal Part Nmber: 50969-90001 Printed in U.S.A., Janary
More informationLTC 8600 Series Allegiant Matrix/Control Systems - Modular
Video 86 Series Allegiant Matrix/Control Systems - Modlar 86 Series Allegiant Matrix/Control Systems - Modlar www.boschsecrity.com 128 Camera by 16 monitor switching Modlar constrction Powerfl alarm handling
More informationFT3. Testing Systems. Precision Thickness Gauge.
Testing Systems www.igt.nl FT3 Precision Thickness Gage Accrate and repeatable thickness measrements Compliant to a mltiple standards Choice of configration FT3 Precision Thickness Gage P R E C I S E L
More informationDIVAR IP U. Video DIVAR IP U.
Video DIVAR IP 7000 3U DIVAR IP 7000 3U www.boschsecrity.com RAID-5 protected (standard configration), all-in-one video management soltion for p to 128 channels Ot-of-the-box IP video management soltion
More informationNetworks An introduction to microcomputer networking concepts
Behavior Research Methods& Instrmentation 1978, Vol 10 (4),522-526 Networks An introdction to microcompter networking concepts RALPH WALLACE and RICHARD N. JOHNSON GA TX, Chicago, Illinois60648 and JAMES
More informationCS 153 Design of Operating Systems
CS 153 Design of Operating Systems Spring 18 Lectre 3: OS model and Architectral Spport Instrctor: Chengy Song Slide contribtions from Nael Ab-Ghazaleh, Harsha Madhyvasta and Zhiyn Qian Last time/today
More informationAN2667 Application note
Application note STM8A GPIO application examples Introduction This document is intended to provide two practical application examples of the GPIO peripheral use in the STM8A device. The examples are: Toggling
More informationSafety. Introduction
KickStart Guide Safety Introduction Safety precautions Before using this product, see the safety precautions associated with your instrument. The instrumentation associated with this software is intended
More informationDialog 4106 Basic/Dialog 4147 Medium
Analog Telephones for MX-ONE Telephony Server User Gide Grafik af dem Deckblatt Platzieren Sie die Grafik direkt af der Seite nd nicht im Textflss. Wählen Sie Grafik > Eigenschaften, nd nehmen Sie die
More informationFunctions of Combinational Logic
CHPTER 6 Fnctions of Combinational Logic CHPTER OUTLINE 6 6 6 6 6 5 6 6 6 7 6 8 6 9 6 6 Half and Fll dders Parallel inary dders Ripple Carry and Look-head Carry dders Comparators Decoders Encoders Code
More informationSTEVAL-CCM002V1. TFT-LCD panel demonstration board based on the STM32 as LCD controller. Features. Description
TFT-LCD panel demonstration board based on the STM32 as LCD controller Data brief Features Displays images on a TFT-LCD using the STM32 as LCD controller Includes a slideshow of images to demonstrate static
More informationCS 153 Design of Operating Systems Spring 18
CS 153 Design of Operating Systems Spring 18 Lectre 12: Deadlock Instrctor: Chengy Song Slide contribtions from Nael Ab-Ghazaleh, Harsha Madhyvasta and Zhiyn Qian Deadlock the deadly embrace! Synchronization
More informationLocal Run Manager Amplicon Analysis Module Workflow Guide
Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report
More informationIDENTIFICATION OF THE AEROELASTIC MODEL OF A LARGE TRANSPORT CIVIL AIRCRAFT FOR CONTROL LAW DESIGN AND VALIDATION
ICAS 2 CONGRESS IDENTIFICATION OF THE AEROELASTIC MODEL OF A LARGE TRANSPORT CIVIL AIRCRAFT FOR CONTROL LAW DESIGN AND VALIDATION Christophe Le Garrec, Marc Hmbert, Michel Lacabanne Aérospatiale Matra
More information4.13 Advanced Topic: An Introduction to Digital Design Using a Hardware Design Language 345.e1
.3 Advanced Topic: An Introdction to Digital Design Using a Hardware Design Langage 35.e.3 Advanced Topic: An Introdction to Digital Design Using a Hardware Design Langage to Describe and odel a Pipeline
More informationDIVAR hybrid 5000 recorder
Video DIVAR hybrid 5000 recorder DIVAR hybrid 5000 recorder www.boschsecrity.com APP H.265 Hybrid recording of p to 16 IP and 16 analog channels Extended rack-mont nit with advanced connections 12 MP IP
More informationAN2143 Application note
AN2143 Application note Programming the ST10F27X embedded Flash using the ST10FLASHER tool Introduction This document summarizes the different steps needed to program the internal Flash memory of the ST10F27x
More informationVRM Video Recording Manager
Video VRM Video Recording Manager VRM Video Recording Manager www.boschsecrity.com 24/7 Distribted storage and configrable load balancing iscsi disk array failover for extra reliability Used with all Bosch
More informationDIVAR IP U. Video DIVAR IP U.
