Bioinformatics in next generation sequencing projects
|
|
- Domenic Hancock
- 6 years ago
- Views:
Transcription
1 Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011
2 Once sequenced the problem becomes computational Computational analyses is the bottleneck Rapid improvement in sequencing Still need for customized analysis for most projects
3 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping (Assembly) Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses
4 Preliminary Analyses Sequences and Real Time Analysis Quality scores Raw Image (TB) Text File (GB) Platform-specific analysis using the vendors programs
5 Sequenced reads Fasta file: >EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC Read identifier Fastq file: - EAS269:1:120:1786:18#0/1 GAACTCTGCCTTTTTCAGTGATGAGGAAAGGAGTTCTCTCTGGTCCCCAG +HWI - EAS269:1:120:1786:18#0/1 aaab^_u_aa [ U [ _Z ] a `WU_^X `GT^_ \ TM^ ^ \ \ Z \ YQVVXUBBBB Quality scores csfasta file >1_39_146_F3 T >1_39_194_F3 T SOLiD, QV file >1_39_146_F >1_39_194_F
6 Phred Quality Score, Q Each base call has an estimate of the probability of being wrong (error probability, p) Q = -10 * log 10 (p) Phred Quality Score Probability of incorrect base call Base call accuracy 10 1 in % 20 1 in % 30 1 in % 40 1 in % 50 1 in %
7 FastQ encodings Sanger FastQ: Phred score from 0-93 using the ASCII characters Solexa (+1.3 pipeline): Phred score from 0-62 using the ASCII characters 0-62 Solexa (older pipelines): Solexa score using ASCII characters -5 to 62 }~ S - Sanger Phred+33, 41 values (0, 40) I - Illumina 1.3 Phred+64, 41 values (0, 40) X - Solexa Solexa+64, 68 values (-5, 62)
8 Fastq quality control (FastQC) Video tutorial:
9 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping Assembly Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses
10 Short Read Assembly Velvet and SOAPdenovo de novo genomic assembler specially designed for short read sequencing technologies Nature 2009
11 Human Genome Assembly UCSC Genome Browser
12 Mapping of reads Task: Map millions of short sequences ( nt) onto a genome (3 000 Mbp ) or transcriptome Computationally feasible Mismatches (sequencing errors and SNPs) Unique / Repetitive matches Indels (Normal variation, CNVs) Large rearrangements (translocations) BLAST, BLAT tools not designed for these tasks
13 MAQ bowtie
14 Commonly used programs Program Approach Comments Bowtie Burrow-Wheeler Transformation (BWT) Illumina, (SOLiD), fast MAQ Spaced Seed Indexing Illumina, (SOLiD), SNPs BWA Novoalign Burrow-Wheeler Transformation (BWT) Needleman-Wunch Alignment Illumina, (SOLiD), indels Illumina, indels, slower, free (single proc mode) ZOOM Designed spaced seeds Illumina, fast, indels, not free Mappers from Illumina (ELAND) and SOLiD (bioscope/mapreads)
15 Paired reads mapping can be more accurate 2 mismatches Exact match Bowtie reports the best alignment it comes across, but this isn t always the right one. To do a better job, we want paired end reads
16 Storing mapped Alignments Formats for storing alignments should include: genomic coordinates mismatches, insertion, deletions etc. quality information
17 Samtools Sequence Alignment Map (SAM) Generic Alignment format Supports long and short reads Human readable, flexible and compact Emerging standard Li H.*, Handsaker B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. BioinformaScs, 25, [PMID: ] h"p://samtools.sourceforge.net/
18 SAM Example Bit field, where 16 means reverse strand Alignment structure. Here: 22 aligned bases, then 731 bases intron, then 28 aligned bases Start position HWI - EAS269:1:114:1242:1582#0 16 chr Y M731N28M * 0 0 ATTTCGACCATGATCATCGAACCTTCCCCTGGATCCACTTCCACGATCAC #9 ;; -7 +2@4 : 2=20-14= : ><?< ;; : BB? : 4<BB?ABBBBABCBBBBC=BB NM: i : 0 XS: A:-
19 CIGAR Format M, match/ mismatch I, insertion D, deletion S, softclip Ref: GCATTCAGATGCAGTACGC Read: cctcag--gcagtagtg Pos: 5 CIGAR: 2S4M3D6M3S...
20 Samtools for SAM/BAM files Library and software package (C, Java) Creating, sorting, indexing SAM & BAM Visualizing alignments in command SNP calling Short indel detection BAM (Binary representation of SAM) ~25% file size reduction
21 Overview of computational analyses genome sequence assembled contig RNA-Seq expression levels ChIP-Seq peak calling Primary Analyses: Image analysis Base calling Mapping Assembly Data type specific analyses (e.g. peak calling, calculate expression) Custom project specific analyses
22 Visualization Integrated Genome Viewer (Broad Inst.) Custom tracks at UCSC Genome Browser
23 Visualization
24 Integrated Genome Viewer Imports many mentioned formats (SAM, BAM, BED etc) Excellent for visualization of RNA-Sequencing or ChIP-sequencing data Can also download/visualize data from public or private servers
25 UCSC Genome Browser Recently introduced new formats for efficient viewing of large data sets: - BedGraph - BigWig Add as custom tracks (slower)
26 Peak characteristics differ with signal
27 Peak characteristics differ with signal H3K4me3: Sharp promoter peaks H3K36me3: Broad transcription elongation signal
28 Important file formats Sequences: FastQ Aligned reads: SAM/BAM Genome annotations: Bed, Gff Coverage: Wig, (Tdf)
29 BED format chrom - The name of the chromosome (e.g. chr3, chry, chr2_random) or scaffold (e.g. scaffold10671). chromstart - The starsng posison of the feature in the chromosome or scaffold. The first base in a chromosome is numbered 0. chromend - The ending posison of the feature in the chromosome or scaffold. The chromend base is not included in the display of the feature. For example, the first 100 bases of a chromosome are defined as chromstart=0, chromend=100, and span the bases numbered track name=pairedreads description="clone Paired Reads" usescore=1 chr
30 BED continued track name=pairedreads description="clone Paired Reads" usescore=1 chr cloneb ,399, 0,3601 strand - Defines the strand - either '+' or '-'. thickstart - The starting position at which the feature is drawn thickly (for example, the start codon in gene displays). thickend - The ending position at which the feature is drawn thickly (for example, the stop codon in gene displays). itemrgb - An RGB value of the form R,G,B (e.g. 255,0,0). If the track line itemrgb attribute is set to "On", this RBG value will determine the display color of the data contained in this BED line. NOTE: It is recommended that a simple color scheme (eight colors or less) be used with this attribute to avoid overwhelming the color resources of the Genome Browser and your Internet browser. blockcount - The number of blocks (exons) in the BED line. blocksizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockcount. blockstarts - A comma-separated list of block starts. All of the blockstart positions should be calculated relative to chromstart. The number of items in this list should correspond to blockcount.