Video DIVAR IP 7000 2U DIVAR IP 7000 2U www.boschsecrity.com RAID-5 protected (standard configration), all-in-one video management soltion for p to 128 channels Ot-of-the-box IP video management soltion
More informationDIVAR IP Video DIVAR IP Remote viewing via Video Security App and Video Security Client from Bosch
Video DIVAR IP 5000 DIVAR IP 5000 www.boschsecrity.com Remote viewing via Video Secrity App and Video Secrity Client from Bosch Flly featred video recording soltion for p to 32 channels Ot-of-the-box IP
More informationResolving Linkage Anomalies in Extracted Software System Models
Resolving Linkage Anomalies in Extracted Software System Models Jingwei W and Richard C. Holt School of Compter Science University of Waterloo Waterloo, Canada j25w, holt @plg.waterloo.ca Abstract Program
More informationAN626 Application note
Application note Serial EEPROM product numbering This application note provides a detailed description of the part numbering scheme of Serial EEPROM products. The part numbering scheme consists of a maximum
More informationDIVAR IP U. Video DIVAR IP U.
Video DIVAR IP 7000 3U DIVAR IP 7000 3U www.boschsecrity.com RAID-5 protected (standard configration), all-in-one video management soltion for p to 128 channels Ot-of-the-box IP video management soltion
More informationGETTING STARTED WITH THE MINIMED 640G INSULIN PUMP
GETTING STARTED WITH THE MINIMED 640G INSULIN PUMP TABLE OF CONTENTS Section 1: Getting Started...3 Getting Started with the MiniMed 640G Inslin Pmp... 3 1.1 Pmp Mechanics and the Delivery of Inslin...
More informationUploading protocols and Assay Control Sets to the QIAsymphony SP via the USB stick
Uploading protocols and Assay Control Sets to the QIAsymphony SP via the USB stick This document describes how to upload protocols and Assay Control Sets to the QIAsymphony SP using the USB stick supplied
More informationAUTOSAR Diagnostic Extract
AUTOSAR Diagnostic Extract The Standard in Practice V1.0 2016-09-12 Agenda Diagnostic Processes in Place AUTOSAR DEXT Introdction Possibilities with DEXT in Diagnostic Tools Diagnostic Processes with DEXT
More informationAusRegistry EOM Report for General Release High-Level Scorecard
As EOM Report for General Release High-Level Scorecard Janary-16 Registrations -. Transactions Renewals Registrant Transfers Score % Domains Jan-1 Jan-1 31 38 7697.3 193 136 187 11.1 7873 786 691. 919
More informationVRM Video Recording Manager v3.0
Video VRM Video Recording Manager v3.0 VRM Video Recording Manager v3.0 www.boschsecrity.com Distribted storage and configrable load balancing iscsi disk array failover for extra reliability Used with
More informationComputer-Aided Mechanical Design Using Configuration Spaces
Compter-Aided Mechanical Design Using Configration Spaces Leo Joskowicz Institte of Compter Science The Hebrew University Jersalem 91904, Israel E-mail: josko@cs.hji.ac.il Elisha Sacks (corresponding athor)
More informationAnalog Telephones. User Guide. BusinessPhone Communication Platform
Analog Telephones BsinessPhone Commnication Platform User Gide Cover Page Graphic Place the graphic directly on the page, do not care abot ptting it in the text flow. Select Graphics > Properties and make
More informationPavlin and Daniel D. Corkill. Department of Computer and Information Science University of Massachusetts Amherst, Massachusetts 01003
From: AAAI-84 Proceedings. Copyright 1984, AAAI (www.aaai.org). All rights reserved. SELECTIVE ABSTRACTION OF AI SYSTEM ACTIVITY Jasmina Pavlin and Daniel D. Corkill Department of Compter and Information
More informationDistributed Systems Security. Authentication Practice - 2. Prof. Steve Wilbur
Distribted Systems Secrity Athentication Practice - 2 Prof. Steve Wilbr s.wilbr@cs.cl.ac.k MSc in Data Commnications Networks and Distribted Systems, UCL Lectre Objectives Examine X.509 as a practical
More informationMVM BVRM Video Recording Manager v2.20
Video MVM BVRM Video Recording Manager v2.20 MVM BVRM Video Recording Manager v2.20 www.boschsecrity.com Distribted storage and configrable load balancing iscsi disk array failover for extra reliability
More informationU85026A Detector 40 to 60 GHz
Operating and Service Manual U85026A Detector 40 to 60 GHz Serial Numbers This manual applies directly to U85026A detectors with serial numbers 100 and above. For additional information on serial numbers,
More informationFiber Optic Media Converters
Video iber Optic edia Converters iber Optic edia Converters Utilizes Small orm-factor Plggable (SP) modles lti-mode and single-mode modles available Spports distances p to 20 km (12.4 miles) Srface mont
More informationThe best decision leaves you options
From Eye to Insight Digital HD Microscope Cameras The best decision leaves yo options The Leica MC170 HD and Leica MC190 HD 2 Easy. Fast. Brilliant. Fast and precise HD live preview images right on yor
More informationThe single-cycle design from last time
lticycle path Last time we saw a single-cycle path and control nit for or simple IPS-based instrction set. A mlticycle processor fies some shortcomings in the single-cycle CPU. Faster instrctions are not
More information