31 WIG format Wiggle format (WIG) allows the display of continuous-valued data in a track format Variable step variablestep chrom=chr is equivalent to: variablestep chrom=chr2 span= Fixed step fixedstep chrom=chr3 start= step=
32 Data Repositories Short Read Archive (fastq) [discontinued!] European Nucleotide Archive Gene Expression Omnibus (bed, wig, fastq)
33 SEQAnswers, an active forum for discussions on next-generation sequencing methods and bioinformatics
34
35 Visual inspection is critical
36 RNA-Seq analysis
Advanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationGenome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14
2014 - BMMB 852D: Applied Bioinforma;cs Week 12, Lecture 24 István Albert Biochemistry and Molecular Biology and Bioinforma;cs Consul;ng Center Penn State Genome representa;on concepts At the simplest
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationA short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationSequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationNext generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationGenetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationEasy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
More informationFrom the Schnable Lab:
From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationGoal: Learn how to use various tool to extract information from RNAseq reads.
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
More informationAccurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing
Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationThe UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationFrom genomic regions to biology
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationBioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
More informationGPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationMapping reads to a reference genome
Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture
More informationSlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching
SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationThe BEDTools manual. Aaron R. Quinlan and Ira M. Hall University of Virginia. Contact:
The BEDTools manual Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 6 1.1 BACKGROUND...6 1.2 SUMMARY OF AVAILABLE TOOLS...7 1.3 FUNDAMENTAL CONCEPTS
More informationThe BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia
The BEDTools manual Last updated: 21-September-2010 Current as of BEDTools version 2.10.0 Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 7 1.1 BACKGROUND...7
More informationRCAC. Job files Example: Running seqyclean (a module)
RCAC Job files Why? When you log into an RCAC server you are using a special server designed for multiple users. This is called a frontend node ( or sometimes a head node). There are (I think) three front
More informationRead Naming Format Specification
Read Naming Format Specification Karel Břinda Valentina Boeva Gregory Kucherov Version 0.1.3 (4 August 2015) Abstract This document provides a standard for naming simulated Next-Generation Sequencing (Ngs)
More informationseqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA
seqcna: A Package for Copy Number Analysis of High-Throughput Sequencing Cancer DNA David Mosen-Ansorena 1 October 30, 2017 Contents 1 Genome Analysis Platform CIC biogune and CIBERehd dmosen.gn@cicbiogune.es
More informationChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationBIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data
BIOINFORMATICS Vol. 00 no. 00 2010 Pages 1 6 Savant: Genome Browser for High Throughput Sequencing Data Marc Fiume 1,, Vanessa Williams 1, and Michael Brudno 1,2 1 Department of Computer Science, University
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More informationAtlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
More informationToday's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
More informationUser's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
More informationAligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
More informationTiling Assembly for Annotation-independent Novel Gene Discovery
Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationGSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
More informationUsing Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationShort Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
More informationBriefly: Bioinformatics File Formats. J Fass September 2018
Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /
More informationTutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
More informationScalable RNA Sequencing on Clusters of Multicore Processors
JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA
More informationSolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationAnalysis of high-throughput sequencing data. Simon Anders EBI
Analysis of high-throughput sequencing data Simon Anders EBI Outline Overview on high-throughput sequencing (HTS) technologies, focusing on Solexa's GenomAnalyzer as example Software requirements to works
More informationChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationv0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationRASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual
RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual July 02, 2015 1 Index 1. System requirement and how to download RASER source code...3 2. Installation...3 3. Making index files...3
More informationLong Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
More informationmerantk Version 1.1.1a
DIVISION OF BIOINFORMATICS - INNSBRUCK MEDICAL UNIVERSITY merantk Version 1.1.1a User manual Dietmar Rieder 1/12/2016 Page 1 Contents 1. Introduction... 3 1.1. Purpose of this document... 3 1.2. System
More informationDocumentation of S MART
Documentation of S MART Matthias Zytnicki March 14, 2012 Contents 1 Introduction 3 2 Installation and requirements 3 2.1 For Windows............................. 3 2.2 For Mac................................
More informationOmega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationRNASeq2017 Course Salerno, September 27-29, 2017
RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials
More informationAccessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
More informationCycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)
Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload
More information- 1 - Web page:
J-Circos Manual 2014-11-10 J-Circos: A Java Graphic User Interface for Circos Plot Jiyuan An 1, John Lai 1, Atul Sajjanhar 2, Jyotsna Batra 1,Chenwei Wang 1 and Colleen C Nelson 1 1 Australian Prostate
More information